5 results about "Fenvalerate" patented technology

The application discloses a nucleic acid aptamer for simultaneously identifying three pyrethroid pesticides and an evaluation method and application thereof, the nucleic acid aptamer is nucleic acid aptamer seq-7, and the nucleotide sequence is 5'-GCCATCTTTGATTGGAATGGCGGTGTCCGTGTTGCGCCATCGTCGGAGG CAAGATCAAGGTTGTGGCACC-3'. The nucleic acid aptamer is screened based on the Capture-SELEX technology, and the nucleic acid aptamer can simultaneously combine lambda-cyhalothrin, cyfluthrin and fenvalerate with high affinity, the application effectively overcomes the limitation that the existing nucleic acid aptamer technology can only identify a single pyrethroid pesticide, and provides a new method and new technology for simultaneously detecting and screening the three pesticide residues rapidly, at low cost, with high sensitivity and without interference. The aptamer not only has high specificity and affinity, but also can accurately detect the target pesticide in a complex sample background, remarkably improves the detection efficiency, reduces experimental cost and time, promotes the development of rapid detection technology, and has a wide application prospect.

The invention provides a pesticide composition containing a pyrethroid compound, which consists of a compound with a structural formula (I) and a second effective component, the second effective component is bifenthrin, beta-cyhalothrin, fenpropathrin, beta-cyhalothrin, beta-cyhalothrin, beta-cyhalothrin, cypermethrin, cyfluthrin, deltamethrin, ethofenprox, fenvalerate or cis-cypermethrin, and the weight ratio of the bifenthrin, the beta-cyhalothrin, the fenpropathrin, the fenvalerate and the cis-cypermethrin is (1-50): (1-50). The invention also provides application of the pesticide composition in prevention and control of agricultural and forestry pests, especially phyllotreta striolata, ostrinia nubilalis or tetranychus cinnabarinus. The invention verifies that a remarkable synergistic effect can be obtained by compounding the flufenoxanil and the pyrethroid insecticide in a proper proportion, the effects of improving the control effect, reducing the dosage and expanding the insecticidal spectrum are realized, and the composition has an excellent control effect on target pests such as chilo suppressalis, plutella xylostella, green peach aphid, beet armyworm, ostrinia nubilalis, thrips, flea beetle and tetranychid mites, and has a good control effect on the target pests such as chilo suppressalis, plutella xylostella, green peach aphid, beet armyworm, ostrinia nubilalis. (I).

The invention relates to the technical field of biological medicine, in particular to a pharmaceutical composition for preventing or relieving sperm motor dysfunction caused by fenvalerate, and the pharmaceutical composition comprises N-acetylcysteine and / or cyclosporin A. Based on the discovery that fenvalerate induces rise of reactive oxygen species (ROS) to cause mitochondrial dysfunction and destroy a cAMP / PKA signaling pathway so as to inhibit sperm motility and induce mitochondrial apoptosis. An in-vitro rat sperm model proves that NAC and CsA can effectively reverse sperm motility reduction, ATP / cAMP level reduction, mitochondrial membrane potential dissipation and cell apoptosis caused by fenvalerate. The invention provides a new prevention and treatment strategy for treating male reproductive function damage caused by exposure of pyrethroid pesticides.

The invention discloses a lyotropic liquid crystal nanoparticle, a nano pesticide and application of the lyotropic liquid crystal nanoparticle and the nano pesticide. Mixing glycerol monooleate, oleic acid and the polyoxyethylene polyoxypropylene ether triblock copolymer, and heating to obtain a blend; and adding a buffer solution into the blend, homogenizing, adjusting the pH value, and standing to obtain the lyotropic liquid crystal nanoparticles. The nano pesticide is obtained by taking lyotropic liquid crystal as a carrier and loading an insecticide S-fenvalerate. The lyotropic liquid crystal is prepared from glycerol monooleate, oleic acid and polyoxyethylene polyoxypropylene ether triblock copolymer through self-assembly, hydrophilic groups and hydrophobic groups are contained between layers of the lyotropic liquid crystal, and the lyotropic liquid crystal can be combined with an insecticide containing the hydrophilic groups or the hydrophobic groups, so that the nano pesticide is obtained by loading the insecticide. The prepared nano pesticide has excellent wettability and stability, and the lyotropic liquid crystal serves as a novel pesticide carrier, so that a new way is provided for research of the nano pesticide.

A method for determining residual pesticides in primary agricultural products by an LPME-GC method based on pre-column separation comprises the following steps: preparing a sample solution: the primary agricultural products are tomatoes, oranges, rice, tea leaves and bulbus fritillariae thunbergii, the residual pesticides are fenpropathrin, fenvalerate and deltamethrin, and a solvent is n-hexane; the LPME technology is a hollow fiber membrane liquid-liquid two-phase liquid phase microextraction method, and the extraction agent is n-hexyl-3-methylimidazolium hexafluorophosphate room temperature ionic liquid; pre-column separation of the extraction agent: carrying out pre-column separation of the extraction agent by adopting a full-automatic split type extraction agent separator, wherein filter cotton for preventing the extraction agent from entering a chromatographic column is arranged in the separator; residual pesticide GC analysis: the residual pesticide in the concentrated solution is driven by carrier gas, flows through a GC instrument sample inlet, flows into a GC instrument and then is subjected to chromatographic analysis. The method provided by the invention has the advantages of convenient sample pretreatment, high sensitivity, good linearity and high precision, and is suitable for determination of residual pesticides in primary agricultural products.