226 results about "Porcine reproductive and respiratory syndrome virus" patented technology

The invention provides a Taqman-MGB fluorescent quantitative PCR kit and a method for detecting 12 common viruses and bacteria of pigs at the same time. The kit comprises PCR reaction liquids A / B / C, wherein the PCR liquids comprise primer pairs and Taqman probes for porcine parvovirus (PPV), type-II streptococcus suis (SS-II), a porcine pseudorabies virus (PRV), type-II porcine circovirus (PCV-2), a hog cholera virus (CSFV), a pig foot and mouth disease virus (FMDV), a porcine reproductive and respiratory syndrome virus (PRRSV), a high pathogenicity porcine reproductive and respiratory syndrome virus strain (Hp-PRRSV), a transmissible gastroenteritis virus (TGEV), an epidemic diarrhea virus (PEDV), rotavirus (PRTV) and a swine influenza virus (SIV) respectively. 12 pathogens of pigs can be detected rapidly and effectively at the same time, the detection method is high in accuracy, specificity and sensitivity and is good in stability, and rapid diagnosis and effective detection on pathogens to be detected can be achieved.

The purpose of the invention is to disclose a porcine circovirus, porcine parvovirus and porcine reproductive and respiratory syndrome virus triplex virus-like particle vaccine and its preparation method. The triple virus-like particle vaccine (Triple VLP vaccine) of the invention contains VLP which is composed of PCV-2 major structural protein CAP protein, PPV VP2 protein epitope and PRRSV Gp5 protein epitope. It is proved by experiment that the vaccine can stimulate good double cellular and humoral immune response. It is shown by pharmacodynamic test that after immunization of different animal groups, the vaccine of injection, nose drops and water forms prepared by VLP antigen formed by the method with or without adjuvants can safely and effectively prevent the infection of PCV-2, PPV and PRRSV. The invention provides an ideal vaccine for the security of sows, piglets and fattening pigs to effectively prevent mixed infection of PCV-2, PPV and PRRSV.

The invention provides a set of nucleic acids of a liquid-phase gene chip for synchronously detecting five porcine viruses, which comprise forward and reverse primers and hybrid probes for porcine reproductive and respiratory syndrome virus (PRRSV), porcine circovirus type 2 (PCV2), porcine pseudorabies virus (PRV), classical swine fever virus (CSFV) and porcine parvovirus (PPV). The invention also provides a multiplex liquid-phase chip high-flux molecular biology detection method of the five porcine viruses. According to the method, porcine virus nucleic acids in the sample to be detected are extracted to perform multiplex unsymmetric nucleic acid amplification / multiplex liquid-phase gene chip (suspension chip) combined detection, thereby synchronously and accurately detecting and identifying the five porcine viruses in the sample to be detected. The method has the advantages of high specificity, high sensitivity, high stability, high flux and high detection speed, and is simple to operate.

The invention discloses variant porcine reproductive and respiratory syndrome virus (PRRSV) TaqMan fluorescence quantitative RT-PCR detecting kit and application thereof. A primer and a TaqMan probe are designed and synthesized by referring to an NSP2 fragment gene sequence of the variant PRRSV and common PRRSV of a GenBank. By optimizing the reaction condition and constructing a standard plasmid product, a method for diagnosing the variant PRRSV by TaqMan fluorescence quantitative RT-PCR is established. A result indicates that the method has the advantages of strong specificity, high sensitivity, and the like and can detect the standard plasmid product with 264 copy numbers, and the virus quantity of 0.5623TICD50 is 10 times more sensitive than RT-PCR. By detecting 22 disease samples, 8 disease samples are positive, and the positive rate is 36.4 percent. Because the method has the advantages of quantification, high speed, accuracy, sensitivity, and the like, the invention is suitable for the diagnosis on the swinery infected variant PRRSV in the early stage, the medium stage and the later stage and plays an important role in effectively diagnosing, preventing and treating the highly pathogenic PRRSV.

The invention belongs to the field of biological detection reagents and relates to a kit for indirect ELISA (Enzyme-Linked Immunosorbent Assay) detection of IgG or IgA antibodies of PRRSV (Porcine reproductive and respiratory syndrome virus) of pigs. The kit is used for indirect ELISA detection of the IgG or IgA antibodies of the PRRSV in serum or saliva of pigs and comprises (a) an antibody detection board, (b) an HRP-labeled goat anti-pig IgG antibody solution or HRP-labeled goat anti-pig IgA, (c) a positive control, namely PRRSV standard positive serum or saliva, (d) a negative control, namely PRRSV negative serum or saliva, (e) sample diluting liquid, (f) 10* concentrated washing liquid, (g) substrate developing liquid, and (h) stopping liquid. The kit is good in PRRSV specificity and sensitivity when being used for detection of PRRSV IgG or IgA antibodies in serum or saliva of pigs. A repeatability test also shows that the kit is good in repeatability.

The invention discloses an RPA (recombinase polymerase amplification) primer and a detection kit for rapidly detecting African swine fever viruses. Target genes can be effectively amplified, specificity is 100%, detection sensitivity is 102 copy / reaction, and sensitivity is equivalent to that of fluorescent quantitative PCR (polymerase chain reaction). Cross reaction between the RPA amplificationprimer and one of classical swine fever viruses, vesicular exanthema swine viruses I, porcine reproductive and respiratory syndrome viruses, porcine circoviruses and the like is omitted. A RPA isothermal amplification system is rapidness in reaction and wide in temperature range, effective amplification of the target genes can be achieved at the temperature of 38-46 DEG C, and the detection kit can rapidly, efficiently and sensitively detect the African swine fever viruses and has the advantages that the kit is simple to operate, high in specificity, safe and free from pollution, reaction results are easily observed and the like. Effective technical means are provided for on-site rapidness detecting and screening of infection nucleic acid of the African swine fever viruses, and the RPA amplification primer has great significance for control of infection spreading of the African swine fever viruses in China and inspection and quarantine in infected areas and entry and exit ports.

The invention discloses a prescription composition of a pig antiviral semen diluent. Based on every 1000ml of double distilled water, the pig antiviral semen diluent contains 15.50g of glucose, 11.65g of trisodium citrate, 2.35g of EDTA sodium salt, 1.75g of sodium bicarbonate, 1.00g of polyvinyl alcohol, 5.50g of tricarboxymethyl amino methane, 4.10g of citric acid, 0.07g of cysteine, 1.00g of vitamin C, 0.10g of enrofloxacin and 50ml of an antiviral agent. According to the embodiment of the invention, the diluent of the prescription composition of the pig antiviral semen diluent has obvious killing, inhibition and obstructing effects on pig reproduction and respiration syndrome virus (PRRSV) and is capable of obviously improving the survival rate and preservation time of semen during in vitro preservation and the litter size of a mated sow.

A porcine reproductive and respiratory syndrome virus-like particle vaccine and a preparation method thereof relate to the field of biological medicines and aims at disclosing the porcine reproductive and respiratory syndrome virus-like particle vaccine (PRRS VLP vaccine) and the preparation method the vaccine. The PRRS VLP vaccine contains a VLP comprising three structure proteins of porcine reproductive and respiratory viruses M, N and GP5 and can excite favorable dual cell and humoral immune response. By adding or not adding an adjuvant into the formed VLP protein antigen, the pharmacodynamic test shows the prepared injection type, nasal drop type and water agent type vaccines are immunized with different animal groups so as to safely and effectively prevent the PRRSV infection and provide ideal vaccines for safely and effectively immunizing, preventing and controlling the PRRSV infection on different groups of sows, piglets and fat pigs.

The invention belongs to the technical field of antibiotic preparations for livestock, and in particular discloses an acetylisovaleryltylosin tartrate premixing agent for inhibiting porcine reproductive and respiratory syndrome virus for livestock and a preparation method thereof. The premixing agent consists of an acetylisovaleryltylosin tartrate inclusion compound and a matrix diluent, wherein the compound can effectively avoid illumination and temperature influences, so that the agent stability is improved, the agent is prevented from being influenced by the ingredients of a feed, the bitter taste of the agent is covered, and the palatability of livestock is improved; moreover, the agent has good liquidity and is easily mixed with the feed to administrate; and in addition, the acetylisovaleryltylosin tartrate inclusion compound can prolong drug release and agent acting time, so that the agent has long acting and slow releasing functions.

The invention provides a synthetic peptide vaccine for treating porcine reproductive and respiratory syndrome and a preparation method thereof, in particular relates to polypeptide of the synthetic peptide vaccine for treating the porcine reproductive and respiratory syndrome and a vaccine which contains the polypeptide and a method for preparing the polypeptide and the vaccine. The amino acid sequence of the polypeptide is an amino acid sequence shown in SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 or SEQ ID No.4. The vaccine prepared from the polypeptide can effectively cope with the antigenic variation of a porcine reproductive and respiratory syndrome virus, ensures biological safety, is easy for large-scale synthesis and has good application prospect.

The invention discloses a separated porcine reproductive and respiratory syndrome virus JJ strain with the microorganism collection number of CGMCC NO.2129, an inactivated vaccine prepared by the virus strain and a preparation method thereof. The porcine reproductive and respiratory syndrome virus inactivated vaccine has good immune protection effectiveness, and can effectively prevent porcine reproduction and respiratory syndrome.

The invention relates to an indirect ELISA (enzyme-linked immunosorbent assay) method for detecting a porcine reproductive and respiratory syndrome antibody, which comprises the following steps: by using a pGEX-6p-1 prokaryotic expression vector, performing tandem repeat on two epitopes to improve the antigen activity of an expressed protein, thus constructing a gene engineering bacterium BLpGEX-6p-GP5 capable of realizing secretory expression of the GP5 protein dominant antigen epitopes, wherein one epitope is a linear conservative neutralizing epitope (epitope B) of a screened PRRSV (porcine reproductive and respiratory syndrome virus) GP5 protein, which can be identified by a monoclonal antibody and can also be identified by porcine anti-PRRSV neutralizing serum, and the other epitope is a high-variability immunodominant epitope (A); and purifying and renaturing the expressed recombinant protein, and coating an ELISA plate, thus establishing the indirect ELISA method for detecting a PRRSV antibody to detect the PRRSV antibody level in porcine serum. Results show that the method has the characteristics of favorable repetitiveness and high specificity and can be used for PRRSV serological search.

The invention relates to a method for preparing a genetic engineering product, in particular to a prokaryotic expression protein of VP73 gene from African swine fever virus (ASFV) and a preparation method thereof. The preparation method comprises: artificially synthesizing the whole-length sequence of VP73 gene according to the sequence of the VP73 gene from ASFV in GenBank, constructing a recombinant expression vector pET32a-VP73, sequencing, verifying, transforming prokaryotic expression recipient bacteria E.coli BL21(DE3), and inducing expression by isopropyl-1-thio-beta-d-galactopyranoside (IPTG), wherein the molecular weight of the recombinant fusion protein is about 65KD. Protein purified by nickel column affinity chromatography can undergo a specific immune imprinting reaction with ASFV positive serum and avoid cross reaction with viruses such as swine fever virus, hog cholera virus, porcine circovirus, porcine reproductive and respiratory syndrome virus, swine influenza virus and pseudorabiesvirus. Experiments show the expressed protein has high detection sensitivity, and high specificity. When the antigen is used for detection, risk of spreading poison is avoided. And the antigen can be used as a detection antigen for use in an enzyme-linked immuno sorbent assay (ELISA) method for identifying an ASFV antibody.

The invention belongs to the technical field of molecular biology, and particularly relates to a real-time fluorescent quantitative PCR primer, kit and detection method for detecting the porcine circovirus 3. The nucleotide sequence of the real-time fluorescent quantitative PCR primer for detecting the porcine circovirus 3 is shown in SEQ ID NO.1-2. The invention further provides the kit containing the primer mentioned above and the detection method for detecting the porcine circovirus 3. The primer, the kit and the detection method are high in specificity, high in sensitivity and stable in repeatability, wave crests of the melting curve of amplified products are single, no primer dimer is caused, and the primer and the kit have no cross reaction with genomes of the porcine circovirus 2, the hog cholera virus, the porcine pseudorabies virus and the porcine reproductive and respiratory syndrome virus; sensitivity is 102 copies per microliter and is 100 times higher than that of the conventional PCR; and the variation coefficients of inter-group and intra-group repeated tests are all smaller than 3.0%. The foundation is laid for research on molecular epidemiology, prevention and control of the pestilence.

The present invention relates to a primer used for detecting the nucleotide fragment of highly pathogenic swine blue ear virus, and a probe sequence. A primer pair comprises a primer pair consisting of an upstream primer PVpf with the sequence of CCCAAGCTGATGACACCTTT, and a downstream primer PVpr with the sequence of AATCCAGAGGCTCATCCTGGT. The probe PVpb sequence is CGCGTAGAACTGTGACAACAACGCTGA.

The invention provides a preparation method of an inactivated and concentrated vaccine 'SD1 strain' for a Porcine reproductive and respiratory syndrome, which is prepared with a water phase and an oil phased according to the following weight percentage content: the water phase is prepared by fully mixing 96 shares of 'SD1 strain' virus culture solution, which is American Porcine reproductive and respiratory syndrome that is inactivated for 20 hours and concentrated 2 times, with 4 shares of Tween minus 80, which occupies 33 percent of the vaccine; the oil phase is prepared by mixing 94 shares of No. 10 white oil with 6 shares of Span minus 80 and then adding a 2 percent aluminum stearate according to the total amount to stir to be transparent, and sterilizing with a high pressure at a temperature of 116 DEG C, which occupies 67 percent of the total amount of the vaccine. The vaccine, with a preservation period of 12 months, is safe and reliable to the Porcine reproductive and respiratory syndrome easily infected animals, and is suitable for pigs of different species and various day old, the immunity protection rate of which reaches 80 percent above, the immunity period of validity of which continues more than 6 months. The safety and immunity efficacy of the vaccine reaches an advanced level among the similar products in the world.

The invention discloses a multiple fluorescent quantitative RT-PCR (reverse transcriptase-polymerase chain reaction) method for detecting PRRSV (porcine reproductive and respiratory syndrome virus) and an application thereof. The method is implemented by fluorescent quantitative RT-PCR primers and probes for detecting the PRRSV, wherein the primers comprise an AM-PRRSV primer pair and a TJM-PRRSV primer pair, and the probes comprise an AM-V-PRRSV-P probe, an AM-C-PRRSV-P probe and a TJM-PRRSV-P probe; and the multiple fluorescent quantitative RT-PCR method for detecting the PRRSV comprises the steps as follows: the primers and the probes are utilized to perform fluorescent quantitative RT-PCR amplification, fluorescence signals are collected after the amplification, the fluorescence signals which have amplification curves are positive, and the method is characterized in that an RT-PCR amplification system comprises the primers and the probes. The multiple fluorescent quantitative RT-PCR method can detect and distinguish PRRSV American type classical strains, HP-PRRSV and highly-pathogenic PRRS living-vaccine TJM-F92 strains simultaneously, and has the advantages of high specificity, high sensibility and high degree of automation.

The invention discloses a porcine reproductive and respiratory syndrome virus attenuated vaccine strain, and the microorganism collection number is CGMCC NO.1883. The attenuated vaccine strain of the invention has stable genetic variation and good safety, which is safe and non-pathogenic for pregnant sows, piglets and the pigs at various ages. The immunized piglets after using the attenuated vaccine strain of the invention for immunization can resist the attack of the strong virus of the porcine reproductive and respiratory syndrome virus.

The invention relates to detection reagents and detection methods for porcine reproductive and respiratory syndrome virus (PRRSV). On the one hand, the invention provides immunogenic fragments in coded non-structural protein 2 (Nsp2), and in particular, the immunogenic fragments provided in the invention exist in Nsp2 protein of wild type PRRSV instead of in Nsp2 protein of attenuation PRRSV; on the other hand, the invention also provides oligonucleotide primers, and in particular, a to-be-amplified area of the oligonucleotide primers provided in the invention includes at least a part of the coding sequence of Nsp2 protein and the part of the coding sequence exists in Nsp2 coding sequence of wild type PRRSV instead of in Nsp2 coding sequence of attenuation PRRSV. The invention further provides the methods of using relevant detection reagents in detection and a method of using the above-mentioned methods to distinguish pigs immunized by attenuation PRRSV from pigs infected by wild type PRRSV.

The invention discloses a method for producing porcine reproductive and respiratory syndrome viruses (PRRSV) in a large scale. The method comprises the following steps of: producing PRRSV by using a cell microcarrier suspension culture system by utilizing a bioreactor; inoculating host cells used for preparing the viruses to a carrier pot containing a culture solution and microcarriers and uniformly mixing the cells and the microcarriers to ensure that the cells are attached on the microcarriers; under a proper culture environment, providing sufficient nutrients and an appropriate gas environment for the cells to ensure that the cells grow on the microcarriers to reach a concentration 5-40 times of an inoculating concentration; changing to use a cell maintenance culture solution and preparing the PRRSV into a viral suspension to ensure that the viral suspension is adsorbed on the cells; culturing the viruses under an appropriate environment; obtaining a viral solution after continuously culturing for 2-3 days; after the viral solution is inspected to be qualified, freeze thawing the obtained viral solution twice at -20 DEG C; and inactivating and purifying to obtain a PRRSV solution. The method has large production scale, high single-batch output and relatively lower production cost.

The invention provides a porcine reproductive and respiratory syndrome virus (PRRSV) purification method. The method comprehensively adopts a series of processes, such as microfiltration clarification purification process, ultrafiltration concentration purification process, repeated filter wash process and the like, maximally enhances the recovery efficiency of PRRSV, and lowers the purification cost. The PPRSV concentrated solution finished product prepared by the method is especially suitable for preparing a vaccine; and compared with the PPRSV vaccine in the prior art, the vaccine prepared from the PPRSV concentrated solution finished product has the advantages of high safety, high purity, favorable uniformity and favorable immunization effect. The method has the advantages of simple technique and lower cost, and has outstanding popularization prospects.

The invention relates generally to the field of virology. More particularly, the present invention relates to methods for determining the effect of a viral inactivation procedure on the antigenicity of the inactivated virus. In particular for a virus that is a member of the family Arteriviridae or Coronaviridae or Asfarviridae, in particular for Porcine Reproductive and Respiratory Syndrome Virus (PRRSV). The invention further provides methods to determine the antigenicity of an inactivated virus as well as methods to screen for anti-viral compounds using any one of the aforementioned methods Methods of using the inactivated and immunogenic virus thus obtained, in particular in the manufacture of a vaccine are also provided by the present invention.

The invention provides a liquid phase chip multiple detection kit for swine PRRSV (Porcine Reproductive and Respiratory Syndrome Virus), SIV (Swine Influenza Virus) and HEV (Hepatitis E Virus) antibodies. Different fluorescence labeling microspheres of PRRSV nsp7, SIV HA (Hemagglutinin) and HEV ORF2 (Opening Reading Frame) antibodies are used as carriers; on the basis of a single liquid phase chip detection method of the PRRSV, SIV and HEV antibodies, a multiple liquid phase chip detection method for simultaneously detecting three antibodies is established, provides a more effective and quicker detection method for monitoring the HEV, PRRSV and SIV antibodies, and provides a new clue for establishing a method of differential diagnosis of swine diseases and serum detection of other animal epidemic disease antibodies; aiming at breeding situation of quick development of pig industry in China, complex conditions of the swine diseases, serious mixed infection phenomenon and the like, accurate, quick and effective diagnosis and monitoring of epidemic disease conditions of swine herds are further enhanced.

The invention discloses an RT-PCR (Reverse Transcription-Polymerase Chain Reaction) method for detecting porcine reproductive and respiratory syndrome virus (PRRSV) classical strains, high-pathogenicity variant strains and NADC-30 strains. A pair of primers are designed by applying Primer5.0 software through referring to a PRRSV Nsp2 gene sequence published in GenBank. The pair of primers can be used for detecting three subtypes with different amino acid quantities of a PRRSV through an RT-PCR method. The RT-PCR method disclosed by the invention has high sensitivity and good specificity, and can be used for successfully detecting the three subtypes of the PRRSV, such as the classical strains, the variant strains ad the NADC-30 strains, and can be used for detecting clinical samples with the suspected PRRSV, so that the RT-PCR method is used for diagnosing the PRRSV and carrying out epidemiological monitoring.

The invention discloses a pair of detection primers, a probe and a detection method of highly pathogenic porcine reproductive and respiratory syndrome virus (HP-PRRSV). According to the invention, a serum sample is directly added into a fluorescent quantitation RT-PCR reaction system containing the detection primers and the probe so as to carry out RT-PCR, and whether the sample contains HP-PRRSV is detected after the RT-PCR. By the method provided by the invention, continuous and automatic virus RNA release, reverse transcription and fluorescent quantitative PCR detection are realized in a PCR tube; it only takes 1.5 hours from obtaining the virus serum sample to obtaining detection results; sensitivity and accuracy of the method are comparable with those of traditional RT-PCR; the defect that traditional RT-PCR needs the tedious step of RNA extraction is overcome, operation steps are minimized, detection speed is improved, costs are saved and cross contamination is effectively avoided; and high throughput detection of HP-PRRSV can be carried out, and the method is of great significance for rapid detecting epidemic situation of HP-PRRSV and timely formulating prevention and control measures.

The invention belongs to the technical field of livestock gene engineering, and relates to construction and an application of a dual-luciferase reporter gene carrier based on a porcine CD163 gene. A key receptor gene, namely the porcine CD163 gene, of a PRRSV (Porcine Reproductive and Respiratory Syndrome Virus) is amplified and sequenced to obtain a complete fragment of a 3' UTR (Untranslated Region) of the gene, candidate microRNAs (micro Ribonucleic Acids) and an action target of the 3' UTR of the porcine CD163 gene are predicted and regulated, and a sequence of the porcine CD163 gene containing the action target is amplified, and inserted into a dual-luciferase carrier to construct the dual-luciferase reporter gene carrier psi-CHECK2-CD163-3UTR of the 3' UTR of the porcine CD163 gene. The carrier can be used for detecting regulation activity of the candidate microRNAs on porcine CD163 gene expression, and screening the microRNAs inhibiting the porcine CD163 gene expression, and the like.

The invention discloses porcine reproductive and respiratory syndrome virus M protein CTL cell epitopes and application thereof. The identification of the epitopes comprises the following steps of: fusing and cloning a M protein gene of a porcine reproductive and respiratory syndrome virus CH-1a strain and a mouse ubiquitin gene to form a DNA vaccine and also form recombination viruses, expressing an M protein, of a WR strain vaccinia virus; immunizing a BALB / c mouse according to a Priming-Boosting policy, separating the mouse splenic lymphocyte, culturing and stimulating a CTL short peptide in vitro predicted and synthesized by a bioinformatic method, and using the flow cytometry and enzyme-linked immunospot technology to identify two CTL epitopes that are K93FITSRCRL and F57GYMTFVHF. The identification of the PRRSVM protein CTL cell epitopes lays a certain theoretical foundation for the PRRS cell immune mechanism and the novel epitope pepetide vaccine and has an instructing significance for the theoretical study on PRRS preventing and control technology.

The invention discloses a porcine reproductive and respiratory syndrome resisting Marc-145 cell line as well as a preparation method and application thereof. The porcine reproductive and respiratory syndrome resisting Marc-145 cell line is obtained by knocking off CD163 extracellular domain SRCR5 of the Marc-145 cell line. The invention further provides gRNA (guide Ribonucleic Acid) for splicing of a pair of shearing Marc-145 cell CD163 receptors SRCR5 and sequences are shown as SEQ ID No. 2 and SEQ ID No. 3 respectively. After an the fifth extracellular fifth structure domain SRCR5 of the Marc-145 cell surface CD163 receptor on the surface of a Marc-145 cell is deleted through a CRISPR / CAS9 (Clustered Regularly Interspaced Short Palindromic Repeats / CRISPR associated protein 9) gene editing technology, the obtained porcine reproductive and respiratory syndrome resisting Marc-145 cell line can completely resist PRRSV (Porcine Reproductive and Respiratory Syndrome virus) infection and resist high-pathogenicity virulent strain HP-PRRSV. Moreover, the CD163 receptor on the surface of the porcine reproductive and respiratory syndrome resisting Marc-145 cell line surface CD163 receptor is normally expressed and other biological functions are normal. The porcine reproductive and respiratory syndrome resisting Marc-145 cell line disclosed by the invention has important meanings for inresearching PRRSV pathogenesis and mining novel disease-resisting or susceptible genes; a novel model is provided for PRRSV researches and the porcine reproductive and respiratory syndrome resisting Marc-145 cell line has important guidance meanings on in screening and breeding of PRRSV-resisting pigs.

The invention discloses a fatty acid complex. The fatty acid complex comprises the following components in parts by weight: 2.2-3 parts of mixed fatty acid, 16-40 parts of a surfactant and 40-60 partsof auxiliary acid, wherein the mixed fatty acid is a mixture of octanoic acid, nonoic acid and capric acid; the auxiliary acid is lauric acid or a mixture of the lauric acid and citric acid. The fatty acid complex has broad-spectrum bactericidal and antiviral activity, can kill polioviruses, foot-and-mouth disease viruses, porcine reproductive and respiratory syndrome viruses and avian influenzaviruses, has the staphylococcus aureus and escherichia coli killing rate as high as 99.99999%; the fatty acid complex has excellent storage stability under a diluted condition, is applied to a food disinfectant, has an excellent food preserving function, is free of cleaning during disinfection, free of metal corrosion, practically non-toxic and non-irritant to skin, and is unlikely to volatilize;the fatty acid complex has acidic pH and a light coconut scent, disinfecting cleaning sewage does not pollute the environment, and the fatty acid complex can be reused in some disinfecting scenes.

The invention provides an immunodetection kit for detecting porcine reproductive and respiratory syndrome virus (PRRSV) and an application thereof. The kit comprises 96-well PRRSV N protein-coated ELISA (enzyme-linked immunosorbent assay) plate, a washing solution, rabbit anti-pig enzyme-linked antibodies, a color-development solution, a stop solution, positive control, and negative control. The immunodetection kit adopts a genetic engineering method to construct virus-specific neutralizing epitope polypeptide fragment, and adopts an ELISA technology. The kit can effective distinguish various antibodies, constructs the technical standards for evaluating immunoprotection effect, is very important for the prevention and control of porcine reproductive and respiratory syndrome, and has broad application market. The immunodetection kit is convenient in operation, has low use cost and good repeatability, and is suitable for large-scale generalization and application.