Primer and probe sequence for detecting high pathogenicity porcine reproductive and respiratory syndrome virus nucleic acid fragment

A porcine PRRS virus, highly pathogenic technology, applied in the fields of biochemical equipment and methods, DNA/RNA fragments, microbial determination/inspection, etc., can solve the problems of cumbersome operation, unsuitable for early diagnosis of the virus, lack of vaccines, etc.

Inactive Publication Date: 2008-03-19
TAITAI GENOMICS +1
View PDF0 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The current common virus isolation and serological diagnosis methods are cumbersome, time-consuming, low sensitivity, and poor specificity, and are not suitable for early diagnosis of viruses
Due to the lack of effective vaccines, it is very important to diagnose the disease in time and deal with the epidemic situation in time, which requires an...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer and probe sequence for detecting high pathogenicity porcine reproductive and respiratory syndrome virus nucleic acid fragment

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0013] 1. Design of primers and probes: Through comparative analysis of the genome sequence of the highly pathogenic porcine PRRS virus, select a segment with no secondary structure and a high degree of conservation, and design multiple pairs of primers and probes. The length of the primers is generally 20 There is no complementary sequence between and within the primers. The optimal primer and probe sequence combinations are as follows:

[0014] Upstream primer PVpf: CCCAAGCTGATGACACCTTT

[0015] Downstream primer PRVp r: AATCCAGAGGCTCATCCTGGT

[0016] Probe PRVpb: CGCGTAGAACTGTGACAACAACGCTGA

[0017] 2. Establishment and optimization of the reaction system: use the inactivated highly pathogenic porcine PRRS virus as the sample to be tested, use the extraction method of Trizol nucleic acid extraction reagent to extract the viral genome RNA, and store it at -20°C after sub-packaging spare.

[0018] 2.1 Optimization of primer concentration Under the same conditions in the r...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention relates to a primer used for detecting the nucleotide fragment of highly pathogenic swine blue ear virus, and a probe sequence. A primer pair comprises a primer pair consisting of an upstream primer PVpf with the sequence of CCCAAGCTGATGACACCTTT, and a downstream primer PVpr with the sequence of AATCCAGAGGCTCATCCTGGT. The probe PVpb sequence is CGCGTAGAACTGTGACAACAACGCTGA.

Description

technical field [0001] The invention relates to a primer and a probe sequence for detecting highly pathogenic porcine PRRS virus nucleotide fragments. Background technique [0002] Porcine Reproductive and Respiratory Syndrome (PRRS) is a viral disease of pigs caused by Porcine Reproductive and Respiratory Syndrome Virus (PRRSV). It is characterized by the fact that pigs of all ages can be infected with the disease, and the main clinical symptoms are anorexia, lethargy, and elevated body temperature. The fertilization rate of breeding sows is low, premature births, late abortions, stillbirths, weak fetuses and mummified fetuses occur in pregnant sows, insufficient lactation in lactating sows, which seriously affects the growth and development of newborn pigs and even dies, and the performance of breeding boars declines, affecting the semen quality and sperm motility. Piglets and fattening pigs showed respiratory symptoms, shortness of breath, interstitial pneumonia, and cy...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11
Inventor 肖性龙曾政张经纬杨泽林
Owner TAITAI GENOMICS
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap