Primer and probe sequence for detecting high pathogenicity porcine reproductive and respiratory syndrome virus nucleic acid fragment

Abstract

The present invention relates to a primer used for detecting the nucleotide fragment of highly pathogenic swine blue ear virus, and a probe sequence. A primer pair comprises a primer pair consisting of an upstream primer PVpf with the sequence of CCCAAGCTGATGACACCTTT, and a downstream primer PVpr with the sequence of AATCCAGAGGCTCATCCTGGT. The probe PVpb sequence is CGCGTAGAACTGTGACAACAACGCTGA.

Description

technical field [0001] The invention relates to a primer and a probe sequence for detecting highly pathogenic porcine PRRS virus nucleotide fragments. Background technique [0002] Porcine Reproductive and Respiratory Syndrome (PRRS) is a viral disease of pigs caused by Porcine Reproductive and Respiratory Syndrome Virus (PRRSV). It is characterized by the fact that pigs of all ages can be infected with the disease, and the main clinical symptoms are anorexia, lethargy, and elevated body temperature. The fertilization rate of breeding sows is low, premature births, late abortions, stillbirths, weak fetuses and mummified fetuses occur in pregnant sows, insufficient lactation in lactating sows, which seriously affects the growth and development of newborn pigs and even dies, and the performance of breeding boars declines, affecting the semen quality and sperm motility. Piglets and fattening pigs showed respiratory symptoms, shortness of breath, interstitial pneumonia, and cy...

AI Technical Summary

Problems solved by technology

[0005] The current common virus isolation and serological diagnosis methods are cumbersome, time-consuming, low sensitivity, and poor specificity, and are not suitable for early diagnosis of viruses

Due to the lack of effective vaccines, it is very important to diagnose the disease in time and deal with the epidemic situation in time, which requires an accurate and rapid laboratory detection method to determine the pathogen

With the development of molecular biology technology, ordinary PCR method has been widely used in clinical diagnosis, but this technology requires post-processing of PCR products, which can easily lead to contamination of PCR products and a certain amount of non-specific amplification.

Images