Detection kit and application thereof
A technology for detection reagents and kits, applied in measurement devices, analysis, instruments, etc. by chemical reaction of materials, which can solve the problems of cumbersome operation process, long time-consuming, unsuitable for rapid detection at the grassroots level or on-site, and achieve rapid sensitivity Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment approach
[0036] As an embodiment of the present invention, the method includes: before step (1), inserting the collected microbial swab into the sample processing tube, dissolving the sample in the solution as much as possible, adding the processed sample dropwise To the center of the sample hole of the test strip, judge the result in 10 minutes or 30 minutes: if the quality control line develops color, the test is established; if the test line develops color, it can be judged as positive; If the quality control line does not develop color, the test is not established. Regardless of whether the test line develops color, it is judged as an invalid result and needs to be retested.
[0037] The present invention also relates to the application of the kit in the detection of porcine circovirus type 2 antigen, classical swine fever virus antigen and / or highly pathogenic porcine reproductive and respiratory syndrome virus antigen for non-diagnostic purposes.
[0038] As an embodiment of the ...
Embodiment 1
[0045] Embodiment 1 Preparation, purification, identification and inspection of anti-porcine circovirus type 2 monoclonal antibody
[0046] 1.1 Preparation, purification and content determination of PCV2Cap whole protein
[0047] Primer pair Cap- F: 5'CATATGATGACGTATCCAAGGAGGC3', Cap-R: 5'CTCGAGTTAAGGGTTAAGTGGGGGGT3'. And according to Li Tingdong (Li Tingdong, the expression of rotavirus structural protein in Escherichia coli and its in vitro assembly of virus-like particles, 2009) literature prokaryotic expression of PCV2Cap whole protein, and purified by ion exchange chromatography, using 12 The protein electrophoresis was used to identify the protein by %SDS-PAGE, and the results showed that the molecular weight of the obtained protein was consistent with the expectation. The purified protein sample was dialyzed in 1×PBS (pH7.4) overnight, and the dialyzed sample was quantified according to the instructions of Beyontian BCA Protein Quantification Kit. The results showed t...
Embodiment 2
[0087] Preparation and method, quality research and application of embodiment 2 kit
[0088] 2.1 Colloidal gold detection test strip of the kit
[0089] 2.1.1 Preparation and application of the colloidal gold detection test strip of the kit
[0090] The kit includes colloidal gold detection test strips, sample processing solution (i.e. pH7.4 phosphate buffer containing 2% CHAPS), sample processing tube, sample preservation solution, sample preservation solution (i.e. pH7.4 phosphate buffer solution) in the sample preservation bottle, wherein the preparation of the colloidal gold detection test strip is as follows: prepare the colloidal gold solution according to the colloidal gold preparation method established by China CN101614737A, and mark the monoclonal antibody PCV2-McAB2 respectively (anti-pig anti-pig prepared in Example 1 Circovirus type 2 monoclonal antibody 3H11, diluted with pH7.4 phosphate buffer to a labeling concentration of 80 μg / ml), monoclonal antibody CSFV-M...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
