Supercharge Your Innovation With Domain-Expert AI Agents!

Detection kit and application thereof

A technology for detection reagents and kits, applied in measurement devices, analysis, instruments, etc. by chemical reaction of materials, which can solve the problems of cumbersome operation process, long time-consuming, unsuitable for rapid detection at the grassroots level or on-site, and achieve rapid sensitivity Effect

Active Publication Date: 2016-06-15
LUOYANG PULIKE WANTAI BIOTECH
View PDF13 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] At present, the methods for detecting these viruses include virus isolation and identification, but the operation process is cumbersome and time-consuming; PCR or gene chip detection, but requires special instruments and professional operators, these methods are not suitable for grassroots or on-site rapid detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection kit and application thereof
  • Detection kit and application thereof
  • Detection kit and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment approach

[0036] As an embodiment of the present invention, the method includes: before step (1), inserting the collected microbial swab into the sample processing tube, dissolving the sample in the solution as much as possible, adding the processed sample dropwise To the center of the sample hole of the test strip, judge the result in 10 minutes or 30 minutes: if the quality control line develops color, the test is established; if the test line develops color, it can be judged as positive; If the quality control line does not develop color, the test is not established. Regardless of whether the test line develops color, it is judged as an invalid result and needs to be retested.

[0037] The present invention also relates to the application of the kit in the detection of porcine circovirus type 2 antigen, classical swine fever virus antigen and / or highly pathogenic porcine reproductive and respiratory syndrome virus antigen for non-diagnostic purposes.

[0038] As an embodiment of the ...

Embodiment 1

[0045] Embodiment 1 Preparation, purification, identification and inspection of anti-porcine circovirus type 2 monoclonal antibody

[0046] 1.1 Preparation, purification and content determination of PCV2Cap whole protein

[0047] Primer pair Cap- F: 5'CATATGATGACGTATCCAAGGAGGC3', Cap-R: 5'CTCGAGTTAAGGGTTAAGTGGGGGGT3'. And according to Li Tingdong (Li Tingdong, the expression of rotavirus structural protein in Escherichia coli and its in vitro assembly of virus-like particles, 2009) literature prokaryotic expression of PCV2Cap whole protein, and purified by ion exchange chromatography, using 12 The protein electrophoresis was used to identify the protein by %SDS-PAGE, and the results showed that the molecular weight of the obtained protein was consistent with the expectation. The purified protein sample was dialyzed in 1×PBS (pH7.4) overnight, and the dialyzed sample was quantified according to the instructions of Beyontian BCA Protein Quantification Kit. The results showed t...

Embodiment 2

[0087] Preparation and method, quality research and application of embodiment 2 kit

[0088] 2.1 Colloidal gold detection test strip of the kit

[0089] 2.1.1 Preparation and application of the colloidal gold detection test strip of the kit

[0090] The kit includes colloidal gold detection test strips, sample processing solution (i.e. pH7.4 phosphate buffer containing 2% CHAPS), sample processing tube, sample preservation solution, sample preservation solution (i.e. pH7.4 phosphate buffer solution) in the sample preservation bottle, wherein the preparation of the colloidal gold detection test strip is as follows: prepare the colloidal gold solution according to the colloidal gold preparation method established by China CN101614737A, and mark the monoclonal antibody PCV2-McAB2 respectively (anti-pig anti-pig prepared in Example 1 Circovirus type 2 monoclonal antibody 3H11, diluted with pH7.4 phosphate buffer to a labeling concentration of 80 μg / ml), monoclonal antibody CSFV-M...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a detection kit containing two anti-porcine circovirus 2 type monoclonal antibodies, two anti-classical swine fever virus monoclonal antibodies and / or two anti-highly pathogenic porcine reproductive and respiratory syndrome virus monoclonal antibodies; the kit can be applied for simultaneous detection of a porcine circovirus 2 type antigen, a classical swine fever virus antigen and / or a highly pathogenic porcine reproductive and respiratory syndrome virus antigen with non-diagnostic purpose, moreover, the detection sensitivity of the kit for simultaneous detection of two or three kinds of viruses is higher than that for the detection of single virus, and false positive results are avoided.

Description

technical field [0001] The invention belongs to the field of biological detection, and in particular relates to a detection kit and its application. Background technique [0002] Porcine circovirus type 2 (Porcinecircovirus2type, PCV2) can cause a series of porcine circovirus diseases, including weaned piglet multisystem wasting syndrome (PostweaningMultisystcmicWastingSyndrome, PMWS), piglet A2 type congenital tremor (A2CT), pig reproductive disorder, porcine dermatitis nephritis Syndrome, hyperplastic necrotizing pneumonia and respiratory disease syndrome, especially the main pathogen of PMWS. PMWS mainly affects piglets aged 6-8 weeks. The incidence rate is generally 10%-20%, and the mortality rate is as high as 50%-100%. It can also cause immune suppression and reduce disease resistance; adult pigs are generally recessively infected and do not show Any symptoms, but can be transmitted to piglets. The widespread prevalence of these diseases has seriously affected the de...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/577G01N33/569G01N33/558G01N33/531G01N33/535G01N21/76
CPCG01N21/76G01N33/531G01N33/535G01N33/558G01N33/56983G01N33/577
Inventor 田克恭韩水仲
Owner LUOYANG PULIKE WANTAI BIOTECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More