35 results about "Sugar nucleotide" patented technology

Provided in the present invention are a method for preparing a strand-specific library for the rapid detection of various types of RNAs, and a high-throughput sequencing method. A polyadenylic acid (poly A) tail is artificially added at the 3' terminal of various RNAs by using a poly A polymerase, and a single-stranded cDNA is synthesized using a poly-deoxythymidine ribonucleotide primer with deoxyuridine under the action of a reverse transcriptase. The obtained single-stranded cDNA molecule is subjected to a series of reactions, and the reaction product is finally amplified by means of PCR to obtain a strand-specific library of various types of RNAs. The library sample can be subjected to on-machine sequencing.

The invention relates to a preparation method of a binary guanidyl block copolymer (Poly-PEG-GUA) for nucleic acid transfection of human vascular endothelial cells (HUVEC). According to the invention, N-(2-(3-carbamyl guanidyl) ethyl) methacrylamide with different proportions is subjected to reversible addition-fragmentation chain transfer (RAFT) polymerization to polyethylene glycol modified 4-cyano-4-(phenyl thioformyl sulfenyl) valeric acid (PEG-CPADN), so that five kinds of binary guanidyl block copolymers with different molecular weights are constructed; the HUVEC gene and messenger ribonucleotide (EGFP-mRNA) of green fluorescent protein are assembled in the HUVEC for screening of transfection efficiency, and the optimal molecular weight for HUVEC transfection is optimized. Experimental results show that the Poly-PEG-GUA with the molecular weight of 53575 Daltons can be used for effectively delivering green fluorescent protein (EGFP) mRNA (messenger ribonucleic acid) to HUVEC (human umbilical vein endothelial cells), and the highest transfection efficiency is shown. The optimized Poly-PEG-GUA in the invention has a certain reference value for the research and development of subsequent cardiovascular transfection products.

Methods are provided for nucleic acid amplification using primers that contain DNA oligonucleotide segments and at least one ribonucleotide. In PCR reactions, this increases the amount of amplified product with each amplification cycle, resulting in greater sensitivity and speed than conventional PCR. In isothermal reactions, this reduces the time required to detect the target. Also provided are methods for monitoring amplification reactions using probes that contain ribonucleotides, without relying on the 5'-nuclease activity of DNA polymerase.

Provided herein are methods of treating cancer in a subject that include administering to the subject a therapeutically effective amount of an inhibitor of UXS1, wherein the inhibitor of UXS1 comprises an inhibitory nucleic acid, and wherein the subject is diagnosed as having a UDGH-high cancer, thereby treating the UDGH-high cancer.

The invention provides a chain-specific library preparation method and a high-throughput sequencing method for rapidly detecting multiple types of RNAs (Ribonucleic Acid). The method comprises the following steps: artificially adding poly A tails at 3'tail ends of multiple RNAs by utilizing poly A polymerase; meanwhile, a polydeoxythymine ribonucleotide primer with deoxyuracil is used for synthesizing single-stranded cDNA under the action of reverse transcriptase, obtained single-stranded cDNA molecules are subjected to a series of reactions and finally subjected to PCR amplification to obtain strand specific libraries of multiple types of RNA, and samples of the libraries can be subjected to computer sequencing.

An aptamer composition is disclosed which has one or more oligonucleotides that include at least one of deoxyribonucleotides, ribonucleotides, derivatives of deoxyribonucleotides, derivatives of ribonucleotides, or mixtures thereof. The aptamer composition has a binding affinity for one or more cellular membrane glycoproteins selected from the group consisting of: intercellular adhesion molecule 1 (ICAM-1), low-density lipoprotein receptor (LDLR) family members, and cadherin-related family member 3 (CDHR3), preferably intercellular adhesion molecule 1 (ICAM-1), and is configured to reduce the binding of one or more human rhinoviruses to the intercellular adhesion molecule 1 (ICAM-1).

The present disclosure provides circular polyribonucleotides including a sequence including: a circularization element; a first spacer; an internal ribosome entry site (IRES) sequence; a sequence encoding a polypeptide; and a second spacer, where the sequence encoding the polypeptide has been codon-optimized to reduce the number of uracil ribonucleotides and / or reduce or remove TLR7- and TLR8-recognition motifs, and kits and compositions thereof. The present disclosure also provides methods of treating subjects in need thereof with the circular polyribonucleotides and compositions described herein.

The present invention relates to a method for preparing oligosaccharides by a glycoside phosphorylase combined with monosaccharide kinase and polyphosphate kinase. The method comprises the steps of using donor monosaccharide, acceptor sugar, polyphosphate, and low equivalent adenosine phosphate as substrates, adding magnesium chloride to the substrate, and then co-catalyzing the reaction for 1.5 to 22 hours at 25 to 40 ° C by polyphosphatase, monosaccharide kinase and glycoside phosphorylase to generate crude oligosaccharide products, and obtaining oligosaccharides after purification. The present invention provides a method for preparing important oligosaccharides by using monosaccharides, acceptor substrates, polyphosphate, and low equivalent adenosine phosphate as substrates, and realizing ATP regeneration by using polyphosphate kinase as substrate, effectively solving the problem that a large amount of expensive sugar nucleotide donors and auxiliary factor ATP need to be added in the process of synthesizing oligosaccharides by bioenzymatic method, resulting in the problem that the cost is too high and cannot be mass-produced. The method of the present invention was successfully used to synthesize lactoyl-N-disaccharide, galactoyl-N-disaccharide, chitosan, and protein N-sugar chain core trisaccharide derivatives.

The invention discloses a gene engineering strain with high yield of 3 '-deoxyadenosine and application of the gene engineering strain, and belongs to the technical field of gene engineering. The genetic engineering strain is obtained by carrying out genetic modification on the strain, and the genetic modification comprises at least one of the following steps: a) overexpressing a ribonucleotide reductase gene rnr1; b) inactivating / weakening an adenosine kinase gene ad1; c) inactivating / weakening the adenine deaminase gene aah1; d) overexpressing a ribonuclease gene rny1; and e) an inactivation / weakening inhibition type vacuolar alkaline phosphatase gene pho8. According to the method, substrate metabolism kinetics is accurately matched in combination with an intermittent feeding strategy, finally, the yield of 3 '-deoxyadenosine reaches 20.58 g / L and reaches the highest yield reported at present, a'gene-process' dual-drive technical barrier is formed, and an efficient, stable and low-cost solution is provided for industrial production of nucleoside compounds.

Provided herein are compounds and methods for treating cancer. The methods comprise administering to a subject in need thereof a therapeutically effective amount of a cyclic sulfonamide RNR inhibitor disclosed herein.

Provided herein are methods of treating cancer in a subject that include administering to the subject a therapeutically effective amount of an inhibitor of UXS1, wherein the inhibitor of UXS1 comprises an inhibitory nucleic acid, and wherein the subject is diagnosed as having a UDGH-high cancer, thereby treating the UDGH-high cancer.

The invention discloses an application of allicin in promoting urea nitrogen to be converted into a nitrogen element in nucleotide or amino acid. Experiments show that the plant source compound allicin has the effect of promoting rumen urea nitrogen to be converted into nitrogen in nucleotide, sugar nucleotide or amino acid; when the garlicin is directly fed to ruminants or added as a feed additive into basic ration of the ruminants to feed the ruminants, urea nitrogen in feed can be promoted to be converted into nitrogen elements in nucleotide, sugar nucleotide or amino acid; the invention further provides a non-therapeutic method for promoting the ruminant to convert urea nitrogen into nitrogen in nucleotides, sugar nucleotides or amino acids, comprising feeding the ruminant with allicin directly or as a feed additive. The method has application prospects in the aspects of providing high-quality protein sources for livestock and poultry, reducing feed cost, improving livestock and poultry production performance and the like.

An aptamer composition is disclosed which has one or more oligonucleotides that include at least one of deoxyribonucleotides, ribonucleotides, derivatives of deoxyribonucleotides, derivatives of ribonucleotides, or mixtures thereof. The aptamer composition has a binding affinity for one or more cellular membrane glycoproteins selected from the group consisting of: intercellular adhesion molecule 1 (ICAM-1), low-density lipoprotein receptor (LDLR) family members, and cadherin-related family member 3 (CDHR3), preferably intercellular adhesion molecule 1 (ICAM-1), and is configured to reduce the binding of one or more human rhinoviruses to the intercellular adhesion molecule 1 (ICAM-1).

The invention provides the production of sugar-nucleotides and the isolation of sugar-nucleotides. In some embodiments the production or isolation are accomplished under acidic conditions. The production is a cell-free synthesis using enzymes, including immobilized enzymes. They may be accomplished using a one-pot reaction protocol. The synthesis may be used as a highly customizable and highly efficient cell-free manufacturing process. In some embodiments, the sugar-nucleotides are used to prepare UDP-Gal, lactose derivatives, and human milk oligosaccharides (HMOs).

The invention relates to the technical field of bioengineering, in particular to a preparation method and application of an immobilized enzyme. Compared with free enzyme, the immobilized enzyme prepared from the selected specific resin can be reused and is high in stability; the immobilized enzyme is easily separated from a reaction system, so that a product purification process can be simplified, and the product yield and quality are improved. Moreover, by immobilizing a sugar nucleotide producing enzyme and four sialyltransferases, a new strategy suitable for large-scale synthesis of functional sugar chains such as sialylated sugar chains is developed, the stability of related enzymes is improved, long-term storage and reutilization of the enzymes are realized, and the production cost of the functional sugar chains is reduced.

The present invention relates to an aptamer composition comprising at least one oligonucleotide comprising: deoxyribonucleotides, ribonucleotides, derivatives of deoxyribonucleotides, derivatives of ribonucleotides, and mixtures thereof; wherein the aptamer composition has binding affinity to one or more fungal species from the genus Malassezia.

The present invention provides production and isolation of sugar nucleotides. In some embodiments, the production or separation is accomplished under acidic conditions. Production is cell-free synthesis using enzymes, including immobilized enzymes. They may be accomplished using a one-pot reaction protocol. The synthesis can be used as a highly customizable and efficient cell-free manufacturing process. In some embodiments, sugar nucleotides are used to prepare UDP-Gal, lactose derivatives, and human milk oligosaccharides (HMOs).

The present application relates to the technical field of bioengineering, and particularly relates to a preparation method and application of immobilized enzyme. Compared with free enzyme, the immobilized enzyme prepared by selecting specific resin can be reused and has high stability; the immobilized enzyme is easy to separate from the reaction system, and can simplify the product purification process, improve the product yield and quality. Moreover, the present application develops a new strategy suitable for the large-scale synthesis of functional sugar chains such as sialylated sugar chains by immobilizing one kind of sugar nucleotide synthase and four kinds of sialyltransferase, improves the stability of related enzymes, realizes long-term preservation and reuse of the enzymes, and reduces the production cost of functional sugar chains.

An aptamer composition is disclosed which has one or more oligonucleotides that include at least one of deoxyribonucleotides, ribonucleotides, derivatives of deoxyribonucleotides, derivatives of ribonucleotides, or mixtures thereof. The aptamer composition has a binding affinity for one or more cellular membrane glycoproteins selected from the group consisting of: intercellular adhesion molecule 1 (ICAM-1), low-density lipoprotein receptor (LDLR) family members, and cadherin-related family member 3 (CDHR3), preferably intercellular adhesion molecule 1 (ICAM-1), and is configured to reduce the binding of one or more human rhinoviruses to the intercellular adhesion molecule 1 (ICAM-1).

The application discloses use of allicin in promoting urea nitrogen conversion into nitrogen element in nucleotide or amino acid. The application finds through experiments that plant source compound allicin has the effect of promoting rumen urea nitrogen conversion into nitrogen element in nucleotide, sugar nucleotide or amino acid, thus, feeding ruminants with allicin directly or adding allicin into the basic daily ration of ruminants as a feed additive can promote urea nitrogen conversion into nitrogen element in nucleotide, sugar nucleotide or amino acid in the feed; the application further provides a method for promoting ruminants to convert urea nitrogen into nitrogen element in nucleotide, sugar nucleotide or amino acid for non-treatment purposes, which comprises: feeding ruminants with allicin directly or as a feed additive. The application has application prospects in providing high-quality protein sources for livestock and poultry, reducing feed costs and improving production performance of livestock and poultry and the like.

The present invention is able to provide a method whereby the presence or absence of a sugar, a sugar derivative, or a nucleotide sugar can be detected using the same column and without contaminating the device. This is achieved by means of a method for detecting the presence or absence of a sugar, a sugar derivative, or a nucleotide sugar, the method comprising a washing step in which a washing solution is passed through a graphite carbon column, and an elution step in which the graphite carbon column which has undergone the washing step is used to separate a sugar and a sugar derivative by means of gradient elution or separate a nucleotide sugar by means of isocratic elution.

An aptamer composition is disclosed which has one or more oligonucleotides that include at least one of deoxyribonucleotides, ribonucleotides, derivatives of deoxyribonucleotides, derivatives of ribonucleotides, or mixtures thereof. The aptamer composition has a binding affinity for one or more cellular membrane glycoproteins selected from the group consisting of: intercellular adhesion molecule 1 (ICAM-1), low-density lipoprotein receptor (LDLR) family members, and cadherin-related family member 3 (CDHR3), preferably intercellular adhesion molecule 1 (ICAM-1), and is configured to reduce the binding of one or more human rhinoviruses to the intercellular adhesion molecule 1 (ICAM-1).

To provide a therapeutic pharmaceutical composition in the treatment or management of a disease or disorder in a subject.SOLUTION: A double-stranded RNA (dsRNA) comprising an antisense strand and a sense strand, wherein each strand has a 5' end and a 3' end; (1) the antisense strand comprises a sequence that is substantially complementary to the nucleic acid sequence of 5' CTCTCGGAATTCTCCATAACAAATATTT3 ' (SEQ ID NO: 1); (2) the antisense strand is at least 20 nucleotides in length; (3) the antisense strand comprises at least 50% 2'-O-methyl modification; (4) the nucleotides at any one or more of positions 2, 4, 5, 6, 8, 10, 12, 14, 16, and 20 from the 5' end of the antisense strand are not 2'-methoxy-ribonucleotides; And the like. Therapeutic pharmaceutical compositions are provided.SELECTED DRAWING: None

Provided herein are compounds and methods for the treatment of cancer. The methods include administering to a subject in need a therapeutically effective amount of a cyclic sulfonamide RNR inhibitor disclosed herein.

The invention discloses a gene engineering strain with high yield of 3 '-deoxyadenosine and application of the gene engineering strain, and belongs to the technical field of gene engineering. The genetic engineering strain is obtained by carrying out genetic modification on the strain, and the genetic modification comprises at least one of the following steps: a) overexpressing a ribonucleotide reductase gene rnr1; b) inactivating / weakening an adenosine kinase gene ad1; c) inactivating / weakening the adenine deaminase gene aah1; d) overexpressing a ribonuclease gene rny1; and e) an inactivation / weakening inhibition type vacuolar alkaline phosphatase gene pho8. According to the method, substrate metabolism kinetics is accurately matched in combination with an intermittent feeding strategy, finally, the yield of 3 '-deoxyadenosine reaches 20.58 g / L and reaches the highest yield reported at present, a'gene-process' dual-drive technical barrier is formed, and an efficient, stable and low-cost solution is provided for industrial production of nucleoside compounds.

Provided is a pharmaceutical which exhibits sufficient anticancer effects by using an antibody which binds to a mutant CALR protein and another anticancer agent in combination. Provided is a pharmaceutical for preventing and / or treating a cancer, comprising (A) an antibody which specifically binds to a mutant calreticulin protein or a functional fragment thereof and (B) at least one drug selected from the group consisting of an alkylating agent, a platinum preparation, an antimetabolite, a ribonucleotide reductase inhibitor, a nucleotide analog, a topoisomerase inhibitor, a microtubule polymerization inhibitor, an antitumor antibiotic, an interferon, a cytokine preparation, a molecular targeting drug, a nucleic acid synthesis inhibitor, a JAK inhibitor, and a cancer immunotherapeutic agent in combination.

Provided herein relates to nucleic acid polymerase variants and kits including the same, where the nucleic acid polymerase variant has an improved function and activity of performing template-independent nucleic acids synthesis using ribonucleotides (rNTPs) in a thermotolerant manner.

An aptamer composition is disclosed which has one or more oligonucleotides that include at least one of deoxyribonucleotides, ribonucleotides, derivatives of deoxyribonucleotides, derivatives of ribonucleotides, or mixtures thereof. The aptamer composition has a binding affinity for one or more cellular membrane glycoproteins selected from the group consisting of: intercellular adhesion molecule 1 (ICAM-1), low-density lipoprotein receptor (LDLR) family members, and cadherin-related family member 3 (CDHR3), preferably intercellular adhesion molecule 1 (ICAM-1), and is configured to reduce the binding of one or more human rhinoviruses to the intercellular adhesion molecule 1 (ICAM-1).

The present application relates to probes for improving melt resolution and multiplicity in nucleic acid assays. Methods and compositions for detecting and quantifying nucleic acids are provided. In certain embodiments, the method involves the use of cleavable probes comprising ribonucleotide positions susceptible to cleavage by endoribonucleases (e.g., RNase H) in the presence of a target nucleic acid molecule. The probes of the embodiments may also comprise non-natural nucleotides connected to a reporter group and / or a quenching moiety.

This invention discloses a method and application for the chemical enzymatic synthesis of O-glycopeptides, belonging to the field of pharmaceutical technology. The method includes the following steps: assembling a polypeptide intermediate using a solid-phase polypeptide synthesis method, wherein the amino acids at non-glycosylated active sites in the polypeptide intermediate are protected by sterically hindered protecting groups, while the hydroxyl groups on the amino acids at predetermined glycosylation sites are unprotected; glycosylation of the polypeptide intermediate with a glyconucleotide donor in the presence of a glycosyltransferase to obtain a glycopeptide intermediate; and reacting the glycopeptide intermediate with a deprotecting agent to remove the sterically hindered protecting groups, thus obtaining the target glycopeptide. This invention uses amino acids modified with protecting groups as raw materials, selectively protects the active hydroxyl sites in the amino acids, prepares polypeptide intermediates through solid-phase polypeptide synthesis, efficiently and accurately synthesizes the target glycopeptide intermediate with the help of glycosyltransferase synergistic catalysis, and finally obtains the target glycopeptide by removing the protecting groups through a catalyst.