18 results about "Sugar nucleotide" patented technology

Provided herein are methods of treating cancer in a subject that include administering to the subject a therapeutically effective amount of an inhibitor of UXS1, wherein the inhibitor of UXS1 comprises an inhibitory nucleic acid, and wherein the subject is diagnosed as having a UDGH-high cancer, thereby treating the UDGH-high cancer.

The invention provides a chain-specific library preparation method and a high-throughput sequencing method for rapidly detecting multiple types of RNAs (Ribonucleic Acid). The method comprises the following steps: artificially adding poly A tails at 3'tail ends of multiple RNAs by utilizing poly A polymerase; meanwhile, a polydeoxythymine ribonucleotide primer with deoxyuracil is used for synthesizing single-stranded cDNA under the action of reverse transcriptase, obtained single-stranded cDNA molecules are subjected to a series of reactions and finally subjected to PCR amplification to obtain strand specific libraries of multiple types of RNA, and samples of the libraries can be subjected to computer sequencing.

An aptamer composition is disclosed which has one or more oligonucleotides that include at least one of deoxyribonucleotides, ribonucleotides, derivatives of deoxyribonucleotides, derivatives of ribonucleotides, or mixtures thereof. The aptamer composition has a binding affinity for one or more cellular membrane glycoproteins selected from the group consisting of: intercellular adhesion molecule 1 (ICAM-1), low-density lipoprotein receptor (LDLR) family members, and cadherin-related family member 3 (CDHR3), preferably intercellular adhesion molecule 1 (ICAM-1), and is configured to reduce the binding of one or more human rhinoviruses to the intercellular adhesion molecule 1 (ICAM-1).

The present disclosure provides circular polyribonucleotides including a sequence including: a circularization element; a first spacer; an internal ribosome entry site (IRES) sequence; a sequence encoding a polypeptide; and a second spacer, where the sequence encoding the polypeptide has been codon-optimized to reduce the number of uracil ribonucleotides and / or reduce or remove TLR7- and TLR8-recognition motifs, and kits and compositions thereof. The present disclosure also provides methods of treating subjects in need thereof with the circular polyribonucleotides and compositions described herein.

The invention relates to the technical field of bioengineering, in particular to a preparation method and application of an immobilized enzyme. Compared with free enzyme, the immobilized enzyme prepared from the selected specific resin can be reused and is high in stability; the immobilized enzyme is easily separated from a reaction system, so that a product purification process can be simplified, and the product yield and quality are improved. Moreover, by immobilizing a sugar nucleotide producing enzyme and four sialyltransferases, a new strategy suitable for large-scale synthesis of functional sugar chains such as sialylated sugar chains is developed, the stability of related enzymes is improved, long-term storage and reutilization of the enzymes are realized, and the production cost of the functional sugar chains is reduced.

The present invention relates to an aptamer composition comprising at least one oligonucleotide comprising: deoxyribonucleotides, ribonucleotides, derivatives of deoxyribonucleotides, derivatives of ribonucleotides, and mixtures thereof; wherein the aptamer composition has binding affinity to one or more fungal species from the genus Malassezia.

The present application relates to the technical field of bioengineering, and particularly relates to a preparation method and application of immobilized enzyme. Compared with free enzyme, the immobilized enzyme prepared by selecting specific resin can be reused and has high stability; the immobilized enzyme is easy to separate from the reaction system, and can simplify the product purification process, improve the product yield and quality. Moreover, the present application develops a new strategy suitable for the large-scale synthesis of functional sugar chains such as sialylated sugar chains by immobilizing one kind of sugar nucleotide synthase and four kinds of sialyltransferase, improves the stability of related enzymes, realizes long-term preservation and reuse of the enzymes, and reduces the production cost of functional sugar chains.

An aptamer composition is disclosed which has one or more oligonucleotides that include at least one of deoxyribonucleotides, ribonucleotides, derivatives of deoxyribonucleotides, derivatives of ribonucleotides, or mixtures thereof. The aptamer composition has a binding affinity for one or more cellular membrane glycoproteins selected from the group consisting of: intercellular adhesion molecule 1 (ICAM-1), low-density lipoprotein receptor (LDLR) family members, and cadherin-related family member 3 (CDHR3), preferably intercellular adhesion molecule 1 (ICAM-1), and is configured to reduce the binding of one or more human rhinoviruses to the intercellular adhesion molecule 1 (ICAM-1).

The application discloses use of allicin in promoting urea nitrogen conversion into nitrogen element in nucleotide or amino acid. The application finds through experiments that plant source compound allicin has the effect of promoting rumen urea nitrogen conversion into nitrogen element in nucleotide, sugar nucleotide or amino acid, thus, feeding ruminants with allicin directly or adding allicin into the basic daily ration of ruminants as a feed additive can promote urea nitrogen conversion into nitrogen element in nucleotide, sugar nucleotide or amino acid in the feed; the application further provides a method for promoting ruminants to convert urea nitrogen into nitrogen element in nucleotide, sugar nucleotide or amino acid for non-treatment purposes, which comprises: feeding ruminants with allicin directly or as a feed additive. The application has application prospects in providing high-quality protein sources for livestock and poultry, reducing feed costs and improving production performance of livestock and poultry and the like.

An aptamer composition is disclosed which has one or more oligonucleotides that include at least one of deoxyribonucleotides, ribonucleotides, derivatives of deoxyribonucleotides, derivatives of ribonucleotides, or mixtures thereof. The aptamer composition has a binding affinity for one or more cellular membrane glycoproteins selected from the group consisting of: intercellular adhesion molecule 1 (ICAM-1), low-density lipoprotein receptor (LDLR) family members, and cadherin-related family member 3 (CDHR3), preferably intercellular adhesion molecule 1 (ICAM-1), and is configured to reduce the binding of one or more human rhinoviruses to the intercellular adhesion molecule 1 (ICAM-1).

To provide a therapeutic pharmaceutical composition in the treatment or management of a disease or disorder in a subject.SOLUTION: A double-stranded RNA (dsRNA) comprising an antisense strand and a sense strand, wherein each strand has a 5' end and a 3' end; (1) the antisense strand comprises a sequence that is substantially complementary to the nucleic acid sequence of 5' CTCTCGGAATTCTCCATAACAAATATTT3 ' (SEQ ID NO: 1); (2) the antisense strand is at least 20 nucleotides in length; (3) the antisense strand comprises at least 50% 2'-O-methyl modification; (4) the nucleotides at any one or more of positions 2, 4, 5, 6, 8, 10, 12, 14, 16, and 20 from the 5' end of the antisense strand are not 2'-methoxy-ribonucleotides; And the like. Therapeutic pharmaceutical compositions are provided.SELECTED DRAWING: None

The invention discloses a gene engineering strain with high yield of 3 '-deoxyadenosine and application of the gene engineering strain, and belongs to the technical field of gene engineering. The genetic engineering strain is obtained by carrying out genetic modification on the strain, and the genetic modification comprises at least one of the following steps: a) overexpressing a ribonucleotide reductase gene rnr1; b) inactivating / weakening an adenosine kinase gene ad1; c) inactivating / weakening the adenine deaminase gene aah1; d) overexpressing a ribonuclease gene rny1; and e) an inactivation / weakening inhibition type vacuolar alkaline phosphatase gene pho8. According to the method, substrate metabolism kinetics is accurately matched in combination with an intermittent feeding strategy, finally, the yield of 3 '-deoxyadenosine reaches 20.58 g / L and reaches the highest yield reported at present, a'gene-process' dual-drive technical barrier is formed, and an efficient, stable and low-cost solution is provided for industrial production of nucleoside compounds.

Provided herein relates to nucleic acid polymerase variants and kits including the same, where the nucleic acid polymerase variant has an improved function and activity of performing template-independent nucleic acids synthesis using ribonucleotides (rNTPs) in a thermotolerant manner.

An aptamer composition is disclosed which has one or more oligonucleotides that include at least one of deoxyribonucleotides, ribonucleotides, derivatives of deoxyribonucleotides, derivatives of ribonucleotides, or mixtures thereof. The aptamer composition has a binding affinity for one or more cellular membrane glycoproteins selected from the group consisting of: intercellular adhesion molecule 1 (ICAM-1), low-density lipoprotein receptor (LDLR) family members, and cadherin-related family member 3 (CDHR3), preferably intercellular adhesion molecule 1 (ICAM-1), and is configured to reduce the binding of one or more human rhinoviruses to the intercellular adhesion molecule 1 (ICAM-1).

This invention discloses a method and application for the chemical enzymatic synthesis of O-glycopeptides, belonging to the field of pharmaceutical technology. The method includes the following steps: assembling a polypeptide intermediate using a solid-phase polypeptide synthesis method, wherein the amino acids at non-glycosylated active sites in the polypeptide intermediate are protected by sterically hindered protecting groups, while the hydroxyl groups on the amino acids at predetermined glycosylation sites are unprotected; glycosylation of the polypeptide intermediate with a glyconucleotide donor in the presence of a glycosyltransferase to obtain a glycopeptide intermediate; and reacting the glycopeptide intermediate with a deprotecting agent to remove the sterically hindered protecting groups, thus obtaining the target glycopeptide. This invention uses amino acids modified with protecting groups as raw materials, selectively protects the active hydroxyl sites in the amino acids, prepares polypeptide intermediates through solid-phase polypeptide synthesis, efficiently and accurately synthesizes the target glycopeptide intermediate with the help of glycosyltransferase synergistic catalysis, and finally obtains the target glycopeptide by removing the protecting groups through a catalyst.

The application belongs to the technical field of plant genetic engineering, and particularly relates to application of a maize ribonucleotide reductase large subunit ZmLSC1 gene in plant variety breeding. The application is particularly applied in obtaining a plant variety with promoted plant growth or a plant variety with slowed leaf senescence. The coding region nucleotide sequence of the maize ribonucleotide reductase large subunit ZmLSC1 gene is shown in SEQ ID NO. 1. The application analyzes a plant with overexpression of the ZmLSC1 gene through plant genetic engineering technology, and first discloses the role of the ZmLSC1 gene in regulating plant growth and development. The gene can be used in molecular breeding to cultivate plants with fast growth and high biomass, and has great application value in plant breeding.

The invention belongs to the technical field of biosynthesis, and relates to a multi-enzyme catalysis system and method for synthesizing functional glycans. The system comprises a substrate module comprising nucleoside monophosphate, monosaccharide, polyphosphate and acceptor molecules; the nucleoside monophosphoric acid is one or more of uridine monophosphoric acid, adenosine monophosphoric acid, guanosine monophosphoric acid or cytidine monophosphoric acid; an enzyme module comprising a polyphosphate kinase, at least one remedial pathway synthetase, and at least one glycosyltransferase; the cofactor module comprises magnesium ions and optional inorganic pyrophosphatase; the system can realize in-situ regeneration of sugar nucleotide with nucleoside monophosphate as an initial cofactor and one-pot synthesis of target glycan. The invention systematically proposes that cheap NMP is used as a unique or main starting cofactor to replace expensive NTP or NDP for in-situ regeneration of various sugar nucleotides for the first time. Cofactor cost can be reduced by dozens of times, and a foundation is laid for large-scale production of glycans.

The present application relates to mRNA, capping enzyme activity detection kit and detection system and detection method, application. The mRNA is used for detecting capping enzyme activity, the chain length of the mRNA is 20nt-40nt, the base sequence of the mRNA is composed of A base and G base, and the number of A base accounts for 29%-71%. In the present study, the mRNA optimized by sequence is composed of adenine ribonucleotide (A) and guanine ribonucleotide (G), which can minimize the degradation of RNase in the environment, and can stably and repeatedly detect the capping enzyme activity, so as to stably and efficiently screen the capping enzyme and its mutant strain.