29 results about "Nitenpyram" patented technology

The invention discloses a neonicotinoid insecticide degrading strain B27 and application thereof, the neonicotinoid insecticide degrading strain B27 is identified as Flexivirga sp. And is preserved in the China Center for Type Culture Collection (CCTCC), and the preservation number is CCTCC NO: M 2022981. According to the invention, a new strain Flexivirga sp.B27 is separated and screened from soil in which earthworms move, and can be used for degrading neonicotinoid insecticides such as imidacloprid, acetamiprid and nitenpyram; the degrading bacterium B27 disclosed by the invention can be used for degrading residual neonicotinoid insecticides in soil or a water body environment, so that the problem of pollution residues of the neonicotinoid insecticides to the soil or the water body environment is solved, and new resources of the degrading bacterium of the Flexivirga neonicotinoid insecticides are enriched.

The invention discloses a compound mosquito larvae killing composition and application thereof. The compound mosquito larvae killing composition comprises 1% to 5% of active ingredients, 0% to 5% of liquid original drug adsorbent, and 2% to 8% of slow-release coating agent (including 1% to 4% of active ingredients A and active ingredients B, wherein the active ingredient A is a piperic acid derivative compound, and the active ingredient B is selected from any one of pyriproxyfen, fenthion, dimethoate, fenoxycarb, S-methoprene, dinotefuran, thiamethoxam, acetamiprid, imidacloprid, nitenpyram, cyantraniliprole, and chlorantraniliprole. The active ingredients A and B are compounded and processed into granules for mosquito larvae control, and the granules have good lethal effect, long lasting effect, slow-release effect, and reduced labor cost; the compound mosquito larvae killing composition can be widely used in sewage ditches, sewers, and other places, and has special effects on mosquito larvae control.

The invention relates to the technical field of pesticides, in particular to a pesticide composition, application thereof and a pesticide preparation. The pesticide composition comprises a first effective component and a second effective component, the first effective component is 1, 8-cineole, and the second effective component comprises at least one of flonicamid, cyantraniliprole, nitenpyram, flubendiamide, spirotetramat, pyriproxyfen, pymetrozine, dinotefuran and sulfoxaflor. The mass ratio of the first effective component to the second effective component is (50: 1)-(1: 100). Through the synergistic interaction of the first effective component and the second effective component, the prevention and treatment effect is remarkably improved, the prevention and treatment spectrum is expanded, and the field dosage can be greatly reduced; specifically, leaf back bemisia tabaci and trialeurodes vaporariorum can be well controlled, the control effect on bemisia tabaci, trialeurodes vaporariorum, thrips and the like is improved, and the application prospect is good.

The invention discloses a soluble binary compound killing agent for piercing-sucking mouthpart pests, the killing agent is a soluble liquid agent, the components of the killing agent comprise nitenpyram, flonicamid and an auxiliary agent, and the mass ratio of the nitenpyram to the flonicamid in the killing agent ranges from 1: 50 to 50: 1. The nitenpyram and the flonicamid are effective components, after compounding, the pesticide resistance process can be delayed, the dosage can be reduced, the use cost can be reduced, the environmental pollution can be reduced, the insecticidal spectrum can be expanded, and the synergistic effect of compounding and addition can be achieved.

The present invention belongs to the technical field of pesticide insecticides and discloses an insecticidal composition containing a nicotinoid insecticide and its use. The insecticidal composition comprises an active ingredient A and an active ingredient B, wherein the active ingredient A is isoflualanam, and the active ingredient B is a nicotinoid insecticide, wherein the nicotinoid insecticide is any one of sulfluramid, sulfoxaflor, clothianidin, thiamethoxam, acetamiprid, thiacloprid, imidacloprid, dinotefuran, nitenpyram, and flupyradone, and the mass ratio of the active ingredient A to the active ingredient B is 1:40 to 45:1. The insecticidal composition of the present invention has the advantages of significant synergistic effect, delayed resistance, and low drug cost.

The invention relates to a fluazinam-containing pesticide composition, a seed treatment suspending agent as well as a preparation method and application of the seed treatment suspending agent. The invention provides a fluazinam-containing pesticide composition. The active ingredients of the fluazinam-containing pesticide composition comprise fluazinam, fludioxonil and clothianidin, the mass ratio of the clothianidin to the fluazinam to the fludioxonil is (6-7): (0.4-0.8): (0.2-0.6), and the composition has an excellent synergistic effect. The suspending agent for seed treatment is compounded with a film-forming agent composed of acrylate and polydimethylsiloxane according to a specific proportion, it can be ensured that seed coats are not prone to falling off after being coated, meanwhile, adjustment can be conducted according to environmental adaptability, a coating layer is evenly mixed with a pesticide and pigment, the release time of effective components of pesticides is prolonged, and the pesticide effect is improved. The problem of seed coating fading is effectively solved, and the pesticide composition has an excellent effect in prevention and treatment of agricultural diseases such as peanut root rot, grub, wheat stem rot and aphid.

This application relates to the field of pesticide compositions, specifically disclosing a water-dispersible granule of chlorpyrifos·acetamiprid and its preparation method, comprising the following raw materials in parts by weight: chlorpyrifos 40-50 parts; acetamiprid 15-25 parts; dispersant 8-12 parts; emulsifier 3-7 parts; synergist 0.5-1 part; mineral oil 3-5 parts; anti-caking agent 3-5.5 parts; cassava starch 2-8 parts; activated carbon powder 5.5-8 parts. The preparation method includes the following steps: S1, mixing the raw materials evenly according to the specified ratio; S2, granulating after air jet milling, drying, and sieving to obtain the water-dispersible granule. This application has the effect of inhibiting the migration of acetamiprid in the soil and reducing pesticide pollution of water resources.

The present invention belongs to the technical field of pesticide insecticides and discloses a pesticide composition and its use. The active ingredients of the pesticide composition include active ingredient A and active ingredient B, wherein active ingredient A is a compound of formula (I), and active ingredient B is selected from any one of nitenpyram, ethiprole, and dichlorothiapyr. The mass ratio of active ingredient A to active ingredient B is 1:50 to 42:1. The pesticide composition of the present invention has excellent control effects on Hemipteran pests in agricultural, forestry, or horticultural production.

The invention discloses a dispersible oil suspending agent containing nitenpyram as well as a preparation method and application thereof, and relates to the field of pesticides, the dispersible oil suspending agent containing nitenpyram is prepared from the following raw materials in parts by weight: 1-30 parts of isoxazole, 1-30 parts of nitenpyram, 5-18 parts of an emulsifier, 0.2-12 parts of a biosurfactant, 5-25 parts of a cosolvent, 30-50 parts of an oil phase medium and other auxiliaries acceptable to the pesticide dispersible oil suspending agent; wherein the cosolvent is selected from one or more of N, N-dimethyl formamide, N, N-dimethyl acetamide and N-methyl pyrrolidone. Through mutual cooperation of the emulsifier and the cosolvent, the decomposition rate of the nitenpyram in the oil suspending agent formed by mixing the isotolfenpyrad and the nitenpyram is smaller than 5%, and the problem that the nitenpyram is easy to decompose in the oil suspending agent is solved.

The invention discloses a microbial enzyme synergistic pymetrozine and nitenpyram water dispersible granule which comprises the following components in percentage by weight: 40-70% of a pymetrozine active compound, 10-25% of a nitenpyram active compound, 1-10% of microbial enzyme, 1-15% of a dispersing agent, 1-10% of a wetting agent, 1-10% of a stabilizer, 1-10% of a buffer solution, 2-10% of an adhesive and the balance of a carrier. The invention also provides a preparation method of the composition. Compared with the prior art, the synergistic water dispersible granule has the advantages that the epidermis or digestive system of pests is destroyed by enzyme generated by specific microorganisms, and the pymetrozine and nitenpyram are combined to form the synergistic water dispersible granule, so that the control effect can be improved, the use of chemical agents can be reduced, and the water dispersible granule is short in disintegration time and low in cost. The suspension rate is greater than or equal to 90%, and the suspension can be used for unmanned aerial vehicle flight prevention and adapts to different water quality conditions.

The invention relates to the technical field of pesticide residue detection, in particular to a method for rapidly screening neonicotinoid and macrolide pesticide residues in vegetables through trichogramma chilonis. The 10% lethal effect condition of the trichogramma on nine kinds of common neonicotinoid or macrolide pesticides such as imidacloprid, acetamiprid, dinotefuran, thiamethoxam, clothianidin, nitenpyram, abamectin, methylamino abamectin benzoate and ivermectin is determined; acute toxic effects and action rules of nine common neonicotinoid or macrolide pesticides in vegetables on trichogramma are researched; according to the method, the 1-hour action dose of the pesticide is determined by adopting 10% of death effect, the detection limit of the trichogramma biotoxicity method on the residues of the 9 pesticides in the vegetables is calculated by combining the quality and surface area of the vegetables, and finally, the common neonicotinoid or macrolide pesticide residues in the vegetables are rapidly screened by adopting the trichogramma biotoxicity limit value determination method.

The present invention relates to a dry flowable agricultural composition of nitenpyram, and pymetrozine. More specifically, synergistic dry flowable (DF) insecticidal composition of nitenpyram, pymetrozine along with suitable agrochemical additives, and its preparation thereof.

The invention discloses a biochar immobilized acetamiprid degrading bacterial agent and a preparation method and application thereof, and belongs to the technical field of microbial agents, the degrading bacterial agent comprises the following raw materials: an immobilization carrier and a streptomyces obscura liquid, the immobilization carrier is corn straw biochar or modified corn straw biochar; the modified corn straw biochar is boric acid polylysine modified corn straw biochar; the streptomyces obscura liquid is obtained by fermenting and culturing streptomyces obscura gl2-18; the streptomyces obscura gl2-18 is immobilized in the corn straw biochar or the modified corn straw biochar, so that the problems that free streptomyces obscura gl2-18 is sensitive to environmental stress, difficult to plant and easy to wash away are solved, and rich nutrient substances and a stable growth environment are provided for strains; meanwhile, the target pollutant acetamiprid is enriched, and the contact efficiency of the fungicide and the pollutant is improved, so that the degradation efficiency is synergistically improved.

The invention belongs to the field of pesticides, and relates to a pesticide composition and application, the pesticide composition comprises an active component A and an active component B, the active component A is any one of imidacloprid, dinotefuran and nitenpyram, the active component B is a compound of formula (I), and the mass ratio of the active component A to the active component B is 1: 64-60: 1. The pesticide composition disclosed by the invention has an excellent prevention and treatment effect on hemiptera pests, has a remarkable synergistic effect under a certain mass ratio, can delay the generation of drug resistance of the pests, and is safe to the environment.

The application discloses a kind of intestinal probiotics for improving the resistance of bees nitenpyram and application thereof.Gilliamella sp.G0441, the preservation number is GDMCC NO:65723.The chemical substance probiotic supplement-Gilliamella sp.G0441 developed this time is the core bacteria of bee intestine, so using the substance will not cause pollution to bee products and natural environment, and will not harm bees.High efficiency.It is proved by test that Gilliamella sp.G0441 can significantly reduce the harm of nitenpyram to bees.

This invention belongs to the field of agricultural nanoparticle formulations and green pest control technology, specifically relating to an insecticide nano-synergist Cu-TA, its preparation method, and its application. The Cu-TA consists of nanoparticles formed by the coordination assembly of copper ions and tannic acid. The Cu-TA can be used in combination with various insecticides to increase the sensitivity of brown planthoppers, white-backed planthoppers, cotton aphids, rice stem borers, and common thrips to pesticides, and to improve the field control effect on brown planthoppers. Furthermore, the combined use of Cu-TA and acetamiprid can reduce the actual heritability of resistance to acetamiprid in brown planthoppers, thereby delaying the development of resistance.

The invention discloses two typical neonicotinoid insecticide aptamers, dinotefuran and nitenpyram are respectively taken as targets, graphene oxide is adopted to adsorb ssDNA sequences which are not combined with the targets, and the dinotefuran and nitenpyram aptamers are obtained through screening. The sequence of the dinotefuran aptamer is CGCAAGTGTTGGCCC-AGGTCGACGCATGCGCCG, and the dissociation constant of the dinotefuran aptamer to the dinotefuran is 48.03 nM. The dinotefuran aptamer can be used for preparing the dinotefuran. The sequence of the aptamer of the nitenpyram is TAGGGAATTCGTCGACGGATCCGCTGGGTGTACGACGTCCCTA, and the dissociation constant of the aptamer of the nitenpyram to the nitenpyram is 25.20 nM. Specific analysis finds that the two aptamers obtained through screening only have a recognition effect on dinotefuran and nitenpyram and do not have affinity to other insecticides. Molecular docking results show that the aptamer is mainly combined with dinotefuran and nitenpyram through hydrogen bonds and hydrophobic interaction. According to the aptamer screening method, the target does not need to be specified, the affinity of the aptamer obtained through screening to the target is improved through combination of positive screening and negative screening, and a new recognition element is provided for construction of a dinotefuran and nitenpyram detection method.

The invention relates to a pesticide composition containing a nicotine compound and application of the pesticide composition. The pesticide composition is prepared from flufenican amide, acetamiprid, thiamethoxam or clothianidin and the like. The pesticide composition has an obvious synergistic effect, the usage amount of pesticides is reduced, the residual amount of the pesticides on crops is reduced, and the environmental friendliness is enhanced. The pesticide composition disclosed by the invention has an excellent control effect on target pests such as chilo suppressalis, plutella xylostella, green peach aphid, beet armyworm, ostrinia nubilalis, thrips, flea beetle, spider mites, brown planthopper or liriomyza sativae.

The invention discloses a seed coating agent as well as a preparation method and application thereof, and belongs to the technical field of pesticide mixtures. The active ingredients of the seed coating agent are fluxapyroxad, clothianidin and bacillus subtilis. The seed coating agent has double effects of disease and pest control and growth promotion, can synchronously control seed-borne diseases, soil-borne diseases and seedling-stage pests, and remarkably improves the control effect on diseases and pests of cereal crops; meanwhile, crop root growth and development can be promoted, and the survival rate is increased through rooting and seedling strengthening. The technical defects of insufficient prevention effect, high cost and serious pollution in traditional seed treatment are overcome in a low-toxicity environment-friendly mode, the defect that a traditional seed coating agent is difficult to take both fast-acting property and long-acting property into account is overcome, and an efficient and environment-friendly technical scheme is provided for seed treatment.

The invention relates to an application of a compound of a sogatella furcifera symbiotic bacterium acinetobacter HUNAN-1, dinotefuran and nitenpyram in prevention and treatment of sogatella furcifera. According to the invention, on the basis that the HUNAN-1 strain bacterial liquid has the effect of killing sogatella furcifera, through compounding with the pesticides dinotefuran and nitenpyram, the effect of enhancing the insecticidal effect of the compound agent is realized, and the usage amount of the pesticides is reduced. The invention can delay the generation of pest resistance to drugs and reduce the pollution of pesticides to the environment, and has a good application prospect.

The invention belongs to the field of pesticide insecticide technology and relates to an emulsifiable concentrate containing bifenthrin and nitenpyram and its preparation method and application. The emulsifiable concentrate is composed of the following weight percentage components: bifenthrin 1-50%, nitenpyram 1-50%, emulsifier 1-30%, wetting and penetrating agent 1-15%, and the balance is a composite solvent; the composite solvent is composed of a sulfur-containing solvent, an ester and ether ester solvent, and an aromatic solvent, and the weight ratio of the sulfur-containing solvent, the ester and ether ester solvent, and the aromatic solvent is (1-2): (1-5): (1-8). The emulsifiable concentrate preparation component system containing bifenthrin and nitenpyram of the present invention is reasonable, the degradation rate of nitenpyram and bifenthrin is low, the emulsifying effect is good, and the low-temperature stability and heat storage stability are good, and the preventive effect on multiple target pests is remarkable.

The invention belongs to the field of agricultural insecticides, and particularly relates to an insecticidal composition containing metarhizium anisopliae and nitenpyram and application of the insecticidal composition. The insecticidal composition is prepared from metarhizium anisopliae, nitenpyram and a pesticide synergist, the pesticide synergist is YUS-AN4, Silwet 408 or a synergist combination consisting of the YUS-AN4, the Silwet 408 and G-2801, and the pesticide synergist is a pesticide synergist combination consisting of the YUS-AN4, the Silwet 408 and the G-2801. The insecticidal composition can be used for preventing and treating tomato greenhouse trialeurodes vaporariorum. According to the invention, chemical agents and biological agents are compounded for use, so that the use amount of the chemical agents is reduced, and the problem of '3R' caused by long-term use of chemical pesticides is avoided; in addition, the pesticide synergist is added into the metarhizium anisopliae and nitenpyram compounded insecticide composition, so that the control effect of the insecticide can be remarkably improved. The insecticidal composition disclosed by the invention has the characteristics of fast effectiveness, good persistence, reduction of environmental pollution and the like required in actual agricultural production, can effectively ensure the quality safety of agricultural products, and has important practical guiding significance in development of green agricultural products.

The application discloses a tea tree summer short-bud cutting rapid seedling forming method, which comprises field nursery construction, seedbed treatment, cutting taking, cutting and field nursery management; the field nursery management comprises illumination management, water management, cutting post-pouring, 3-4 times of daily watering, soil humidity control at 65-75%, cutting initial stage management, 6-8 days after cutting, 17:00 spraying of thiophanate-methyl, 15% validamycin, humic acid foliar fertilizer and 34% propargite, 18-20 days after cutting, 17:00 spraying of kresoxim-methyl, 15% validamycin, humic acid foliar fertilizer, azoxystrobin-propineb and nitenpyram-pymetrozin, topdressing, 1 month after cutting, first time of topdressing of water-soluble compound fertilizer, 10 days of interval, 4 times of continuous topdressing, 10-12 cm of seedling height, second time of topdressing of water-soluble compound fertilizer and seedling training.

The invention belongs to the technical field of pesticides, and particularly relates to a pesticide composition for preventing and treating rice brown planthopper, which is prepared by compounding thiodicyclaniliprole and triflumezopyrim according to the mass ratio of (1-30): (30-1), or compounding thiodicyclaniliprole and nitenpyram according to the mass ratio of (1-40): (40-1). When the thiodicyclaniliprole, the triflumezopyrim and the nitenpyram are compounded according to the mass ratio of (1-7): (15-1) and the mass ratio of (1-20): (8-1) respectively, the co-toxicity coefficient of the compounded composition on the rice brown planthopper is larger than 120, the compounded composition shows a synergistic effect, the control effect on the rice brown planthopper can be improved, the application dosage of the pesticide can be reduced, and the pesticide cost is reduced. The control cost and the drug resistance risk can be reduced, and a support can be provided for effectively controlling the brown planthopper of the rice and realizing high quality and high yield of the rice.

The invention relates to an agricultural chemical insecticidal mixture. The agrochemical insecticidal mixture comprises a biologically active agent selected from the group consisting of garlic extracts, garlic oils and mixtures thereof in combination with a further insecticidal agent selected from the group consisting of neonicotinoid, pyrethroids, pyrrolealkenes, diamides, benzoylurea, METI acaricides, METI insecticides, mesoionic compounds, pyridine azomethine derivatives, and combinations thereof. The insecticidal composition is prepared from the following raw materials: tetronic acid and tetramic acid derivatives, phenyl pyrazole, flonicamid, saflufenacil, sulfoxaflor and a mixture thereof; and a method for controlling pests and protecting a crop from pest infestation comprising treating a crop with an effective amount of the agrochemical insecticidal mixture.

The invention belongs to the technical field of pesticides, and relates to a pesticide composition and application thereof. Effective components of the pesticide composition comprise an active component A and an active component B, the active component A is a compound shown in a formula (I), the active component B is any one of flufenacet nicotinamide, pyriminostrobin and cycloxaprid, and the mass ratio of the active component A to the active component B is 1: 40-35: 1. The composition has the advantages of synergism, resistance delay and the like, and is used for preventing and treating hemiptera pests.

The present invention relates to the field of pest control and insecticides. More specifically, it pertains to a synergistic insecticidal composition that combines nitenpyram, pyriproxyfen, and tolfenpyrad for enhanced efficacy against a wide range of insect pests.

This invention belongs to the field of agricultural insecticides, specifically an insecticidal composition comprising Metarhizium anisopliae and acetamiprid, and its application. The insecticidal composition includes Metarhizium anisopliae, acetamiprid, and a pesticide synergist. The pesticide synergist is YUS-AN4, Silwet408, or a combination of YUS-AN4, Silwet408, and G-2801. The insecticidal composition of this invention can be used for the control of whiteflies in tomato greenhouses. This invention combines chemical and biological agents, reducing the amount of chemical agents used and avoiding the "3R" problems (reduction, redundancy, and resource depletion) caused by long-term use of chemical pesticides. Furthermore, the addition of a pesticide synergist to the Metarhizium anisopliae and acetamiprid insecticide composition significantly enhances the control effect. The insecticidal composition of this invention combines the characteristics of rapid effectiveness, long-lasting effect, and reduced environmental pollution required in actual agricultural production, effectively ensuring the quality and safety of agricultural products and providing important practical guidance for the development of green agricultural products.

Pesticidal mixtures comprising as active compounds 1) at least one isochinoline compound A of formula I: wherein R is CH2-pyrimidine-2 or cyclpropyl; and 2) at least one further compound B selected from ethiprole and fipronil; alpha-cypermethrin, bifenthrin, cyfluthrin, etofenprox, lamda-cyhalothrin, gamma-cyhalothrin, deltamethrin; thiameth-oxam, imidacloprid, clothianidin, acetamiprid, thiacloprid, dinotefuran, nitenpyram, sulfoxaflor, flupyradifurone, triflumezopyrim; spinosad, spinetoram; abamectin, emamectin benzoate; pyriproxyfen; pymetrozine, afidopyropen; chlorfenapyr; teflubenzuron; buprofezin; methoxyfeno-zide; indoxacarb; spirotetramat, spiropidion, spidoxamat; chlorantraniliprole, cyantraniliprole, cyhalodiamide, cyclaniliprole, flubendiamide, tetrachlorantraniliprole, tetraniliprole; flonicamid; broflanilide; dicloromezotiaz, dimpropyridaz, flupyrimin, and oxazosulfyl; methods and use of these mixtures for combating invertebrate pests such as insects, arachnids or nematodes in and on plants, and for protecting such plants being infested with pests, especially also for protecting plant propagation material as like seeds.