28 results about "Dimethoate" patented technology

The invention relates to a dinotefuran and fenobucarb emulsion in water and a preparation method thereof, and belongs to the technical field of agricultural chemicals. According to the dinotefuran and fenobucarb emulsion in water and the preparation method thereof, the dinotefuran and fenobucarb emulsion in water with smaller particle size and more uniform particle size distribution is prepared by selecting a specific emulsifier and a stabilizer, the stabilizer contains a hydrophilic sulfonate group, a hydrophilic quaternary ammonium salt group, cyclic piperidine and an imidazole group, and a molecular chain contains an appropriate carbon chain, so that the dinotefuran and fenobucarb emulsion in water is prepared. The emulsion in water has good hydrophilicity and lipophilicity, can effectively and stably disperse dinotefuran and fenobucarb in water at the same time through the synergistic effect with the polyethylene glycol butyl ether emulsifier and the physical and chemical effect of each functional group with dinotefuran and fenobucarb, can endow the emulsion in water with good wettability, can quickly wet the surfaces of pests, and has the advantages of no toxicity and no harm to the environment. The diffusion rate of the dinotefuran and the fenobucarb from the body surfaces of the spider millettii and the oriental rice locust to the body is increased, and the insecticidal efficiency of the dinotefuran and the fenobucarb is improved.

The invention discloses an enzyme biosensor for rapid detection of organophosphorus pesticide dimethoate as well as preparation and application of the enzyme biosensor, and relates to the field of electrochemical sensors. The method comprises the following steps: preparing GR / GCE, preparing AuNPs / GR / GCE, and preparing AChE / AuNPs / GR / GCE. Graphene and gold nanoparticles are compounded to form AuNPs / GR / GCE, the electrochemical impedance of the glassy carbon electrode is remarkably reduced, the effective specific surface area of the glassy carbon electrode is increased, the electron transfer rate of the surface of the glassy carbon electrode is increased, rich binding sites are provided for immobilization of enzyme molecules, the stability of enzyme is improved, and degradation or inactivation of the enzyme in the using process is reduced; acetylcholine esterase is used as a recognition probe, AChE / AuNPs / GR / GCE is constructed on AuNPs / GR / GCE in a self-assembly mode, dimethoate can prevent acetyl thiocholine iodide from being hydrolyzed to generate thiocholine, electrochemical response signals are reduced, and the dimethoate has good electrochemical response signals, so that the organophosphorus pesticide dimethoate residue is rapidly, accurately and safely screened on site.

The application discloses application of a microbial natural product GameXPeptide-A in improving the control effect of insecticides on pests, and belongs to the technical field of biological control. Experiments prove that GameXPeptide-A can effectively improve the insecticidal activity of insecticides on agricultural pests such as thrips, corn borer and prodenia litura when GameXPeptide-A is combined with insecticides such as Metarrhizium anisopliae, Beauveria bassiana, nuclear polyhedrosis virus, 4% abamectin and pyridaben, 10% dimethoate and spinosad, 30% ethoxazole, 45% bifenthrin and etoxazole, 5% spinosad, 5% chlorantraniliprole, 5% abamectin and the like, and it is indicated that the substance can be combined with different insecticides to improve the insecticidal activity of insecticides on pests such as Lepidoptera, Diptera, Coleoptera, Orthoptera, Hemiptera and Homoptera in agricultural production, and can be used for the development and application of a new type of pest immunosuppressant or insecticide synergist.

The invention relates to a method for detecting pesticide based on a ferriporphyrin modified covalent organic framework nano-enzyme sensing array. According to the invention, ferriporphyrin molecules are loaded on a porous and ordered COFs skeleton, so that excellent peroxidase simulated catalytic activity is realized, H2O2 can be catalyzed to be decomposed to generate reactive oxygen free radicals, and TMB, OPD and ABTS chromogenic reactions are catalyzed. Based on the performance, a three-channel colorimetric sensing array is constructed to detect and distinguish various pesticides such as malathion, profenofos, chlorpyrifos, acephate and dimethoate, and the detection limit is as low as 0.341 nM. After different pesticides are adsorbed to active sites, catalytic reaction can be remarkably inhibited, and specific colorimetric fingerprint signals are generated. Colorimetric data is further combined with a machine learning algorithm, high-accuracy classification and recognition of single pesticides and mixtures thereof are achieved by means of a multilayer sensor, a support vector machine, a random forest and other models, the classification accuracy of an MLP model reaches 90%, ROC curve AUC exceeds 0.97, and the reliability of the detection method is proved.

The invention discloses an FET (Field Effect Transistor) biosensor based on aptamer functionalized carbon nanotubes as well as a preparation method and application of the FET biosensor, and belongs to the technical field of pesticide residue detection. The FET biosensor comprises a chip provided with a conducting channel and an aptamer recognition layer constructed on the chip, according to the chip, a semiconductor single-walled carbon nanotube film sorted by polycarbazole is used as a conducting channel, and gold nanoparticles are synthesized on the surface of the channel in situ; the aptamer recognition layer contains a specific aptamer and is fixed with the nano-gold particles through a gold-sulfur bond. Meanwhile, the invention also provides a preparation method of the FET biosensor. The detection limits of the sensor to chlorpyrifos, isocarbophos and omethoate in a phosphate buffer solution respectively reach 0.51 fM, 0.47 fM and 0.21 fM, the linear detection range is 1 * 10 < M > to 1 * 10 < M >, the adding standard recovery rate is 86-105%, and the variation between the sensors is less than 5%. Specific experiments show that the sensor has no obvious response to non-organophosphorus pesticides.

A pesticidal emulsifiable concentrate with widened spectrum of action on plurality of pest insects comprising bio-effective synergistic amount of Dimethoate active content particularly in an amount ranging from 15% to 25% weight percent ratio and Cypermethrin active content particularly in an amount ranging from 1.0 % to 10.0% weight percent ratio with respect to the said emulsifiable concentrate, along with particular agriculturally acceptable adjuvants in particular amounts. The present invention is also related to a process for the preparation of said synergistic Emulsifiable concentrate composition and in further use having significant broad agrochemical utility in many crops, without causing phytotoxic damage to any part of the plant, non-toxic and environmentally harmonious &. safe to natural enemies.

The invention relates to the field of biodegradation, in particular to a pesticide residue degradation composite enzyme based on delftia and a preparation method and equipment thereof.The pesticide residue degradation composite enzyme comprises a smashing cylinder, the bottom of the smashing cylinder penetrates through and is fixedly connected with a feeding cylinder, the bottom of the feeding cylinder is connected with a screening assembly, and supporting blocks are fixedly connected to the four corners of the bottom of the smashing cylinder; a first motor is fixedly connected to the top of the smashing barrel, the output end of the first motor penetrates through the smashing barrel to be fixedly connected with a smashing rod, smashing blades are fixedly connected to the outer portion of the smashing rod, a constant-temperature shaking table is arranged on the right side of the smashing barrel, and a fermentation tank is arranged on the right side of the constant-temperature shaking table; the top of the fermentation tank is fixedly connected with a second motor. The degradation rates of the enzyme for organophosphorus pesticides such as phoxim, dichlorvos and dimethoate with the concentration of 200 mg / L within 48 hours reach 93.8%, 92.5% and 91.2% respectively and are far higher than those of mainstream biodegradable products (72%-80%) in the market, and the degradation period is only 5 days and is shortened by 83% compared with that of a traditional enzyme.

The application belongs to the technical field of dressing reagent research and development, and particularly relates to application of a lead sulfide collector in flotation of complex polymetallic mixed minerals, and a preparation method of the lead sulfide collector is performed according to the following steps: (1) weighing dimethoate, and grinding to below 0.074 mm; (2) placing the ground dimethoate into a stirrer, keeping stirring, and adding water into the stirrer at a proportion of 1:49 by weight; (3) continuously stirring for 30 minutes until the raw materials are fully dissolved, so as to obtain the lead sulfide collector; the dimethoate (Dimethoate) has a chemical name of O,O-dimethyl-S-(N-methyl carbamoyl methyl) dithiophosphate, a molecular formula of C5H 12 NO3PS2. The lead sulfide collector provided by the application realizes efficient recovery of lead sulfide ore, provides a new technology for separating complex polymetallic mixed minerals, and provides a brand-new design direction for use of a new collector.

The invention relates to the technical field of nutrition and health, in particular to a sleep-promoting composition containing oriental cherry polyphenol and a preparation method of the sleep-promoting composition. The oriental cherry polyphenol-containing sleep promoting composition is prepared from the following components in parts by mass: 5 to 8 parts of lemon myrtle leaf powder, 1 to 5 parts of oriental cherry polyphenol, 15 to 20 parts of casein hydrolyzed peptide, 15 to 25 parts of semen ziziphi spinosae powder, 5 to 8 parts of rhizoma gastrodiae powder, 8 to 12 parts of poria cocos powder, 2 to 10 parts of Borojo powder, 1 to 5 parts of N-acetylneuraminic acid, 10 to 15 parts of corn leaf extract and 0.5 to 5 parts of silicon dioxide. The lemon myrtle leaf powder, the sakura polyphenol, the casein hydrolyzed peptide and the N-acetylneuraminic acid are used as main effective components, and the obtained sakura polyphenol composition has the effects of improving sleep, resisting oxidation and improving the immunity of a human body and can be used as health-care food.

The present invention discloses a novel camphor-based fluorescent probe for detecting the organophosphorus pesticide dimethoate, as well as its preparation method and application. The present invention uses camphor as a raw material, condenses it with ethyl isonicotinate to obtain 3-(pyridine-4-formyl)-1,7,7-trimethylbicyclo[2.2.1]2-heptanone, and then cyclizes it with 4-bromophenylhydrazine to obtain 2-(4-bromophenyl)-7,8,8-trimethyl-3-(pyridine-4-yl)-4,5,6,7-tetrahydro-2H-4,7-bridged methylindazole, which is then coupled with 4-formylphenylboronic acid to obtain 4 ′ ‑(7,8,8-trimethyl-3-(pyridin-4-yl)-4,5,6,7-tetrahydro-2H-4,7-methyleneindazol-2-yl)-[1,1′-diphenyl]-4-yl)methylene)benzofuran-3(2H)-one, which was then esterified with acetyl chloride. 3-Oxo-2-((4′-(7,8,8-trimethyl-3-(pyridin-4-yl)-4,5,6,7-tetrahydro-2H-4,7-methyleneindazol-2-yl)-[1,1′-diphenyl]-4-yl)methenyl)-2,3-dihydrobenzofuran-6-yl acetate (abbreviated as CPA-OAc) was obtained. This compound can undergo enzymatic hydrolysis with carboxylesterase. Under ultraviolet irradiation, the fluorescent color of the solution changes from colorless to green. Since dimethoate can effectively inhibit the activity of carboxylesterase, when dimethoate is added to the solution, the fluorescence of the solution changes from green to colorless. Therefore, this compound can be used as a fluorescent probe for detecting dimethoate.

The application provides a preparation method of metal-doped carbon dots, comprising the following steps: drying an aqueous solution of reactants containing ethylenediaminetetraacetate, Cu 2+ and Fe 3+ , high-temperature pyrolysis, acid washing, water washing, methanol purification and filtering, and drying at 60 DEG C to obtain the metal-doped carbon dots. The phenol measurement steps provided by the application are as follows: mixing a sample solution with a buffer solution, a 4-aminoantipyrine solution and a carbon dot solution, incubating to obtain a solution A, and measuring the absorbance of the solution A at 509 nm for quantitative analysis. The measurement steps of dimethoate provided by the application are as follows: mixing a sample solution with a acetylcholinesterase solution, incubating for half an hour, adding a acetylthiocholine chloride solution and incubating for another half an hour, adding a solution A, and incubating for half an hour before fluorescence measurement. The synthesis method provided by the application is simple, the detection method has high sensitivity and small interference, and is suitable for simultaneous detection of phenol and dimethoate in actual samples.

The application discloses application of a molecular imprinting nanochannel membrane in selective identification of dimethoate molecules, and the molecular imprinting nanochannel membrane is obtained by first synthesizing a molecular imprinting polymer with a dimethoate molecular imprinting cavity, and then uniformly loading the molecular imprinting polymer on an AAO base by using a super assembly technology. The application constructs a nanofluid device including two half electroconductive cells by taking the molecular imprinting nanochannel membrane as an ion selective membrane, realizes identification and detection of dimethoate by testing I-V variation after adding a to-be-tested solution in an electrolyte solution, and has considerable application prospect in the field of intelligent ion transmission due to simple operation and high sensitivity.

The invention relates to an omethoate hapten and a preparation method and application thereof, and the structure of the omethoate hapten is shown as a formula I. The omethoate hapten and the omethoate antigen provided by the invention are simple in synthesis method, high in purity and high in yield, and have great value for preparation of an omethoate antibody and detection of omethoate drug residues. The detection limit of the omethoate enzyme linked immunosorbent assay kit developed by the invention in cowpeas, lettuces and eggplants is 0.5 mu g / kg, the recovery rate of each addition concentration is 87.73-113.34%, the intra-batch variation coefficient is less than 10%, and the inter-batch variation coefficient is less than 15%.

The present invention relates to the field of food detection technology, and in particular to a method for simultaneously detecting multiple organophosphorus pesticide residues in pre-prepared dishes. The method comprises the following steps: (1) crushing the pre-prepared dish sample to obtain the pre-prepared dish sample; (2) mixing the pre-prepared dish sample with water, acetonitrile, anhydrous magnesium sulfate, and sodium chloride, shaking for 10 to 20 minutes, centrifuging, taking the supernatant, purifying the supernatant, and filtering with a microporous filter membrane to obtain a sample to be tested; (3) detecting the peak area of ​​the organophosphorus in the sample to be tested by high performance liquid chromatography-mass spectrometry, substituting the obtained peak area into a standard curve to obtain the content of the organophosphorus; according to the method of the present invention, 10 organophosphorus pesticide residues can be simultaneously detected in pre-prepared dishes, namely, dimethoate, dichlorvos, phorate, isocarbophos, chlorpyrifos, fenthion, malathion, fenthion sulfone, malathion, and omethoate, with a recovery rate of more than 90%. The method provides a basis for the detection of pesticide residues in pre-prepared dishes.

The application discloses a test strip for detecting omethoate as well as a preparation method and application thereof. The test strip comprises a test paper and a microporous reagent. The test paper comprises a reaction membrane, a sample absorption pad, a water absorption pad and a bottom plate. The reaction membrane is provided with a detection line coated with an omethoate hapten-carrier protein conjugate and a quality control line coated with a sheep anti-mouse antibody. The microporous reagent is freeze-dried with an omethoate monoclonal antibody-colloidal gold marker. The application further provides a method for detecting omethoate residues in fruits and vegetables by using the test strip. The test strip and the detection method have the advantages of simple operation, high sensitivity, fast detection speed, low cost and no limitation on detection equipment, and can realize on-site rapid detection of a large number of samples.

The invention belongs to the technical field of pesticides, and particularly relates to the technical field of pesticide compounding, in particular to a synergistic acaricidal composition. The synergistic acaricidal composition comprises an active compound (A), a compound shown in a formula Ia (formula Ia) and at least one active compound (B), and the active compound (B) is selected from the group consisting of chlorfenapyr, phoxim, dimethoate, pyridazinofos, carbosulfan, amitraz, lambda-cyhalothrin, lime sulfur, sulfur, chlorpyrifos, profenofos, lambda-cyhalothrin, triflumizone, Sulfiflumin, Spirobudifen, Mivorisaner, Modoplaner, Tigolaner, Umifoxolaner and Flupentifenox. The weight ratio of the active compound (A) to the active compound (B) is (1: 100)-(100: 1). The synergistic acaricidal composition can effectively improve the prevention and control effect on pest mites, has a remarkable synergistic effect compared with a single agent, and can effectively reduce the use amount, reduce the use cost and reduce the influence on the environment.

The invention discloses a preparation method and application of an antigen for detecting impurities such as etoxazole in vegetables and fruits. The obtained antibody is prepared into an enzyme linked immunosorbent assay kit, and when the enzyme linked immunosorbent assay kit is used for detecting etoxazole contained in vegetables and fruits, the detection limit is 10 [mu] g / L. The detection result is high in accuracy, especially in an etoxazole antibody specificity experiment, obvious specificity to etoxazole is shown, and the detection result is not interfered by drugs such as carbendazim, triazophos, chlorpyrifos, cyfluthrin, metalaxyl, acetamiprid, difenoconazole, procymidone, chlorfenapyr, profenofos and omethoate.

The invention discloses an enzyme-free electrochemical sensor based on functionalized MOFs as well as preparation and application of the enzyme-free electrochemical sensor, and relates to the technical field of food safety detection. The sensor is constructed by compositely modifying the surface of a glassy carbon electrode with ferroferric oxide nanoparticles and an amino-functionalized metal organic framework material. By utilizing the porous structure and high specific surface area of MIL-101-NH2 and the specific coordination effect of amino groups on the surface of MIL-101-NH2 and dimethoate molecules and combining the high electron mobility of Fe3O4, the high-sensitivity and high-selectivity detection of the organophosphorus pesticide dimethoate in fruits and vegetables is realized. The sensor is enzyme-free, avoids instability of biological enzyme, has the advantages of simplicity and convenience in preparation, low cost, rapidness in detection, good stability, high reproducibility and the like, is wide in linear range and low in detection limit, is suitable for rapid and accurate detection of trace dimethoate residues in fruits and vegetables, and provides a reliable technical means for on-site screening of quality safety of agricultural products.

The invention discloses a nano-enzyme filtering membrane as well as a preparation method and application thereof. According to the preparation method disclosed by the invention, uniform dispersion on polyamide acid (PAA) is realized by utilizing the amphipathy of cobalt salicylic acid N-octyl imidazole ionic liquid, and the activity of the obtained polyamide acid cobalt (PAA-Co) composite membrane is endowed by reduction activation. The PAA-Co composite membrane has excellent catalytic performance and stability, so that the PAA-Co composite membrane becomes an ideal candidate for dimethoate colorimetric detection. In addition, the PAA-Co membrane is integrated into the filtering device, and catalytic oxidation occurs in the process of filtering the soil test solution. When the solution passes through the membrane, impurities are effectively filtered out, so that the detection precision is improved, and meanwhile, a catalytic oxidation reaction occurs. According to the method, continuous testing is achieved, the trouble of artificial enzyme recovery is eliminated, the detection efficiency is remarkably improved, and it is proved that the method has huge potential in actual pesticide residue detection application.

The invention belongs to the field of biological biology, and discloses an omethoate specific aptamer, omethoate is taken as a target, the specific aptamer APT-8 is obtained by screening through a GO-SELEX technology, a key recognition area of specific pi-pi stacking action can be defined by the aptamer and the target through molecular docking simulation, and the specific aptamer APT-8 can be used for identifying the specific pi-pi stacking action of omethoate. The aptamer APT-8-1 is obtained after truncation treatment is conducted on APT-8, the sequence of the aptamer APT-8-1 is CGCAGGCGTATCTAGACCGCAGGTCGACGCATGCG, the dissociation constant Kd value measured through a fluorescence method is 28.79 nM, experiments prove that the APT-8-1 has excellent selection specificity, the target does not need to be fixed, forward and reverse screening is combined, rational truncation is conducted through molecular dynamics simulation guidance, the screening efficiency of the aptamer is improved, and the screening efficiency of the aptamer is improved. The omethoate aptamer is obtained, and a nucleic acid recognition element with high affinity and specificity is provided for organophosphorus pesticide residue detection.

The invention provides a method and device for continuously producing dimethoate, and relates to the technical field of continuous and efficient pesticide and medicine production.The device comprises a dimethoate continuous reaction kettle, and a stirring frame is integrally composed of a vertical stirring column and a row of horizontal stirring rods welded to the horizontal stirring rods at equal intervals; the head end part of the horizontal stirring rod is inserted and matched with the peripheral wall of the hollow rotating shaft in a penetrating manner; a plurality of circles of rectangular positioning frames arranged in the axial direction are welded to the inner circle of the peripheral wall of the hollow rotating shaft. The head end part of the horizontal stirring rod is inserted between the two vertically adjacent rectangular positioning frames at the corresponding height, and the vertical insertion plate is in penetrating sliding fit with the two vertically adjacent rectangular positioning frames at the corresponding height and is in penetrating insertion fit with a rectangular positioning groove formed in the head end part of the horizontal stirring rod in a penetrating manner. According to the invention, the trouble of locking and unlocking the stirring frame before and after maintenance or replacement due to additional manual up-and-down sliding of the six-edge driving shaft can be avoided, and the maintenance and replacement efficiency of the stirring frame can be indirectly improved.

The present invention discloses a sanitary insecticide compound composition and its application. The compound insecticide comprises active ingredients A and B, wherein active ingredient A is a piperic acid derivative compound and active ingredient B is an organophosphorus insecticide, wherein the organophosphorus insecticide is any one of dimethoate, fenthion, fenitrothion, and pirimiphos-methyl. The combined weight of active ingredient A and the organophosphorus insecticide accounts for 2% to 50% of the insecticide composition, with a combined weight ratio of 20:1 to 1:10. This binary composition addresses the problem of organophosphorus resistance in sanitary pests, improving control efficacy, reducing application dosage, and reducing irritation, while also prolonging the duration of the effect. Active ingredient A, as a lethal agent, exhibits no cross-resistance with organophosphorus compounds, resulting in a good lethal effect and no repellency to sanitary pests. The compound is widely used in hotels, schools, factories, farms, and other places, and is particularly effective in controlling sanitary pests.

This invention discloses a nanocomposite material and its preparation method, a nanoenzyme-bioenzyme cascade sensor and its application, relating to the field of pesticide detection technology. The technical solution of this invention introduces flexible two-dimensional graphitic carbon nitride nanosheets as a soft template and spatial confinement agent for in-situ growth, effectively suppressing the excessive growth of PCN-222(Fe) crystals during the solvothermal process, successfully controlling its size from the micrometer scale to the submicrometer scale, resulting in higher catalytic activity. The nanoenzyme-bioenzyme cascade sensor constructed based on this composite material achieves broad-spectrum, ultrasensitive detection of pesticides such as glyphosate, dimethoate, and paraoxon. This sensor has a low detection limit in the pM-nM range, a wide linear range, and exhibits excellent recovery and precision in complex real-world samples, strong anti-interference ability, and high practicality.

The invention relates to an omethoate hapten and a preparation method and application thereof, and the structure of the omethoate hapten is shown as a formula I. The omethoate hapten and the omethoate antigen provided by the invention are simple in synthesis method, high in purity and high in yield, and have great value for preparation of an omethoate antibody and detection of omethoate drug residues. The detection limit of the omethoate detection test strip developed by the invention on omethoate in cowpea, leaf lettuce and eggplant is 0.5 mu g / kg, and the false positive rate and the false negative rate are both 0.

The present application belongs to the technical field of pesticide detection, and particularly relates to a multi-in-one pesticide residue quantitative detection test paper and a detection method. The test paper is provided with gold nanoparticle labeled antibodies of at least two kinds of pesticides on a colloidal gold combination pad; a chromatography membrane is provided with a quality control line and at least two detection lines, each detection line is coated with an antigen of one kind of pesticide; the pesticides are selected from chlorpyrifos, phorate, dimethoate, acetamiprid, carbendazim, procymidone, fenpropathrin, carbofuran, isoprocarb, chlorothalonil, chlorfenapyr, parathion, tetramethylenedisulfide, triadimefon, isocarbophos or parathion. Through optimization of the pesticide types and preparation methods of the antigens and antibodies, the present application overcomes the problem of mutual interference of detection targets when multiple pesticides are simultaneously detected, has good specificity, high sensitivity, can accurately quantify, can simultaneously detect multiple components, and has simple pretreatment, and thus has good application prospect.

The invention provides a method for detecting organophosphorus in soil, and relates to the technical field of environment monitoring and analysis detection. According to the method, through four core steps of sample pretreatment, targeted extraction, purification separation and accurate detection, a specific extractant-dispersant combination is adopted to reinforce organic phosphorus selective enrichment, ultrasonic assistance is combined to shorten the extraction time, and an HPLC-MS / MS multi-reaction monitoring mode is utilized to realize anti-interference quantification. The core innovation lies in extraction system optimization, accurate matching of pretreatment parameters and targeted design of a detection mode. Practice verification shows that the detection limit of the method on 15 common organophosphorus such as dimethoate and dichlorvos in soil is as low as 0.01-0.05 mu g / kg, the recovery rate reaches 90%-105%, the relative standard deviation RSD is smaller than or equal to 3.5%, the pretreatment time is shortened to be within 30 min, and the method is suitable for organophosphorus residue detection of various soil samples such as farmlands, industrial areas and polluted sites and has a wide application prospect. And scientific and accurate data support is provided for soil environment quality evaluation.

A mixture for killing pests, comprising, as the active compound, A) an ethyl sulfone compound having formula (I) and B) At least one additional compound B, selected from fipronil, λ-cyhalothrin, bifenthrin, heptafluthrin, α-cyhalothrin, thiamethoxam, thiamethoxam, acetamiprid, imidacloprid, dinotefuran, trifluralin, dithiamethoxam, spinosad, ethyl spinosad, abamectin, bispyribac-methyl, indoxacarb; cyfluthrin, methoxypiperazine ethyl ester, dispirenil, chlorantraniliprole, brofenoxuronamide, tetrazolium acetonitrile, cyclobromhizobium acetonitrile, brofenoxuron dimethoate; pyrimethanil, M.UN.1: 1-[6-(2,2-difluoro-7-methyl-[1,3]m-dioxacyclopenten[4,5-f]benzimidazol-6-yl)-5-ethylsulfonyl-3-pyridyl]cyclopropaneformonium, M.UN.2: 6-(5-cyclopropyl-3-ethylsulfonyl- 2-pyridyl)-2,2-difluoro-7-methyl-[1,3]m-dioxacyclopenten[4,5-f]benzimidazole; and difenoconazole, prothioconazole, fenbendazole, tebuconazole, chlorfluazuron, cymoxanil, fluopyram, tetrazoxystrobin, azoxystrobin, oxadiazon, azoxystrobin, fluopyram, fluopyram, fluopyram, fluopyram, fluopyram, isopropoxystrobin, trifluoropyridamole, fluthiazolinone, flusaprolin, metalaxyl, tetrazoxystrobin, fludioxonil, thiophanate-methyl; these mixtures are used to combat invertebrate pests such as insects, arachnoides or nematodes inside and on the surface of plants, and for the protection of such plants, especially for the protection of plant propagation material such as seeds from pest infestation.

The application discloses a dimethoate molecular imprinting photoelectrochemical sensor based on a multi-center affinity MOF, takes dimethoate (DIM) as a target analyte, and uses PCN-224 (Zn) as not only a photoelectric signal generation center of the sensor, but also a matching center of a molecular imprinting cavity, so that multiple recognitions are performed on the target, and the affinity effect of Lewis acid center sites (Zn (II), Zr (IV)) and the synergistic effect of spatial matching of the molecular imprinting ensure accurate capture of the DIM; through a competition strategy of taking dopamine as an electron donor and an interface probe, a high-selectivity PEC sensor for trace DIM is finally constructed, and the method can be popularized to other organophosphorus chemical structures, thereby providing a new direction for multifunctional application of photoactive MOFs.