725 results about "Planthopper" patented technology

The invention belongs to the field of pesticide, which mainly relates to an ultralow-volume solvent containing pleocidin or spinetoram. The ultralow-volume solvent is an active component I or an active ingredient compounded by the active component I or an active component II, and the balance is solvent and accessory ingredient, wherein the active component I is pleocidin or spinetoram; and the active component II is insecticide of the other type of action mechanism. The ultralow volume solvent is simple to process and has the advantages of water conservation, high work efficiency, long efficacy continuing period, small possibility of generating resistance to drug for a target, small environment pollution, synergy and the like. Ultralow volume spraying, low-volume spraying or low-volume electrostatic spraying is applied to effectively prevent and control various pests, such as Cnaphalocrocis medinalis, Chilo suppressalis, rice planthopper, Ostrinia nubilalis, plutella xylostella, cabbage caterpillar, Spodoptera litura, Spodoptera exigua, aphids, Lesser green leaf hopper, Icerya purchase, aleyrodid, Thrip, stinkbug, acridid, flea beetle, leafminer, looper and the like.

The invention provides a brown planthopper resistant rice gene Bph9 as well as a molecular marker and application thereof. The brown planthopper resistant rice gene Bph9 has a nucleotide sequence as shown in SEQ ID No.1 and a cDNA (complementary Desoxvribose Nucleic Acid) sequence as shown in SEQ ID No.2. The Bph9 gene is located between molecular markers InD2 and RM28466. The molecular markers closely linked with the gene also includes one of RM28438, InD28450, InD28453, InD14, InD28432, RM28481 and RM28486 which can be used for sieving the rice containing the brown planthopper resistant gene Bph9. The Bph9 gene belongs to the NBS-LRR (Nucleotide Binding Site-Leucine Rich Repeat) gene family; the encoded protein is related to the plant disease resistance; the Bph9 gene is transferred into common rice by virtue of genetic transformation and hybridization, and thus the resistance of rice to brown planthopper can be improved, so that the damage of brown planthopper is decreased, and the purposes of yield increase and yield stabilization are realized.

The invention discloses a fluoro methoxylpyrazole-containing o-formylaminobenzamide compound shown as a structural formula (I) or agriculturally suitable salts thereof, a synthesis method and application thereof. The fluoro methoxylpyrazole-containing o-formylaminobenzamide compound has the advantages of effectiveness, low toxicity, low cost and environmental safety and can be used for preventingand removing various pests in the fields of agriculture and horticulture or pests parasitized on animals. The fluoro methoxylpyrazole-containing o-formylaminobenzamide compound has very high activityon lepidopteran pests (plutella xylostella, spodoptera exigua and cotton bollworm), hemipteran pests (black peach aphid and aphis craccivora koch), homopteran pests (nilaparvata lugens), dipteran pests (liriomyza trifolii) and leaf beetle pests (phaedon conchleariae). Particularly, good effect on the lepidopteran pests, the hemipteran pests and the dipteran pests can be achieved under the condition of low dosage of the compound.

The invention discloses a pesticide composition and application thereof in agriculture. The effective component of the composition comprises flonicamid and neonicotinoid insecticides with a mass ratioof 80:1-1:80. The composition has the advantage of synergetic effect, obviously for resistant pests, reduces the dosage and delays resistance development, and is used for preventing and treating pests with obvious resistance, and is especially suitable for preventing and treating rice planthopper, thrips and aphid with resistance.

The invention relates to a disinsection composition containing a matrine and a neonicotinoid insecticide, and application thereof. The composition mainly uses the matrine and the neonicotinoid insecticide and is prepared by an auxiliary agent and an excipient to form microemulsion, emulsion in water, suspending agent, water dispersible granule, wetting powder and missible oil, wherein the mass percentage of the matrine and the neonicotinoid insecticide is 30:1-1:100. The disinsection composition has higher synergy effect, prevents pests from becoming resistant to drugs, prolongs the service life of pesticides and reduces pesticide residue. The composition can be used for preventing and treating homoptera, lepidoptera, thysanoptera, coleopteran and diptera on crops, particular for rice planthopper, trialeurodes vaporariorum, aphid, tryporyza incertulas, chilo suppressalis, thrips, paddy weevil and gall midge.

The invention provides a pesticide preparation for controlling rice pests of planthoppers and the like, which relates to the technical field of pesticides. The main agent of the pesticide preparation is a mixture containing the following active ingredients in percentage by weight: 0.1-2.0% of nimbin and 0.1-50.0% of chlorantraniliprole. The main agent and auxiliary agents are prepared into creams, microemulsions, aqueous emulsion and suspending agents. The pesticide preparation has high efficiency on the rice pests of planthoppers and the like, can control the rice pests of planthoppers and the like in different instars and thoroughly kill the pests, has the advantages of less pollution on the environment and low production cost, and is suitable for chemically controlling the rice pests of planthoppers and the like.

The invention provides a brown planthopper resistance gene Bph14 in rice. The gene has a nucleotide sequence shown in SEQ ID No. 1 and a cDNA sequence thereof is shown in SEQ ID No.2. The gene Bph14 of the invention belongs to CC-NBS-LRR gene family, and coded protein is related to plant disease resistance. The gene Bph14 has function of resisting the brown planthopper. Through genetic transformation and hybridization, the gene Bph14 is transferred into normal rice varieties, which can improve the resistance of the rice to the brown planthopper, thus reducing the damage caused by the brown planthopper and achieving the purposes of increasing and stabilizing the production of rice.

The invention discloses a cyantraniliprole containing insecticidal composition, which is an insecticidal composition containing active ingredients A and B, wherein the active ingredient A is cyantraniliprole, the active ingredient B is any one of the following pesticides: imidacloprid, acetamiprid, nitenpyram, thiamethoxam, thiacloprid, clothianidin and dinotefuran, and the weight ratio of the active ingredients A and B is 1:60-60:1. The composition disclosed by the invention can control various insects, has an obvious synergistic effect, expands the insecticidal spectrum, and has high activities to piercing-sucking pests such as plant hoppers, aphid, tea lesser leafhopper and aleyrodid, and lepidoptera pests such as plutella xylostella and asparagus caterpillar; the application amount of pesticides is reduced, the residues of pesticides on crops are reduced, and the environment pollution is reduced; and the composition is safe to people and livestock and good in environmental compatibility, and pests are unlikely to produce pesticide resistance.

The invention relates to a planting method for organic rice. The method mainly comprises: soaking seeds, accelerating germination, raising rice seedlings, and transplanting rice seedlings 20-30 days before local rice planting time; in field preparation, turning under green manure, base fertilizer including biogas manure, fully decomposed yard manure and/or fully decomposed cake fertilizer; 10-20 days after rice transplanting, after seedlings stand, stocking ducklings, in peak of outbreak of rice planthoppers, adding a second batch of ducklings, in a rice heading flowering period, taking back the ducklings; in fertilization aspect, in addition to using green manure cooperating with farmyard manure base fertilizer, and dressing farmyard manure, the rest using wood vinegar; in pest control aspect, using field light traps and artificially propagating parasitic wasps, alternatively spraying the wood vinegar and garlic pepper solution. The method solves problems that yield of organic rice planting is not high, rice quality is not good, and plant diseases and insect pests are severe. The method is successful in plantation of ''sticky fragrance'', ''rice fragrance'', ''beautiful fragrant sticky'', and a Japan introduced variety ''Koshihikari''.

The invention discloses a phyto-pesticide and a use method thereof. The pesticide is used for controlling aphids, rice planthoppers and cabbage worms. A principle of 'monarch, minister, adjuvant and messenger' for drug formula in philosophy of the traditional Chinese medicament is used in the development of a product of the phyto-pesticide formula. The phyto-pesticide comprises four plant extracts including 0.5 to 10 percent by sanguinarine of macleaya cordata, which plays a main insect killing role and serves as a monarch drug; 2 to 20 percent by nicotinamide of tobacco extract, which is used for improving the insect killing effect of the 'monarch drug' and serves as a 'minister drug'; 5 to 10 percent by teasaponin of tea oil cake, which is used for making a target insect refuse to have food, generates certain gastrointestinal toxicity to reduce the viability of the insect and serves as an 'adjuvant drug'; 0.1 to 0.5 percent by natural borneol(L(-)-Borneol ) of borneol camphor, which can expel the insect and serves as a 'messenger drug'. The formula combines the 'monarch, minister, adjuvant and messenger' composite formula and an additive and a carrier to prepare the pesticide with insect expelling effect. The phyto-pesticide is effective, free from residue and environmentally-friendly.

The invention provides an anti-rice black-streaked dwarf virus field inoculation identification method for rice varieties, and belongs to the technical field of agricultural science. A piece of rice field with certain conditions is selected as an identification nursery, different rice varieties are sown in special stages, it is identified that virus transmission interbody small brown rice planthoppers in the nursery have certain virus carried rate and population density after wheat harvest, and after rice grows to a specific growth period, the anti-rice black-streaked dwarf virus level of the rice varieties is evaluated according to the severity degree of disease. With the method, anti-rice black-streaked dwarf virus identification can be performed on a large number of rice varieties at a time, and the defects that the manual identification scale in a laboratory and the identification variety number are small are overcome. The identification method can be applied to the multiple fields of screening of anti-rice black-streaked dwarf virus rice varieties, variety resistance evaluation, resistant variety breeding, researching on the law of genetics of resistance and the like.

The invention discloses a molecular mark linked with rice gene resistant to Whitebacked Planthopper. Rice is selected, and a molecular mark primer is selected from following primer pairs, wherein the nucleotide sequence is 5' arrow 3'; RM6917 forward: CTGGTTGTTTTCTGAACTCCGT, reverse: GCATTAACCATAGCTGTCCACTC; and AP4741 forward: AATCATGCTAGGTTATTACTCG, reverse: GTGCAGAGATCATGCTTTTG. The invention also provides the development method of the molecular mark. The molecular mark is tightly linked with the gene resistant to Whitebacked Planthopper, and can be used for auxiliary selection and breeding of rice resistant to Whitebacked Planthopper.

The invention relates to an application of a Metarhizium anisopliae CQMa421 strain in preparation of insecticide for preventing and controlling Striped flea beetle or plutella xylostella. The strain is capable of infecting Striped flea beetles and plutella xylostella with fatality rates being 60.9% and 70.8% respectively. The Metarhizium anisopliae CQMa421 strain with enhanced toxicity, which is prepared according to a method disclosed by the invention, has a fatality rate reaching 100% and achieves an outstanding prevention and control effect. The insecticide for preventing and controlling Striped flea beetles or plutella xylostella comprises dry conidial powder of Metarhizium anisopliae CQMA421 (44-60%), kieselguhr (30-40%), nano-aluminum trihydrate (0.5-1%), sodium carboxymethylcellulose (3-5%), tween-80 (3-5%) and OP-10 (3-5%). All the components in the Metarhizium anisopliae insecticide are matched effectively to take a synergistic effect. After being mixed with water, the Metarhizium anisopliae insecticide is applied in a spraying way to achieve a field prevention effect of 80% or above for rice planthopper. The Metarhizium anisopliae insecticide has excellent wetting dispersion characteristic, wherein the wetting time is less than 60s; and in addition, the bioactivity during long-term storage can be retained and the storage time is as long as 12 months.

The invention relates to a method for raising small brown rice planthopper by utilizing soil-less cultured barley seedlings, belonging to the technical field of insect raising. The method comprises the steps of: culturing barley seedlings, raising small brown rice planthopper nymphae, taking care of the eggs delivered by small brown rice planthopper imagoes and carrying out subculture. In the invention, soil-less cultured barley seedlings are adopted, the culture is not limited by field, temperature and other natural conditions, and the seeds of barley seedlings are sterilized to prevent the barley seedlings from rotting. During the raising period, the whole operation is convenient, and the environment is clean and neat without the limitation of time, space and temperature, especially a method of inversely covering a wild-mouth bottle is used for transferring nymphae to reduce the natural death of nymphae during transferring; reasonable culture density is used for nymphae culture and imagoes culture, which ensures the fully utilization of barley seedlings, reduces the frequency for replacing barley seedling, facilitates the operation and saves time. The invention has the advantages of subculture, uniform worm age, large multiplication quantity and the like, and ensures the large quantities of standard worm source required by test.

The invention discloses application of a NlInR gene of brown planthopper as a target point in preparation of a pesticide for preventing and treating the brown planthopper, and provides dsRNA used forinhibiting expression of the NlInR gene, wherein the NlInR gene is composed of a NlInR1 gene and a NlInR2 gene; the nucleotide sequence of the NlInR1 gene is shown as SEQ ID NO.1; the nucleotide sequence of the NlInR2 gene is shown as SEQ ID NO.2. The effect of the NlInR gene in preventing and treating the brown planthopper is discovered for the first time, the dsRNA of the NlInR gene is obtainedthrough an RNAi technology, and after the NlInR gene is silenced through a micro-injection mode, the individual development and the ovarian development of the brown planthopper can be effectively inhibited, and the spawning amount is reduced, so that the propagation of the brown planthopper is inhibited, and the prevention and treatment of the brown planthopper are realized.

The invention discloses an insecticidal composition containing sulfoxaflor, comprising A and B components, wherein the active component A is selected from sulfoxaflor and the active component B is selected from any one of the following insecticides: pymetrozine, imidacloprid, acetamiprid, nitenpyram, thiamethoxam, buprofezin, thiacloprid, clothianidin and dinotefuran; and the weight percentage of the active components A to B is: (1-50%): (1-50%). The composition can be used for preventing and treating many insects, has obvious synergy, expands the insecticidal range and has relatively high activity on sucking insects such as plant hopper, aphid, Empoasca pirisuga Matsumura and aleyrodid, and Lepidoptera pests such as plutella xylostella and spodoptera exigua. Furthermore, the composition reduces the usage of the farm chemical and residue of the farm chemical on the crops, alleviates the environment pollution, and has safety on both human and poultry, good environment compatibility; and the insects are difficult to generate drug resistance.

The invention discloses a carrier plant system for protecting and increasing the number of rice field rice planthopper parasitic wasps. The carrier plant system comprises three parts, namely, carrier plants, substitute hosts and the parasitic wasps, wherein the carrier plants are grassy weed blighted grain grass and clubhead cutgrass herbs, the substitute hosts are main phytophagous insect false brown planthopper on the grassy weed blighted grain grass and the clubhead cutgrass herbs, and the parasitic wasps are mainly anagrus nilapartvatae pang et wang. The system servers as a species pool of natural enemies of the rice planthopper and used for unceasingly breeding the parasitic wasps, the biological control efficiency of the rice planthopper can be effectively improved, and the number of the times of using pesticides can be lowered by 2 to 3 in one season. The system has the advantages of being long in action time, easy to operate and high in practicability.

The invention discloses an immunodetection kit specially used for rice black-streaked dwarf virus in single planthopper and a using method thereof. Specific polyclonal antibodies of the rice black-streaked dwarf virus (RBSDV) are utilized to build a dot immuno-binding assay (DIBA) detecting method which is used for building the detection kit for rice black-streaked dwarf virus, main reagents of the kit are working solution or concentrated solution, and the kit has the characteristics of convenient use, simple operation, and the like. And simultaneously, the use of the rice black-streaked dwarf virus detection kit can be a standard program or a reduced program, which can greatly broaden the using ranges and applicable persons of the kit and facilitate the population and application of the technique to establishment units, and further, the kit is applied in the fields of plant disease prognosis and prediction and the formulation of prevention and curing strategies, and the like. In addition, the kit can be used for measuring the inoculation strength in varietal resistance seed selection of rice black-streaked dwarf virus, and the like.

A composite insecticide in the form of microemulsion for rice borer, leaf roller, plutella xylostella, leafhopper, etc is prepared from triazophos, fipronil, emulsifier, stabilizer, cosolvent, antifreezing agent and water through proportional mixing, stirring, and emulsifying. Its advantages are high effect and less environmental pollution.

The invention relates to a rynacypyr and dursban insecticidal composition, belonging to an insecticidal composition with enhancement effect. The rynacypyr and dursban insecticidal composition is a mixture of a compound (A) and a compound (B), and can effectively prevent and treat rice stem borers, tryporyza incertulas, cnaphalocrocis medinalis guenees, rice planthopper and injurious insects on various plants, such as wheat, cotton, soybeans, fruit trees, tea trees, vegetables and the like. The invention has higher prevention effect than singly using the compound (A) or the compound (B).

The invention discloses a method for cultivating paddy rice in a lodging resistance way, comprising the following steps of (1) selecting a lodging resistance variety; (2) implementing row-expanding transplant and rational sparse planting; (3) rationally irrigating to keep the alternate dry or wet status of a paddy field; (4) rationally applying fertilizer to optimize nitrogen fertilizer management; (5) enhancing control on plant diseases and insect pests, i.e. enhancing control on rice planthopper, banded sclerotial blight, rice joint blast and chilo suppressalis; (6) after the occurrence of lodging, timely adopting remedial measures, i.e. timely ditching for water discharge, implementing the foliage top dressing of foliar fertilizer, and bunching and strengthening after lodging. By the adoption of the method for cultivating the paddy rice in the lodging resistance way, as the resistance against external environmental conditions is enhanced, the lodging resistance capability of the paddy rice can be improved; after suffering natural hazards such as typhoon and rainstorm, the paddy rice grows well; therefore, available spikes are increased by 10.2%, total grains are increased by 10.2%, and filled grains are increased by 10.5%; the maturing rate is increased by 10.3%, the thousand grain weight is increased by 10.1%, the theoretical yield is increased by 10.9% and the actual yield is increased by 10.9%; in addition, the rice grains are excellent in quality, the cooked rice is tasted good, and the economic benefits are obvious.

The invention discloses an insecticidal composition. The active ingredients of the composition comprise spirotetramat and bifenthrin in a mass ratio of 40:1 to 1:80. The compounding of spirotetramat and the bifenthrin produces an obvious synergistic effect and can reduce the dosage of the active ingredients and medicament application times and delay the generation of pesticide resistance of pests. The insecticidal composition can be used for preventing and controlling various pests on agricultural crops and garden crops, particularly plant hoppers, leafhopper and whitefly.