Patents
Literature
PatSnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

737 results about "Planthopper" patented technology

A planthopper is any insect in the infraorder Fulgoromorpha: in the suborder Auchenorrhyncha and exceeding 12,500 described species worldwide. The name comes from their remarkable resemblance to leaves and other plants of their environment and from the fact that they often "hop" for quick transportation in a similar way to that of grasshoppers. However, planthoppers generally walk very slowly so as not to attract attention. Distributed worldwide, all members of this group are plant-feeders, though surprisingly few are considered pests. The infraorder contains only a single superfamily, Fulgoroidea. Fulgoroids are most reliably distinguished from the other Auchenorrhyncha by two features; the bifurcate ("Y"-shaped) anal vein in the forewing, and the thickened, three-segmented antennae, with a generally round or egg-shaped second segment (pedicel) that bears a fine filamentous arista.

Insecticide composition

The invention discloses a pesticide composition. The composition comprises an active ingredient A and an active ingredient B, wherein the active ingredient A adopts afidopyropen; the active ingredient B is selected from one of paichongding, cycloxaprid and cycolxylidin; the weight ratio of the active ingredient A to the active ingredient B is (1:80) to (80:1). The pesticide composition is used for controlling and preventing various injurious insects, such as plant hoppers and thrips, has an excellent synergistic interaction effect, and can improve the controlling and preventing effect, and reduce the usage amount of pesticide and the use cost of farmers.
Owner:SHENZHEN NOPOSION AGROCHEM

Ultralow-volume solvent containing pleocidin or spinetoram

The invention belongs to the field of pesticide, which mainly relates to an ultralow-volume solvent containing pleocidin or spinetoram. The ultralow-volume solvent is an active component I or an active ingredient compounded by the active component I or an active component II, and the balance is solvent and accessory ingredient, wherein the active component I is pleocidin or spinetoram; and the active component II is insecticide of the other type of action mechanism. The ultralow volume solvent is simple to process and has the advantages of water conservation, high work efficiency, long efficacy continuing period, small possibility of generating resistance to drug for a target, small environment pollution, synergy and the like. Ultralow volume spraying, low-volume spraying or low-volume electrostatic spraying is applied to effectively prevent and control various pests, such as Cnaphalocrocis medinalis, Chilo suppressalis, rice planthopper, Ostrinia nubilalis, plutella xylostella, cabbage caterpillar, Spodoptera litura, Spodoptera exigua, aphids, Lesser green leaf hopper, Icerya purchase, aleyrodid, Thrip, stinkbug, acridid, flea beetle, leafminer, looper and the like.
Owner:GAUNGXI TIANYUAN BIOCHEM

Brown planthopper resistant rice gene Bph9 as well as molecular marker and application thereof

The invention provides a brown planthopper resistant rice gene Bph9 as well as a molecular marker and application thereof. The brown planthopper resistant rice gene Bph9 has a nucleotide sequence as shown in SEQ ID No.1 and a cDNA (complementary Desoxvribose Nucleic Acid) sequence as shown in SEQ ID No.2. The Bph9 gene is located between molecular markers InD2 and RM28466. The molecular markers closely linked with the gene also includes one of RM28438, InD28450, InD28453, InD14, InD28432, RM28481 and RM28486 which can be used for sieving the rice containing the brown planthopper resistant gene Bph9. The Bph9 gene belongs to the NBS-LRR (Nucleotide Binding Site-Leucine Rich Repeat) gene family; the encoded protein is related to the plant disease resistance; the Bph9 gene is transferred into common rice by virtue of genetic transformation and hybridization, and thus the resistance of rice to brown planthopper can be improved, so that the damage of brown planthopper is decreased, and the purposes of yield increase and yield stabilization are realized.
Owner:WUHAN UNIV

Preparation method and use of compound with high insecticidal activity

This invention relates to a kind of nitryl methylene ramification, and its preparation method and application. Anthelminthic activity test indicate: this ramification has very high insecticidal activity to thorn-suck type, scrape-suck type gnathite pest, such as aphid, leafhopper, planthoppers, thrips, aleyrodids and resistant strain, also possess prevention and cure action to rice water weevil, acarid cochineal spider, hygiene pest and termite.
Owner:EAST CHINA UNIV OF SCI & TECH +1

Fluoro methoxylpyrazole-containing o-formylaminobenzamide compound, synthesis method and application thereof

ActiveCN101967139AStrong noveltyBroad-spectrum insecticidal activityBiocideOrganic chemistrySynthesis methodsCotton bollworm
The invention discloses a fluoro methoxylpyrazole-containing o-formylaminobenzamide compound shown as a structural formula (I) or agriculturally suitable salts thereof, a synthesis method and application thereof. The fluoro methoxylpyrazole-containing o-formylaminobenzamide compound has the advantages of effectiveness, low toxicity, low cost and environmental safety and can be used for preventingand removing various pests in the fields of agriculture and horticulture or pests parasitized on animals. The fluoro methoxylpyrazole-containing o-formylaminobenzamide compound has very high activityon lepidopteran pests (plutella xylostella, spodoptera exigua and cotton bollworm), hemipteran pests (black peach aphid and aphis craccivora koch), homopteran pests (nilaparvata lugens), dipteran pests (liriomyza trifolii) and leaf beetle pests (phaedon conchleariae). Particularly, good effect on the lepidopteran pests, the hemipteran pests and the dipteran pests can be achieved under the condition of low dosage of the compound.
Owner:SINOCHEM LANTIAN +2

Pesticide composition with synergetic effect

The invention discloses a pesticide composition and application thereof in agriculture. The effective component of the composition comprises flonicamid and neonicotinoid insecticides with a mass ratioof 80:1-1:80. The composition has the advantage of synergetic effect, obviously for resistant pests, reduces the dosage and delays resistance development, and is used for preventing and treating pests with obvious resistance, and is especially suitable for preventing and treating rice planthopper, thrips and aphid with resistance.
Owner:SHENZHEN NOPOSION AGROCHEM

A kind of ultra-low volume liquid preparation containing thiamethoxam

The invention discloses an ultra-low-capacity liquid preparation containing thiamethoxam, which uses thiamethoxam, or the compound of thiamethoxam and active component II as the active ingredient, and supplements the rest to 100% with auxiliary agents and solvents. Low-volume liquid preparation; active component II is beta-cypermethrin, pymetrozine, chlorantraniliprole, flubendiamide, tofenpyrad, azadirachtin, buprofezin, abamectin, and emamectin Any one of plain benzoate and diazinon. The invention can be used to control crop pests such as rice planthopper, rice leaf roller, brown planthopper, white-backed planthopper, striatellus striatellus, stem borer and rice thrips, and has the advantages of convenient processing, water saving, high work efficiency and good drug effect , long-lasting, synergistic and other advantages.
Owner:GAUNGXI TIANYUAN BIOCHEM

Matrine composition

The invention relates to a disinsection composition containing a matrine and a neonicotinoid insecticide, and application thereof. The composition mainly uses the matrine and the neonicotinoid insecticide and is prepared by an auxiliary agent and an excipient to form microemulsion, emulsion in water, suspending agent, water dispersible granule, wetting powder and missible oil, wherein the mass percentage of the matrine and the neonicotinoid insecticide is 30:1-1:100. The disinsection composition has higher synergy effect, prevents pests from becoming resistant to drugs, prolongs the service life of pesticides and reduces pesticide residue. The composition can be used for preventing and treating homoptera, lepidoptera, thysanoptera, coleopteran and diptera on crops, particular for rice planthopper, trialeurodes vaporariorum, aphid, tryporyza incertulas, chilo suppressalis, thrips, paddy weevil and gall midge.
Owner:SHENZHEN NOPOSION AGROCHEM

Pesticide preparation for controlling rice pests of planthoppers and the like

The invention provides a pesticide preparation for controlling rice pests of planthoppers and the like, which relates to the technical field of pesticides. The main agent of the pesticide preparation is a mixture containing the following active ingredients in percentage by weight: 0.1-2.0% of nimbin and 0.1-50.0% of chlorantraniliprole. The main agent and auxiliary agents are prepared into creams, microemulsions, aqueous emulsion and suspending agents. The pesticide preparation has high efficiency on the rice pests of planthoppers and the like, can control the rice pests of planthoppers and the like in different instars and thoroughly kill the pests, has the advantages of less pollution on the environment and low production cost, and is suitable for chemically controlling the rice pests of planthoppers and the like.
Owner:YANGZHOU UNIV

Brown planthopper resistant gene in rice and use thereof

The invention provides a brown planthopper resistance gene Bph14 in rice. The gene has a nucleotide sequence shown in SEQ ID No. 1 and a cDNA sequence thereof is shown in SEQ ID No.2. The gene Bph14 of the invention belongs to CC-NBS-LRR gene family, and coded protein is related to plant disease resistance. The gene Bph14 has function of resisting the brown planthopper. Through genetic transformation and hybridization, the gene Bph14 is transferred into normal rice varieties, which can improve the resistance of the rice to the brown planthopper, thus reducing the damage caused by the brown planthopper and achieving the purposes of increasing and stabilizing the production of rice.
Owner:WUHAN UNIV

Cyantraniliprole containing insecticidal composition

The invention discloses a cyantraniliprole containing insecticidal composition, which is an insecticidal composition containing active ingredients A and B, wherein the active ingredient A is cyantraniliprole, the active ingredient B is any one of the following pesticides: imidacloprid, acetamiprid, nitenpyram, thiamethoxam, thiacloprid, clothianidin and dinotefuran, and the weight ratio of the active ingredients A and B is 1:60-60:1. The composition disclosed by the invention can control various insects, has an obvious synergistic effect, expands the insecticidal spectrum, and has high activities to piercing-sucking pests such as plant hoppers, aphid, tea lesser leafhopper and aleyrodid, and lepidoptera pests such as plutella xylostella and asparagus caterpillar; the application amount of pesticides is reduced, the residues of pesticides on crops are reduced, and the environment pollution is reduced; and the composition is safe to people and livestock and good in environmental compatibility, and pests are unlikely to produce pesticide resistance.
Owner:陕西亿田丰作物科技有限公司

Planting method for organic rice

The invention relates to a planting method for organic rice. The method mainly comprises: soaking seeds, accelerating germination, raising rice seedlings, and transplanting rice seedlings 20-30 days before local rice planting time; in field preparation, turning under green manure, base fertilizer including biogas manure, fully decomposed yard manure and / or fully decomposed cake fertilizer; 10-20 days after rice transplanting, after seedlings stand, stocking ducklings, in peak of outbreak of rice planthoppers, adding a second batch of ducklings, in a rice heading flowering period, taking back the ducklings; in fertilization aspect, in addition to using green manure cooperating with farmyard manure base fertilizer, and dressing farmyard manure, the rest using wood vinegar; in pest control aspect, using field light traps and artificially propagating parasitic wasps, alternatively spraying the wood vinegar and garlic pepper solution. The method solves problems that yield of organic rice planting is not high, rice quality is not good, and plant diseases and insect pests are severe. The method is successful in plantation of ''sticky fragrance'', ''rice fragrance'', ''beautiful fragrant sticky'', and a Japan introduced variety ''Koshihikari''.
Owner:GUILIN ZHAOFENG AGRI INVESTMENT DEV CO LTD

Phyto-pesticide and use method thereof

The invention discloses a phyto-pesticide and a use method thereof. The pesticide is used for controlling aphids, rice planthoppers and cabbage worms. A principle of 'monarch, minister, adjuvant and messenger' for drug formula in philosophy of the traditional Chinese medicament is used in the development of a product of the phyto-pesticide formula. The phyto-pesticide comprises four plant extracts including 0.5 to 10 percent by sanguinarine of macleaya cordata, which plays a main insect killing role and serves as a monarch drug; 2 to 20 percent by nicotinamide of tobacco extract, which is used for improving the insect killing effect of the 'monarch drug' and serves as a 'minister drug'; 5 to 10 percent by teasaponin of tea oil cake, which is used for making a target insect refuse to have food, generates certain gastrointestinal toxicity to reduce the viability of the insect and serves as an 'adjuvant drug'; 0.1 to 0.5 percent by natural borneol(L(-)-Borneol ) of borneol camphor, which can expel the insect and serves as a 'messenger drug'. The formula combines the 'monarch, minister, adjuvant and messenger' composite formula and an additive and a carrier to prepare the pesticide with insect expelling effect. The phyto-pesticide is effective, free from residue and environmentally-friendly.
Owner:MICOLTA BIORESOURCE INC LTD

Acquiring method for special small brown rice planthopper for inoculating rice black-streaked dwarf virus

The invention discloses a method for obtaining Laodelphax striatellus specially for inoculating black streaked dwarf virus of rice and application thereof in agriculture. The principle of the invention is to obtain Laodelphax striatellus without carrying stripe virus of rice by manual screening, feed the Laodelphax striatellus on rice carrying the black streaked dwarf virus without the stripe virus to obtain virus, transfer the Laodelphax striatellus to healthy rice sprouts without carrying viruses to feed for living through cycle period of the viruses, and further obtain the Laodelphax striatellus carrying the black streaked dwarf virus of the rice without the stripe virus of the rice. The established method for identifying the resistance of a rice variety with the black streaked dwarf virus can suppress interference due to that the Laodelphax striatellus simultaneously transmits the stripe virus of the rice, so that the identifying result is more objective and accurate, and the evaluation of resistance is more scientific and reasonable. The identifying method can be applied in discovery, identification, the evaluation of variety resistance, the breeding of disease-resistant variety, the research on resistance genetic development for rice variety resources and other fields.
Owner:JIANGSU ACAD OF AGRI SCI

Method for evaluating rice planthopper-resistant property of rice

InactiveCN101822187AClarify the actual resistance performanceSimple methodRice cultivationHigh resistanceAgricultural science
The invention provides a method for evaluating the rice planthopper-resistant property of rice. The method includes the steps that: (1) a nylon net greenhouse is constructed; (2) rice varieties, which include a rice variety to be tested, a pest-resistant check variety and a pest-susceptible variety, are planted in the greenhouse; and the pest-susceptible variety is planted around each variety to serve as rice planthopper-inducing rows; (3) the dosage of nitrogenous fertilizer is 200kg / ha to 250kg / ha; (4) at the early tillering stage of all the varieties, 2.5 percent of deltamethrin emulsifiable concentrate or 20 percent of triazophos emulsifiable concentrate is used for killing all pests and natural enemies in the net; (5) 10 days after the step 4, adult rice planthoppers are put on the pest-susceptible check variety (TN1) planted around the rice variety to be tested, 5 to 10 pairs per clump, and are freely and naturally propagated and randomly transferred to the variety to be tested; (6) after the step 5, when all of the pest-susceptible check variety in the test field dies, the resistance of each variety is evaluated, wherein the rice variety to be tested has high resistance when the death rate of the rice variety to be tested is less than 10 percent, pest resistance when the death rate is 11 percent to 30 percent, medium resistance when the death rate is 31 percent to 50 percent, medium susceptibility when the death rate is 51 percent to 70 percent, and pest susceptibility when the death rate is higher than 70 percent. The method has the advantages of simplicity and high operability, and accords with production reality.
Owner:ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES

Anti-rice black-streaked dwarf virus field inoculation identification method for rice varieties

InactiveCN103749230AOvercoming the small scale of manual identificationOvercome the disadvantage of fewer identified varietiesHorticulture methodsRice cultivationDiseasePlanthopper
The invention provides an anti-rice black-streaked dwarf virus field inoculation identification method for rice varieties, and belongs to the technical field of agricultural science. A piece of rice field with certain conditions is selected as an identification nursery, different rice varieties are sown in special stages, it is identified that virus transmission interbody small brown rice planthoppers in the nursery have certain virus carried rate and population density after wheat harvest, and after rice grows to a specific growth period, the anti-rice black-streaked dwarf virus level of the rice varieties is evaluated according to the severity degree of disease. With the method, anti-rice black-streaked dwarf virus identification can be performed on a large number of rice varieties at a time, and the defects that the manual identification scale in a laboratory and the identification variety number are small are overcome. The identification method can be applied to the multiple fields of screening of anti-rice black-streaked dwarf virus rice varieties, variety resistance evaluation, resistant variety breeding, researching on the law of genetics of resistance and the like.
Owner:江苏徐淮地区连云港农业科学研究所

Method for preserving rice black-streaked dwarf virus indoor living bodies

ActiveCN102870743ASolve the technical problems that are difficult to maintain in vivo preservationOvercome technical bottlenecks that are difficult to preserve for a long timeHorticulture methodsAnimal husbandryRice black-streaked dwarf virusTriticeae
The invention provides a method for preserving rice black-streaked dwarf virus (RBSDV) indoor living bodies. According to the principle of the method, wheat serves as a virus source host, small brown planthopper imagoes carrying the RBSDV spread the virus on wheat seedlings, a descendant small brown planthopper nymphs obtain the virus from the wheat, and accordingly a large of small brown planthoppers with the virus are obtained at a short period under indoor feeding conditions. The method effectively overcomes the technical bottleneck in preserving a large number of RBSDV indoor living bodies in a long term, and a series of technical problems that an RBSDV virus source is difficult to preserve continuously through the living bodies, the conventional cycle of obtaining the virus source is long, virus feeding plants cannot be provided for a long term, and minimum of the instar of the virus feeding nymphs is difficult to operate, and the like are solved. The obtained small brown planthoppers with the virus can support rice and corn variety resistance identification at any time and can also serve as RBSDV purification and serum preparation materials, and the problems that materials are difficult to obtain and the virus content is low and the like in conventional purification are solved. By application of the method, research, development and utilization of the RBSDV are greatly accelerated.
Owner:JIANGSU ACAD OF AGRI SCI

A kind of ultra-low volume liquid preparation containing thiacloprid

The invention discloses an ultra-low-volume liquid preparation containing thiacloprid, which uses thiacloprid, or a compound of thiacloprid and active component II as the active ingredient, and supplements the rest to 100% with additives and solvents. Low-volume liquid formulation; active ingredient II is beta-cypermethrin, pymetrozine, chlorantraniliprole, flubendiamide, tofenpyrad, azadirachtin, buprofezin, abamectin or emamectin Any of the plain benzoates. The invention can be used to control crop pests such as rice planthopper, rice leaf roller, brown planthopper, white-backed planthopper, striatellus striatellus, stem borer and rice thrips, and has the advantages of convenient processing, water saving, high work efficiency and good drug effect , long-lasting, synergistic and other advantages.
Owner:GAUNGXI TIANYUAN BIOCHEM

Numerator mark concatenated with whitebacked planthopper resistance genes of rice, and developing method thereof

InactiveCN101294161AOvercoming shortcomings such as long time periodStrong resistanceFermentationPlant genotype modificationBiotechnologyPlanthopper
The invention discloses a molecular mark linked with rice gene resistant to Whitebacked Planthopper. Rice is selected, and a molecular mark primer is selected from following primer pairs, wherein the nucleotide sequence is 5' arrow 3'; RM6917 forward: CTGGTTGTTTTCTGAACTCCGT, reverse: GCATTAACCATAGCTGTCCACTC; and AP4741 forward: AATCATGCTAGGTTATTACTCG, reverse: GTGCAGAGATCATGCTTTTG. The invention also provides the development method of the molecular mark. The molecular mark is tightly linked with the gene resistant to Whitebacked Planthopper, and can be used for auxiliary selection and breeding of rice resistant to Whitebacked Planthopper.
Owner:CHINA NAT RICE RES INST

Application of Metarhizium anisopliae strain in preparation of insecticide for vegetable pest insects

The invention relates to an application of a Metarhizium anisopliae CQMa421 strain in preparation of insecticide for preventing and controlling Striped flea beetle or plutella xylostella. The strain is capable of infecting Striped flea beetles and plutella xylostella with fatality rates being 60.9% and 70.8% respectively. The Metarhizium anisopliae CQMa421 strain with enhanced toxicity, which is prepared according to a method disclosed by the invention, has a fatality rate reaching 100% and achieves an outstanding prevention and control effect. The insecticide for preventing and controlling Striped flea beetles or plutella xylostella comprises dry conidial powder of Metarhizium anisopliae CQMA421 (44-60%), kieselguhr (30-40%), nano-aluminum trihydrate (0.5-1%), sodium carboxymethylcellulose (3-5%), tween-80 (3-5%) and OP-10 (3-5%). All the components in the Metarhizium anisopliae insecticide are matched effectively to take a synergistic effect. After being mixed with water, the Metarhizium anisopliae insecticide is applied in a spraying way to achieve a field prevention effect of 80% or above for rice planthopper. The Metarhizium anisopliae insecticide has excellent wetting dispersion characteristic, wherein the wetting time is less than 60s; and in addition, the bioactivity during long-term storage can be retained and the storage time is as long as 12 months.
Owner:CHONGQING JULIXIN BIOENG

Method for raising small brown rice planthopper by utilizing soil-less cultured barley seedling

InactiveCN101715754APrevent seedling rotTake advantage ofSeed and root treatmentAnimal husbandryNatural deathPlanthopper
The invention relates to a method for raising small brown rice planthopper by utilizing soil-less cultured barley seedlings, belonging to the technical field of insect raising. The method comprises the steps of: culturing barley seedlings, raising small brown rice planthopper nymphae, taking care of the eggs delivered by small brown rice planthopper imagoes and carrying out subculture. In the invention, soil-less cultured barley seedlings are adopted, the culture is not limited by field, temperature and other natural conditions, and the seeds of barley seedlings are sterilized to prevent the barley seedlings from rotting. During the raising period, the whole operation is convenient, and the environment is clean and neat without the limitation of time, space and temperature, especially a method of inversely covering a wild-mouth bottle is used for transferring nymphae to reduce the natural death of nymphae during transferring; reasonable culture density is used for nymphae culture and imagoes culture, which ensures the fully utilization of barley seedlings, reduces the frequency for replacing barley seedling, facilitates the operation and saves time. The invention has the advantages of subculture, uniform worm age, large multiplication quantity and the like, and ensures the large quantities of standard worm source required by test.
Owner:ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES

Application of NlInR gene of brown planthopper as target point in preparation of pesticide for preventing and treating brown planthopper

The invention discloses application of a NlInR gene of brown planthopper as a target point in preparation of a pesticide for preventing and treating the brown planthopper, and provides dsRNA used forinhibiting expression of the NlInR gene, wherein the NlInR gene is composed of a NlInR1 gene and a NlInR2 gene; the nucleotide sequence of the NlInR1 gene is shown as SEQ ID NO.1; the nucleotide sequence of the NlInR2 gene is shown as SEQ ID NO.2. The effect of the NlInR gene in preventing and treating the brown planthopper is discovered for the first time, the dsRNA of the NlInR gene is obtainedthrough an RNAi technology, and after the NlInR gene is silenced through a micro-injection mode, the individual development and the ovarian development of the brown planthopper can be effectively inhibited, and the spawning amount is reduced, so that the propagation of the brown planthopper is inhibited, and the prevention and treatment of the brown planthopper are realized.
Owner:HANGZHOU NORMAL UNIVERSITY

Insecticidal composition containing sulfoxaflor

The invention discloses an insecticidal composition containing sulfoxaflor, comprising A and B components, wherein the active component A is selected from sulfoxaflor and the active component B is selected from any one of the following insecticides: pymetrozine, imidacloprid, acetamiprid, nitenpyram, thiamethoxam, buprofezin, thiacloprid, clothianidin and dinotefuran; and the weight percentage of the active components A to B is: (1-50%): (1-50%). The composition can be used for preventing and treating many insects, has obvious synergy, expands the insecticidal range and has relatively high activity on sucking insects such as plant hopper, aphid, Empoasca pirisuga Matsumura and aleyrodid, and Lepidoptera pests such as plutella xylostella and spodoptera exigua. Furthermore, the composition reduces the usage of the farm chemical and residue of the farm chemical on the crops, alleviates the environment pollution, and has safety on both human and poultry, good environment compatibility; and the insects are difficult to generate drug resistance.
Owner:陕西汤普森生物科技有限公司

Breeding method of insect-resistant big-stigma three-line sterile line

The invention discloses a breeding method of an insect-resistant big-stigma three-line sterile line, belonging to the technical field of rice insect-resistant breeding. The breeding method is characterized in that a three-line maintainer line B is taken as a recurrent parent, a chilo-suppressalis-resisting parent, a rice-planthopper-resisting parent and a big-stigma parent are subjected to hybridization, backcross and insect-resistant screening to polymerize big stigma, chilo-suppressalis-resisting and rice-planthopper-resisting genes in the three-line maintainer line B, and then the highly chilo-suppressalis-resisting and planthopper-resisting big-stigma three-line sterile line is formed through hybridization and backcross of the line B and a corresponding line A. The sterile line is highly resistant to rice planthopper and chilo suppressalis, is easy to expose because of large stigma of glumous flowers, and is high in exposure rate of the stigma, outcrossing maturing rate and seed production yield; and the seed production yield and the insect-resistant level of hybrid rice can be improved when the insect-resistant big-stigma three-line sterile line is used for preparing the hybrid rice.
Owner:福建亚丰种业有限公司

Carrier plant system for protecting and increasing number of rice field rice planthopper parasitic wasps

The invention discloses a carrier plant system for protecting and increasing the number of rice field rice planthopper parasitic wasps. The carrier plant system comprises three parts, namely, carrier plants, substitute hosts and the parasitic wasps, wherein the carrier plants are grassy weed blighted grain grass and clubhead cutgrass herbs, the substitute hosts are main phytophagous insect false brown planthopper on the grassy weed blighted grain grass and the clubhead cutgrass herbs, and the parasitic wasps are mainly anagrus nilapartvatae pang et wang. The system servers as a species pool of natural enemies of the rice planthopper and used for unceasingly breeding the parasitic wasps, the biological control efficiency of the rice planthopper can be effectively improved, and the number of the times of using pesticides can be lowered by 2 to 3 in one season. The system has the advantages of being long in action time, easy to operate and high in practicability.
Owner:ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES

Screening method and applications of brown planthopper reference genes under high temperature stress

InactiveCN104178564ATroubleshoot screening issuesMicrobiological testing/measurementReference genesTemperature stress
The invention discloses a screening method of brown planthopper reference genes under high temperature stress. According to the screening method, fluorescent quantitative PCR studies are carried out through taking brown planthopper under no stress as a control material and brown planthoppers under the stress of different high temperatures as experimental materials; and quantitative PCR data of candidate reference genes are input to geNorm and BestKeeper softwares to be analyzed so as to screen the most suitable and most stably expressive reference gene-actin1 in the brown planthoppers under the high temperature stress and under no stress. On the basis, the expression pattern of an hsp90 gene of the brown planthopper under the high temperature stress is studied by the inventor through taking the brown planthopper at the high temperature as a sample, the heat shock protein gene hsp90 of the brown planthopper as a target gene and the screened actin1gene as the reference gene.
Owner:INST OF PLANT PROTECTION GUANGXI ACADEMY OF AGRI SCI

Immunity detection reagent kit for rice black-streaked dwarf fijivirus in single-head small brown rice planthopper

The invention discloses an immunodetection kit specially used for rice black-streaked dwarf virus in single planthopper and a using method thereof. Specific polyclonal antibodies of the rice black-streaked dwarf virus (RBSDV) are utilized to build a dot immuno-binding assay (DIBA) detecting method which is used for building the detection kit for rice black-streaked dwarf virus, main reagents of the kit are working solution or concentrated solution, and the kit has the characteristics of convenient use, simple operation, and the like. And simultaneously, the use of the rice black-streaked dwarf virus detection kit can be a standard program or a reduced program, which can greatly broaden the using ranges and applicable persons of the kit and facilitate the population and application of the technique to establishment units, and further, the kit is applied in the fields of plant disease prognosis and prediction and the formulation of prevention and curing strategies, and the like. In addition, the kit can be used for measuring the inoculation strength in varietal resistance seed selection of rice black-streaked dwarf virus, and the like.
Owner:JIANGSU ACADEMY OF AGRICULTURAL SCIENCES

Composite insect disinfestation micellar emulsion contaning triazophos and 'Ruijinte', and its preparation method

InactiveCN1539285AUniform and transparent appearanceImprove liquidityBiocideAnimal repellantsEmulsionFipronil
A composite insecticide in the form of microemulsion for rice borer, leaf roller, plutella xylostella, leafhopper, etc is prepared from triazophos, fipronil, emulsifier, stabilizer, cosolvent, antifreezing agent and water through proportional mixing, stirring, and emulsifying. Its advantages are high effect and less environmental pollution.
Owner:BAYER CROPSCIENCE (CHINA) CO LTD

Method for cultivating paddy rice in lodging resistance way

The invention discloses a method for cultivating paddy rice in a lodging resistance way, comprising the following steps of (1) selecting a lodging resistance variety; (2) implementing row-expanding transplant and rational sparse planting; (3) rationally irrigating to keep the alternate dry or wet status of a paddy field; (4) rationally applying fertilizer to optimize nitrogen fertilizer management; (5) enhancing control on plant diseases and insect pests, i.e. enhancing control on rice planthopper, banded sclerotial blight, rice joint blast and chilo suppressalis; (6) after the occurrence of lodging, timely adopting remedial measures, i.e. timely ditching for water discharge, implementing the foliage top dressing of foliar fertilizer, and bunching and strengthening after lodging. By the adoption of the method for cultivating the paddy rice in the lodging resistance way, as the resistance against external environmental conditions is enhanced, the lodging resistance capability of the paddy rice can be improved; after suffering natural hazards such as typhoon and rainstorm, the paddy rice grows well; therefore, available spikes are increased by 10.2%, total grains are increased by 10.2%, and filled grains are increased by 10.5%; the maturing rate is increased by 10.3%, the thousand grain weight is increased by 10.1%, the theoretical yield is increased by 10.9% and the actual yield is increased by 10.9%; in addition, the rice grains are excellent in quality, the cooked rice is tasted good, and the economic benefits are obvious.
Owner:句容市植保植检站