145 results about "Reference genes" patented technology

A molecular marker closely linked to a pepper fruit shape gene. Taking a basic version of Zhangshugang pepper as a reference gene, a single nucleotide polymorphism is present at base 162028839 of the pepper Chr02 chromosome, where a substitution from base C to A occurs. A primer and kit for identifying the molecular marker closely linked to the pepper fruit shape gene, and use thereof in identifying the pepper fruit shape or in molecular-assisted breeding. Early use of the molecular marker, the primer, and the kit in the early stage can quickly screen satisfactory plants, thereby effectively reducing the planting scale, reducing the workload of later identification, and improving the selection efficiency and accuracy. The molecular marker, the primer, and the kit are of great significance in the practice of pepper fruit shape breeding and the research on fruit shape changes and regulation mechanisms.

The invention belongs to the technical field of plant biology, and particularly relates to a gene for regulating and controlling powdery mildew resistance of cucumbers and application of the gene, two cswrky31 mutants are obtained based on a cucumber Tnt1 reverse transcription transposon mutant library, and the two cswrky31 mutants both show high susceptibility to powdery mildew bacteria. A target gene Csa5G551250 which is directly regulated and controlled by CsWRKY31 is screened by virtue of a high-throughput transcriptome sequencing technology and a DNA affinity purification sequencing technology in combination with a yeast one-hybrid experiment. A dual luciferase report experiment shows that the CsWRKY31 positively regulates and controls the expression of the Csa5G551250, and the overexpression of the Csa5G551250 gene promotes the resistance of the cucumber to powdery mildew bacteria. A new reference gene resource is provided for cultivation of cucumber disease-resistant varieties, and a new thought is provided for molecular mechanism research of transcription factor mediated plant immunity.

The invention belongs to the field of pepper breeding, and discloses a KASP molecular marker closely linked with pepper fruit length, a primer, a kit and application, the molecular marker takes a Ca591.0 version gene as a reference gene, the single nucleotide polymorphism at the 70238018 position of the pepper No.3 chromosome is subjected to base A-T replacement, the flanking nucleotide sequence is shown as SEQ ID No: 1, the nucleotide sequence is shown as SEQ ID No: 2, and the nucleotide sequence is shown as SEQ ID No: 3. The sequences of the primers are shown as SEQ ID No: 2-4, and the kit comprises the primers. The invention also discloses an application of the primer or the kit in identification of different length types of pepper fruits or in molecular assisted breeding of pepper fruit length. A primer and a kit are developed aiming at the molecular marker, and can be used for identifying the length of the pepper fruit, so that assistant breeding is carried out by depending on the molecular marker, and the problems that the conventional breeding period is long and is easily influenced by the environment can be effectively solved.

The invention provides a probiotic screening method based on a fine tuning DNABERT model and a convolutional neural network. The method comprises the following steps: acquiring a reference genome sequence and a target sequence sample; preprocessing the reference genome sequence and the target sequence sample; segmenting the preprocessed reference gene sequence, and inputting the segmented reference gene sequence into a DNABERT model for fine tuning training; expanding the number of samples of the preprocessed target sequence, segmenting the sequence by using a sliding window, and inputting the segmented sequence into the fine-tuned DNABERT model for decoding to obtain a representation vector; inputting the representation vector into a CNN model for training, sequencing a target sequence to obtain a to-be-detected sequence sample, encoding the to-be-detected sequence sample, inputting the encoded to-be-detected sequence sample into the CNN model, judging whether the strain is the probiotics or not, and completing screening of the probiotics; according to the method, the data enhancement technology of introducing the reverse complementary sequence and the randomly intercepted sub-sequence is adopted, so that the diversity and the quantity of training data are increased, and the overfitting problem is effectively relieved.

The invention belongs to the technical field of biological detection, and discloses a primer probe composition for detecting CMV virus, a product and application thereof, the primer probe composition for detecting CMV virus comprises a primer probe combination for detecting CMV virus and a primer probe combination for detecting reference gene; the detection technology can be used for detecting the CMV on the DNA level and also can be used for detecting on the RNA level, the detection operation is more flexible, and the detection technology is particularly suitable for rapid safety recheck of cell therapy products and process detection in the production process. The primer probe composition provided by the invention has good detection sensitivity and specificity, is simple to operate, and can be widely applied to CMV detection of cell therapy products.

The invention relates to the technical field of molecular biology, in particular to a reference gene for Chinese olive functional gene expression analysis and application thereof. According to the invention, the reference gene RPN2B which is most stably expressed in fruits of different varieties (lines) of Chinese olives in different development and maturation periods is screened out, and in addition, two reference genes NIFS1 and RPS16 which are only second to the RPN2B are also screened out, so that the method can be used for expression analysis of nutritional quality or other functional genes of the fruits of the Chinese olives of different varieties (lines) in different development and maturation periods; the specificity, the stability and the accuracy of functional gene expression analysis data are remarkably improved, and powerful support is provided for Chinese olive functional gene expression analysis. The invention also provides a special detection primer for detecting the reference gene of the Chinese olive fruit, and the detection primer can quantify the expression quantity and function analysis of the auxiliary gene through fluorescence in the Chinese olive function research, and has high application value.

The application provides a urine exosome-based bladder cancer gene detection system and application, and relates to the technical field of biological detection. Through the cooperative application of the internal reference gene and the diagnosis model, the application provides a reliable endogenous quality control standard for the bladder tissue-derived exosome in the urine exosome sample; meanwhile, the application realizes non-invasive, accurate, rapid screening, diagnosis, prognosis and recurrence monitoring of bladder cancer, lays a key technical foundation and detection tool for the urine exosome-based molecular diagnosis of bladder cancer, and has important clinical transformation value and application prospect.

Provided is an internal reference gene for the real-time quantitative PCR (RT-qPCR) of Yersinia enterocolitica, including one of or a combination of some of glnS, nuoB, glmS, gyrB, dnaK, and thrS genes. Further provided is a primer set for amplifying the internal reference gene for the RT-qPCR of Yersinia enterocolitica. Given that stable housekeeping genes of Yersinia enterocolitica remain unclear, internal reference genes with relatively stable expression at different culture temperatures are selected by screening for Yersinia enterocolitica. Specific detection primers and real and reliable data provide a reference basis for selecting housekeeping genes of Yersinia enterocolitica; moreover, the use thereof alone or in combination, as an internal reference gene, improves the data accuracy, stability, and reliability, thereby solving the problem that usually only empirically selecting 16s rRNA as a single internal reference gene in conventional RT-qPCR results in unstable research results.

The present invention discloses lncRNA internal reference genes for osmanthus hormone treatment, primers, and applications thereof. The present invention obtains the optimal lncRNA internal reference genes for osmanthus under hormone treatment conditions: lnc00239991+18S under ABA treatment, lnc00265419+lnc00249739 under MeJA treatment, lnc00229717+lnc00044331 under ethephon treatment, and lnc00265419+lnc00239991 under multiple hormone treatments. qRT-PCR primers were designed using these genes. This invention fills the technical gap of the lack of internal reference lncRNAs under osmanthus hormone treatment, provides strong support for the quantification of lncRNAs under osmanthus hormone treatment, and provides a theoretical basis for the study of gene function in osmanthus.

The invention belongs to the technical field of forensic medicine, and particularly relates to an mRNA marker combination, a product and application thereof and a forensic human menstrual blood or human menstrual blood spot detection method. The mRNA marker combination comprises a reference gene, a human blood specific mRNA marker and a human menstrual blood specific mRNA marker; the human blood specific mRNA marker is composed of HBA, HBB, ALAS2 and GYPA; the human menstrual blood specific mRNA marker is composed of MMP7, MMP10, SFRP4 and STC1. Standardized identification suggestions are given according to mRNA marker combination expression conditions, the problems of insufficient specificity, flow disorder and the like in the prior art are solved, human menstrual blood or human menstrual blood spots can be accurately distinguished from peripheral blood and other body fluids, cross-platform compatible standardized detection is realized, evidence support is provided for missing cases, and the detection method is suitable for clinical application. The method has important practical significance for improving the forensic physical evidence identification efficiency.

According to the DUX4-IGH rearrangement detection primer probe set, the kit and the application, common rearrangement fracture sites of DUX4-IGH are confirmed, an upstream primer is designed on the upstream of a DUX4 transcript, 33 downstream primers are designed according to IGH fracture positions, a universal primer is designed on the upstream of DUX4, and a universal DUX4 probe is designed near the downstream of the primer; interference between the primer probes is small, influence of non-specific amplification is small, the primer probes are suitable for specific detection of multiple DUX4-IGH rearrangement sites, the problem that rearrangement detection is difficult in the prior art is solved, DUX4-IGH fusion transcripts and ABL1 reference genes can be quantitatively detected in a digital PCR instrument through RT-PCR, a basis is provided for auxiliary diagnosis, and the primer probes have remarkable application prospects.

The invention discloses a detection kit for detecting JAK2V617F mutation, which is characterized by comprising: a JAK2V617F detection reagent, which comprises an inner primer pair, an outer primer pair and a specific probe for specifically amplifying a JAK2V617F mutant gene; the internal reference detection reagent comprises a primer pair and a probe of an internal reference gene; the PCR reaction buffer solution comprises a reaction mixed solution and a HotstartTaq enzyme; the kit comprises a positive control, a known proportion of V617F mutant DNA, a negative control, a JAK2V617F wild type DNA, a positive control and a known proportion of V617F mutant DNA. Compared with the prior art, the invention has the advantage of providing the detection kit for detecting JAK2V617F mutation, which can be used for diagnosis, identification and clinical prognosis of PV.

The invention relates to the technical field of helicobacter pylori multi-drug-resistant gene detection, and discloses a paper sensor-based helicobacter pylori multi-drug-resistant gene detection and treatment quantitative monitoring kit, which comprises an isothermal amplification module, which comprises a loop-mediated isothermal amplification reaction system and is used for carrying out isothermal amplification on 23S rRNA gene and rdxA gene of helicobacter pylori; the paper sensor module comprises a nitrocellulose membrane, the nitrocellulose membrane comprises a test area and a control area, a biotin labeled probe aiming at 23S rRNA gene and rdxA gene mutant amplification products is fixed in the test area, and a biotin labeled probe aiming at reference gene cgt amplification products is fixed in the control area; and the color development module is used for performing color development and quantitative analysis on the detection result of the paper sensor module. The kit disclosed by the invention can be used for detecting various helicobacter pylori multi-drug-resistant genes, can be used for quantitatively monitoring, and is rapid and convenient to monitor.

The present invention relates to methods for determination of vector copy number. In particular, there is provided a method of determining a vector copy number in a biological sample that has undergone transduction with two or more vectors, the method comprising: (a) extracting genomic DNA (gDNA) from the biological sample; (b) performing digital droplet PCR (ddPCR) on the extracted gDNA using one or more pairs of forward and reverse primers to amplify a transgene of interest on each vector and to amplify a reference gene, together with one or more probes for detection of the amplification products; and (c) determining vector copy number for each vector in the biological sample.

The application belongs to the field of plant biotechnology, and particularly relates to a cucumber CsODO1 gene and application thereof, and is a MYB transcription factor capable of being combined with a CsCSE1 promoter, which is screened through a yeast single hybridization. It is proved through EMSA and tobacco transient expression analysis that the CsODO1 gene directly and specifically combines with a "CAACCA" sequence in the CsCSE1 promoter, and inhibits the expression of the CsCSE1 gene. The CsODO1 gene can be induced to express by a powdery mildew fungus, and is differentially expressed in the cucumber infected by the powdery mildew fungus. It is found through a cucumber cotyledon transient transformation system mediated by an agrobacterium that the CsODO1 gene negatively regulates the biosynthesis of lignin and the resistance of the cucumber to the powdery mildew fungus. The application provides a new reference gene resource for the cultivation of a cucumber disease-resistant variety, and provides a new thought for the research on the molecular mechanism of the plant immunity mediated by the lignin pathway.

The present invention relates to a c-myc gene copy number microdroplet digital PCR detection kit, belonging to the field of biomedicine technology. The present invention provides a c-myc gene copy number microdroplet digital PCR quantitative detection method, which calculates the c-myc gene copy number based on the fluorescence values of the c-myc gene and an internal reference gene; the present invention discloses primers and probes for the above method and kit. By combining the present invention with clinical pathological information, follow-up results, treatment response, and fluorescence in situ hybridization methods, the optimal threshold value of c-myc gene copy number amplification variation is determined, which serves as a reference indicator for the prognosis of specific tumor patients, providing a convenient and reliable auxiliary diagnostic tool for clinical practice.

The invention discloses a subsequence searching method, a comparison method, a system and equipment of a gene sequence. The subsequence searching method comprises the following steps: acquiring a preset number of sequencing data of a to-be-searched gene sequence; sequentially acquiring basic group data of a search interval corresponding to each piece of sequencing data on the reference gene sequence, and searching based on an acquisition result; the search interval corresponding to each piece of sequencing data is determined based on the to-be-searched base sequence of each piece of sequencing data; repeatedly obtaining the base data of the search interval of the next search, and searching based on the obtained result to obtain a target sub-sequence; the search interval of the next search is determined according to the next to-be-searched alkali of each piece of sequencing data and the search interval of the previous search. According to the search method, the basic group data of the search interval is obtained in advance, the sequencing data is processed in batches, calculation of other sequencing data can be processed when the prefetch result is waited, and the gene search efficiency is improved.

The invention belongs to the technical field of molecular biology, and particularly relates to a method for detecting transgenic source soybeans in soybean oil through an LAMP-OSD probe. The invention provides a rapid, sensitive, specific and visual method which is used for detecting whether soybean oil contains transgenic soybean components or not and a small amount of fragmented DNA (deoxyribonucleic acid) in the soybean oil, and detecting the transgenic soybean components in the soybean oil by simultaneously or respectively detecting two most common transgenic selection marker elements, namely a CaMV 35S promoter and an NOS terminator and a soybean reference gene Lectin. And whether the transgenic soybean is used in the raw material of the soybean oil can be effectively identified.

The application discloses a KASP molecular marker closely linked with pepper stem tip color, takes a zhangshugang version gene as a reference gene, and the KASP molecular marker is at 148515563 of a pepper 10th chromosome, a single nucleotide polymorphism at the position, and a base C to A replacement occurs at the position. The application further discloses primers, a kit for identifying the KASP molecular marker closely linked with the pepper stem tip color, and application of the KASP molecular marker in identifying the pepper stem tip color or identifying purity of pepper seeds. The KASP molecular marker closely linked with the pepper stem tip color gene, and the primers and the kit developed according to the KASP molecular marker can be used for identifying the pepper stem tip color and identifying the seed purity, can be detected at a seedling stage, and the identification method is carried out indoors, so that influences of natural factors such as weather, diseases and insect pests are avoided, and true and false hybrid seeds can be identified early, fast and accurately, and the seeds can be put on the market early.

The invention belongs to the field of molecular biology of forestry insects, and particularly relates to a fluorescent quantitative reference gene of different gender adults of yellow shield elephant, as well as a primer and application of the fluorescent quantitative reference gene. According to the method, 8 candidate genes commonly used as reference genes are referenced and selected according to transcriptome sequencing data of the hedychium aureum, gene sequences of the 8 reference genes are identified, the stability of the candidate reference genes is evaluated through five algorithms, and the fluorescent quantitative reference genes suitable for the hedychium aureum adults with different genders are obtained. And a real-time fluorescent quantitative PCR (Polymerase Chain Reaction) primer of the candidate reference gene is designed. The detection primer provided by the invention is strong in specificity and high in amplification efficiency, fills up the current situation that no reference gene exists under adults with different genders of the hedychium aureum, provides a reliable analysis basis for expression quantification of related functional genes under the adults with different genders of the hedychium aureum, and has a good application prospect. A necessary earlier-stage foundation is laid for analysis of subsequent molecular mechanisms and mining of key functional genes, and repeatability, stability and reliability of functional gene research can be improved at the same time.

The invention provides a primer design, a disease typing diagnosis method and device, a composition, a kit and application thereof, and the primer design method comprises the following steps: obtaining a variety of reference data including a TRDV reference gene sequence and a TRDJ reference gene sequence; aiming at each kind of reference data, performing the following operations: aligning a plurality of reference gene sequences according to sites, determining a conservative score list of each site, obtaining conservative scores of a plurality of conservative intervals according to the conservative score list of each site, selecting K conservative intervals with higher conservative scores, K being a natural number greater than or equal to 1, and selecting K being a natural number greater than or equal to 1; generating K groups of primer combinations aiming at the K conservative intervals; and screening the primers in the K groups of primer combinations, evaluating the screened K groups of primer combinations, and obtaining a final primer combination according to an evaluation result.

The invention discloses screening and application of a fluorescent quantitative reference gene in a root and stem development process of iris vetiveria, and belongs to the technical field of plant genetic engineering. By constructing a strict reference gene evaluation and screening system, the reference gene with the most stable expression in different stages of root and stem development of iris vetiveria is screened out from eight candidate genes for the first time, errors in samples and between samples caused by internal reference selection are remarkably reduced, accurate correction and standardization of the expression level of a target gene are achieved, and the accuracy of the reference gene is improved. And reliable technical guarantee is provided for subsequent large-scale accurate quantitative analysis of irisone synthesis related functional genes.

The invention discloses a primer and a probe for digital PCR (polymerase chain reaction) detection of environmental DNA (deoxyribonucleic acid) abundance of aurelia aurita, a primer pair and a probe combination comprise an upstream primer with a sequence of SEQ ID NO: 15 'GCGGTAACTCTGACCGTGAT 3', a downstream primer with a sequence of SEQ ID NO: 25 'GTCGGCTTGCAATTTGTAT 3', a probe with a sequence of SEQ ID NO: 35 'FAM-ATGGCTAAACGAATCCTCCCTGTCT-BHQ 3', and a fluorophore added to the probe is 5-carboxyl fluorescein. The primer and the probe have strong specificity, high sensitivity and good repeatability, so that the time sequence change of the abundance of the aurelia in an environmental water body can be detected by using a digital PCR technology, and the time sequence change is used as an index for evaluating the change condition of an aurelia population and has potential application value in early warning and forecasting of disaster-causing aurelia of a coastal nuclear power plant. A control group does not need to be set, reference genes are not needed, and the application limitation of a traditional fluorescent real-time quantitative PCR detection method is broken through.

The application discloses application and primers of CuSUMO1 and CuHTR4 as internal reference genes, belongs to the technical field of plant molecular biology, and particularly relates to application of CuSUMO1 and / or CuHTR4 as internal reference genes for quantitative analysis of genes of Dendrocalamopsis oldhami in Jinfoshan Mountain, and is characterized in that the nucleotide sequence of the CuSUMO1 is shown as SEQ ID NO. 2, and the nucleotide sequence of the CuHTR4 is shown as SEQ ID NO. 3. The application provides the internal reference genes CuSUMO1 and CuHTR4 and a primer pair for detecting expression analysis research of target genes of samples in different tissues, different development periods and different stress treatments of Dendrocalamopsis oldhami in Jinfoshan Mountain. The internal reference genes CuSUMO1 and CuHTR4 have high stability, and have important values for evaluating and detecting expression amounts of target genes of Dendrocalamopsis oldhami in Jinfoshan Mountain in different tissues, different development periods and different stress treatments.

The invention particularly relates to a primer probe and a kit for detecting the copy number of a GJB2 gene of a non-syndromic deafness patient by using microdroplet digital PCR (Polymerase Chain Reaction), and application of the primer probe and the kit. The primer probe combination provided by the invention comprises a target gene detection primer pair, a target gene detection probe, an upstream primer of a reference gene, a downstream primer of the reference gene and a probe of the reference gene, and the sequence information of the primer probe combination is shown as SEQ ID NO.6-11; the invention also provides a kit for detecting the copy number of the GJB2 gene of a non-syndromic deafness patient. When the primer probe combination and the kit provided by the invention are applied to detection of copy number variation of the GJB2 gene of a patient with non-syndromic deafness, the accuracy of hereditary deafness detection is remarkably improved; whether GJB2 gene expression is abnormal or not is judged in an auxiliary mode according to the judgment result, disease prognosis is evaluated, potential treatment drugs are screened, genetic counseling services are provided or personalized medical schemes are formulated, and the method has wide application prospects.

The invention discloses a metagenome activity quantification method based on an exogenous artificially synthesized endogenous reference gene and application of the metagenome activity quantification method, and relates to the technical field of biology. According to the invention, an endogenous reference gene as shown in SEQ ID NO.1 is firstly designed, and the endogenous reference gene has no homology with an existing organism and can realize homology interference. On the basis, a metagenome activity quantitative method is further designed, and the core thought of the metagenome activity quantitative method comprises the following steps: providing an artificially synthesized vector containing an endogenous reference gene, setting the artificially synthesized vector as a standard system with gradient concentration, and adding the standard system into a sample to be detected; before addition, a to-be-detected sample is pretreated through light-sensitive DNA combined with dye so as to shield dead bacteria DNA interference, then nucleic acid extraction, library construction and sequencing are carried out, and metagenome activity quantification is obtained through bioinformatics analysis and calculation. According to the method, homology interference is eliminated from the source, absolute quantification of microbial activity is realized, the stability and standardization degree of an internal standard are improved, and the method is suitable for quantitative analysis of metagenomes in various scenes.

The invention discloses a method for synchronously detecting multiple strawberry pathogens and application, the method for synchronously detecting multiple strawberry pathogens comprises a primer combination capable of synchronously detecting multiple strawberry pathogens, and the primer combination comprises 18 specific primers and 2 universal primers, the fluorescent probe can be used for detecting strawberry mottle virus, strawberry mild yellow edge virus, strawberry crinkling virus, strawberry vein banding virus, strawberry powdery mildew, strawberry gray mold, strawberry anthracnose, strawberry xanthomonas and strawberry internal reference beta-Actin1, and also provides a corresponding detection method, a detection reagent and a detection kit. According to the method, 9 targets can be detected at the same time through one-tube reaction, the detection efficiency is greatly improved, meanwhile, a false negative result is effectively avoided through internal reference gene monitoring, powerful technical support is provided for early diagnosis of strawberry diseases, and the method has great application value and market prospects.

The present invention discloses a diagnostic kit for autism spectrum disorder based on pan-apoptosis-related genes, which belongs to the field of biomedicine. The diagnostic kit for autism spectrum disorder based on the pan-apoptosis-related genes of the present invention includes a detection kit. <h2 style=";text-align:left;direction:ltr">CD36 <h2 style=";text-align:left;direction:ltr"> LMNB1, DNAJA1, MSH2, JAK2, PDCD4, DEK This study identified and screened key pan-apoptosis genes that were differentially expressed between children with autism spectrum disorder and healthy children. Using primer sequences for these key pan-apoptosis genes and internal reference genes, a diagnostic kit was constructed to calculate autism risk based on the expression levels of these key genes. External sample validation of the kit and its diagnostic efficacy was conducted, demonstrating positive results.

The present invention provides miRNA internal reference genes and primers thereof and applications during the opening and aging of sweet osmanthus petals, belonging to the field of plant molecular biology. The petals opening and aging process include S1 (spiritual stem stage), S2 (initial flowering stage), S3 (initial flowering stage), S4 (full flowering stage), S5 (late flowering stage) and S6 (petal shedding stage). The present invention screened 14 candidate internal reference genes, evaluated the stability of the candidate genes by 5 algorithms (delta-CT, geNorm, NormFinder, BestKeeper and RefFinder), and obtained miRNA internal references suitable for the opening and aging of sweet osmanthus petals, which are novel33 and ofr-miR395e. The present invention designs real-time fluorescence quantitative PCR primers for internal references, which have strong primer specificity and high amplification efficiency, can greatly improve the detection efficiency when using real-time fluorescence quantitative detection of sweet osmanthus miRNA, and improve the credibility of the test results.

The invention discloses a primer and a method for quickly identifying the molecular level gonad differentiation state of strongylocentrotus nudus, which are characterized in that two gene segments CYCLIN A and CYCLIN B which are obviously differentially expressed in undifferentiated and differentiated gonad tissues are analyzed and identified through bioinformatics, a fluorescent quantitative PCR (Polymerase Chain Reaction) primer is designed, and a Ubiquitin gene is used as a reference gene through real-time quantitative PCR, so that the differentiated gonad differentiation state of strongylocentrotus nudus is identified, and the differentiated gonad differentiation state of strongylocentrotus nudus is identified. Respectively calculating expression quantities of the CYCLIN A gene and the CYCLIN B gene in the same sea urchin gonad, and converting the expression quantities into-LOG2 multiple change values; if the obtained-LOG2 multiple change values are all greater than 3, determining that differentiation is not carried out, otherwise, determining that differentiation is carried out. Compared with the prior art, the method has the characteristics of simplicity, rapidness, accuracy, sensitivity and the like.