Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

GSTM3 (Glutathione S-Transferase M3) gene methylation quantitative detection method for hepatic failure prognosis and kit

A methylation quantification and detection kit technology, applied in the medical field, can solve problems such as strict control of conditions, and achieve the effects of good stability, far-reaching clinical significance, and accurate and reliable results.

Inactive Publication Date: 2014-01-22
SHANDONG UNIV QILU HOSPITAL
View PDF4 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, MSP-PCR can only be used for qualitative research and its polymerase chain reaction (PCR) conditions need to be strictly controlled

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • GSTM3 (Glutathione S-Transferase M3) gene methylation quantitative detection method for hepatic failure prognosis and kit
  • GSTM3 (Glutathione S-Transferase M3) gene methylation quantitative detection method for hepatic failure prognosis and kit
  • GSTM3 (Glutathione S-Transferase M3) gene methylation quantitative detection method for hepatic failure prognosis and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0036] For setting forth the present invention in more detail, below in conjunction with accompanying drawing and embodiment concrete method of the present invention will be further described:

[0037] GSTM3 Gene Methylation Quantitative Detection Kit contains reagents for extracting genomic DNA from peripheral blood; reagents for bisulfite modification of genomic DNA; 5× premixed PCR reaction system; ALU-specific primer pair and Taqman fluorescent probe, internal reference gene ALU-C4 specific primer pair and Taqman fluorescent probe:

[0038] GSTM3-upstream primer: 5'CGTACGGTTTTGTGGAGTC 3';

[0039] GSTM3-downstream primer: 5'TCCGAACCTTCGAAAACTAA 3';

[0040] GSTM3-probe: 5'Fam AAACCCACGCGCGAACGCC 3'BHQ1;

[0041] ALU-C4-upstream primer: 5'GGTTAGGTATAGTGGTTTATATTTGTAATTTTAGTA 3';

[0042] ALU-C4-downstream primer: 5'ATTAACTAAACTAAATCTTAAACTCCTAACCTCA 3';

[0043] ALU-C4-probe: 5'Fam CCTACCTTAACCTCCC 3'BHQ1.

[0044] The 5× premixed PCR reaction system is a commercially ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a GSTM3 (Glutathione S-Transferase M3) gene methylation quantitative detection method for hepatic failure prognosis and a kit, and provides a method and a device for quantitatively detecting the methylation degree of a glutathione S-transferase M3 promoter. The kit is internally provided with a reagent for extracting peripheral blood genome DNA (Deoxyribose Nucleic Acid), a reagent for modifying the genome DNA, a 5*premixing PCR (Polymerase Chain Reaction) system, a methylation specific primer pair and a Taqman fluorescence probe aiming at a target gene GSTM3 promoter, and a specific primer pair and a Taqman fluorescence probe of reference genes ALU-C4. According to the GSTM3 gene methylation quantitative detection method for the hepatic failure prognosis and the kit, the methylation specific primer pair and the probe of the target gene GSTM3 promoter and the specific primer pair and the probe of the reference genes can be used for carrying out a real-time quantitative polymerase chain reaction (PCR) on the peripheral blood genome DNA; a quantitative methylation specific PCR method is used for detecting a threshold value circulation value of the target gene GSTM3 and the reference genes ALU-C4 and calculating a gene GSTM3 methylation quantitative value, so as to be good for evaluating illness states, judging the prognosis and guiding the treatment.

Description

technical field [0001] The invention belongs to the field of medicine, and is a detection method and a kit for detecting the degree of methylation of genes related to the prognosis of liver failure, especially a detection method for quantitatively detecting the degree of methylation of glutathione S-transferase M3 promoter methods and kits. Background technique [0002] Acute-on-chronic liver failure (ACHBLF) is a group of clinical syndromes mainly manifested by jaundice, coagulation dysfunction, hepatic encephalopathy and ascites. It occurs on the basis of chronic liver disease, and is caused by extensive hepatocyte necrosis or severe liver damage caused by various factors, leading to serious impairment or decompensation of liver synthesis, excretion, biotransformation and detoxification. Acute-on-chronic liver failure can be induced by many reasons, and its main cause in my country is chronic hepatitis B (CHB). The severity of hepatitis B is caused by multiple genes and ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCC12Q1/6883C12Q1/6851C12Q1/686C12Q2545/101C12Q2561/101C12Q2600/118C12Q2600/154
Inventor 王凯王丽媛赵静高帅孙丰凯范玉琛
Owner SHANDONG UNIV QILU HOSPITAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com