Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

280 results about "Deoxyribose" patented technology

Deoxyribose, or more precisely 2-deoxyribose, is a monosaccharide with idealized formula H−(C=O)−(CH₂)−(CHOH)₃−H. Its name indicates that it is a deoxy sugar, meaning that it is derived from the sugar ribose by loss of an oxygen atom. Since the pentose sugars arabinose and ribose only differ by the stereochemistry at C2′, 2-deoxyribose and 2-deoxyarabinose are equivalent, although the latter term is rarely used because ribose, not arabinose, is the precursor to deoxyribose.

Genetically engineered bacterium for producing O-succinyl-L-homoserine as well as construction method and application of genetically engineered bacterium

The invention provides a genetically engineered bacterium for producing O-succinyl-L-homoserine as well as a construction method and application of the genetically engineered bacterium. In a chassis bacterium genome, the expression of a 2-ketoglutaric acid decarboxylase encoding gene sucA is enhanced, and the expression of a succinyl-coenzyme A synthetase encoding gene sucD is weakened, so that the supply of succinyl-coenzyme A is increased; the method comprises the following steps: increasing the NADPH (Nicotinamide Adenine Dinucleotide Phosphate) reducing capacity and ATP (Adenosine Triphosphate) energy supply of a chassis bacterium, increasing DNA (Deoxyribose Nucleic Acid) in combination with a transcription dual regulatory factor ompR to improve the stress resistance of escherichia coli under high osmotic pressure, and introducing an overexpression plasmid containing a homoserine transsuccinylase coding gene metA to construct the genetically engineered bacterium for producing O-succinyl-L-homoserine. The engineering strain obtained through a systematic metabolic engineering modification strategy can realize effective accumulation of OSH, the shake flask yield of OSH reaches 19.8 g / L, the fed-batch fermentation yield of a 5L fermentation tank reaches 110.5 g / L, the sugar-acid conversion rate reaches 52.6%, and a foundation is laid for subsequent construction of high-yield OSH engineering bacteria.
Owner:HANGZHOU YOUZE BIOTECHNOLOGY CO LTD

In-situ detection method of protein and phosphoinositide compound in tissue level

The invention relates to the technical field of biological detection, and discloses an in-situ detection method for the tissue level of a protein and phosphoinositide compound, which comprises the following steps: providing a to-be-detected tissue sample containing the protein and phosphoinositide compound; incubating the sample to be detected by using a primary antibody mixture; incubating a product obtained in the previous step by using a second antibody mixture containing a PLA probe, and reacting to obtain circular DNA (Deoxyribose Nucleic Acid); carrying out in-situ amplification by taking the circular DNA as a template; and acquiring and analyzing a signal of the detection probe. According to the method, the interaction between the protein and the phosphoinositide compound can be specifically detected in situ at the tissue level, the actual state of the protein and the phosphoinositide compound in the physiological and pathological processes of cells can be more truly reflected by the technology, and more accurate information is provided for researching the function and regulation mechanism of the protein and the phosphoinositide compound; wide application prospects are realized.
Owner:SOUTHERN UNIVERSITY OF SCIENCE AND TECHNOLOGY

Composite probe for detecting salmonella enteritidis and preparation method thereof

The invention belongs to the technical field of microbiological detection, and discloses a composite probe for detecting salmonella enteritidis and a preparation method. The composite probe for detecting the salmonella enteritidis comprises magnetic nanoparticles FeO, wherein the surface of the magnetic nanoparticles FeO is modified with an aptamer apt which is specifically combined with the salmonella enteritidis; the surface of the long afterglow nano particle PLNPs is modified with a DNA (Deoxyribose Nucleic Acid) sequence cDNA (Complementary Deoxyribonucleic Acid) complementary with the aptamer; the aptamer apt and the complementary DNA sequence cDNA are subjected to hybridization to form a composite probe structure FeO-SEapt (at) PLNPs-cDNA (complementary deoxyribonucleic acid). The long afterglow luminescence characteristic of PLNPs (ZnGaO: Cr) is utilized, and an excitation light source is stopped before detection, so that signal acquisition completely avoids autofluorescence of a sample matrix, background fluorescence interference is thoroughly eliminated, and the signal-to-noise ratio is remarkably improved.
Owner:CHENGDU UNIV

Method for constructing plasma ctDNA organ distribution characteristic chromatogram of advanced colorectal cancer

PendingCN121687190AMicrobiological testing/measurementBiostatisticsDeoxyriboseClinicopathologic feature
The invention relates to the technical field of biomedicine, in particular to a method for constructing a plasma ctDNA organ distribution characteristic spectrum of advanced colorectal cancer. The method comprises the following steps: collecting a peripheral blood sample at multiple time points, separating plasma by adopting a double-centrifugal method, and extracting circulating tumor DNA (Deoxyribose Nucleic Acid); carrying out whole exome sequencing based on ctDNA to obtain genome variation information and calculating variation allele frequency, and synchronously detecting the expression quantity of immune-related proteins by adopting an Olink proteomics technology; integrating the genome data, the protein expression data and the clinical pathological features, and constructing a multi-dimensional feature data matrix; and taking the organ metastasis condition confirmed by iconography as a supervision label, training a model by applying a machine learning algorithm, screening key prediction factors, constructing a quantitative prediction model, and finally generating a visual organ metastasis tendency prediction map. According to the method, early and accurate prediction of the advanced colorectal cancer organ metastasis tendency is realized through multi-omics data collaborative analysis and machine learning modeling.
Owner:CHINESE PEOPLES ARMED POLICE FORCE CHARACTERISTIC MEDICAL CENT

Polyethylene glycol derivative-collagen injectable cartilage repair gel as well as preparation method and application thereof

The invention provides a polyethylene glycol derivative-collagen cartilage repair gel which is characterized by being prepared from the following components in parts by weight: 8 to 12 parts of collagen (namely COL) solution, 0.5 to 2 parts of polydeoxyribonucleotide (namely PDRN), 4 to 8 parts of polyethylene glycol disuccinimide succinate (namely SS-PEG-SS) solution and 0.1 to 0.4 part of tannic acid (namely TA), and particularly discloses a preparation method and application of the polyethylene glycol derivative-collagen cartilage repair gel. In a word, the composite gel and the collagen are subjected to efficient amidation reaction through SS-PEG-SS to form a stable three-dimensional network, so that the structural support of the type I collagen, the tissue repair of PDRN and the anti-inflammatory and anti-oxidation characteristics of tannic acid are successfully integrated; therefore, the composite material has the comprehensive performance of good structural stability, high mechanical strength, good biocompatibility, controllable degradation period, excellent needle passing performance and the like, and shows the wide application prospects of clear repair effect, remarkable component synergistic effect, mature production process, outstanding cost effectiveness and the like.
Owner:BEIJING UNIV OF CHEM TECH

Extraction of polydeoxyribonucleotide as well as preparation and application of PDRN-Ce microsphere cluster

The invention discloses extraction of polydeoxyribonucleotide as well as preparation and application of a PDRN-Ce (Polydeoxyribonucleotide-Ce) microsphere cluster. The extraction and purification method comprises the following steps: mixing in-vitro fish testis tissues with water, carrying out crushing treatment and homogenization treatment on an obtained premix, carrying out proteolysis and solid-liquid separation, and collecting supernate to obtain enzymatic hydrolysate; wherein protease used for proteolysis comprises neutral protease; carrying out alcohol precipitation on the enzymatic hydrolysate by adopting an alcohol solvent, and collecting a precipitate; and dissolving the precipitate in water, desalting and drying. According to the extraction method, the purity and the yield of the poly-deoxyribonucleotide are remarkably improved, the preparation method is low in cost and convenient to operate, the prepared poly-deoxyribonucleotide is stable in property, small in molecular weight and easy to absorb by skin, in order to further improve the bioavailability of the extracted poly-deoxyribonucleotide, the PDRN-Ce microsphere cluster is prepared, and the PDRN-Ce microsphere cluster can be used for preparing the poly-deoxyribonucleotide. Good application prospects are realized.
Owner:BEIJING TECH & BUSINESS UNIV

Molecular marker closely linked with wheat powdery mildew resistance gene PmCWI16926 and application of molecular marker

The invention discloses a molecular marker closely linked with a wheat powdery mildew resistance gene PmCWI16926. The molecular marker is YTU2BS-P12, and the molecular marker is a molecular marker PmCWI16926. The nucleotide sequence of an upstream primer of the molecular marker is as shown in SEQ ID NO: 1; the nucleotide sequence of the downstream primer is as shown in SEQ ID NO: 2; the molecular marker is used for carrying out PCR (Polymerase Chain Reaction) amplification on to-be-detected wheat genome DNA (Deoxyribose Nucleic Acid) to obtain a corresponding amplification product with the molecular weight According to the molecular marker YTU2BS-P12 closely linked with the wheat powdery mildew resistance gene PmCWI16926, provided by the invention, a genetic mapping group of the PmCWI16926 can be more efficiently detected, and map-based cloning of the PmCWI16926 is facilitated; when the marker is used for molecular marker-assisted selection of PmCWI16926, the breeding period can be shortened, the breeding efficiency can be improved, and the marker can be better applied to wheat breeding for disease resistance.
Owner:YANTAI UNIV

Preparation method and application of high-activity raw material for extracting salmon salmon sperm polydeoxyribonucleotide PDRN (DNA sodium)

PendingCN121221448ACosmetic preparationsSugar derivativesIchthyobodo salmonisAnimal science
The invention provides a preparation method and application of a high-activity salmon salmon sperm PDRN (DNA sodium) raw material. The preparation method comprises the following steps: crushing and freezing a salmon testis at an ultralow temperature, adding a mixed solution of a Tris-HCl buffer solution and sodium chloride, and dispersing at a low temperature; adding a compound enzyme preparation with the total enzyme activity of more than or equal to 350KU / L, and carrying out low-temperature appropriate pH enzymolysis; and adjusting the pH value to a suitable range, and carrying out frequency conversion ultrasonic and high-pressure homogenization alternate synergistic treatment in an ice-water bath to obtain the DNA fragmentation liquid, so that the defects of low PDRN activity retention rate, insufficient purity and high protein residue in the prior art are overcome.
Owner:TIANJIN SAIMENG BIOTECHNOLOGY CO LTD +2

Repair compositions and uses thereof

The invention provides a repairing composition and application thereof. The repairing composition at least comprises the following components: (1) polydeoxyribonucleotide; (2) gamma-polyglutamic acid or a salt thereof; and (3) hyaluronic acid or salts thereof, and the three components of polydeoxyribonucleotide, gamma-polyglutamic acid or salts thereof and hyaluronic acid or salts thereof in the repairing composition are compounded to achieve a synergistic effect, so that the repairing composition is beneficial to improving skin sensitivity, repairing skin barriers, stimulating collagen regeneration and the like.
Owner:BLOOMAGE BIOTECHNOLOGY CORP LTD

Genetically engineered bacterium for producing polydeoxyribonucleotide as well as construction method and application of genetically engineered bacterium

The invention provides a genetically engineered bacterium for producing polydeoxyribonucleotide as well as a construction method and application of the genetically engineered bacterium. The genetically engineered bacterium comprises kluyveromyces marxianus for expressing a salmon DNA polymerase I gene. According to the invention, the edible probiotic Kluyveromyces marxianus is transformed through genetic engineering, efficient, safe and controllable production of PDRN is realized, the biological activity of PDRN is equivalent to that of PDRN from a natural source, and large-scale production and application of PDRN are facilitated.
Owner:SHANGHAI JIAXIN BIOTECHNOLOGY CO LTD

Polydeoxyribonucleotide self-assembled supramolecular nanoparticle composition, preparation method and application thereof, and cosmetics

The invention relates to a poly (deoxyribonucleotide) self-assembled supramolecular nanoparticle composition, a preparation method and application thereof and cosmetics, the poly (deoxyribonucleotide) self-assembled supramolecular nanoparticle composition comprises PDRN and mussel protein, and the mass ratio of the PDRN to the mussel protein is 1: (0.05-10). The PDRN-mussel protein self-assembled supramolecular nano-particles have the beneficial effects that the PDRN-mussel protein self-assembled supramolecular nano-particles are prepared by utilizing the inherent charge properties of PDRN and mussel protein, so that the microscopic sizes of the PDRN and mussel protein are compressed, the transdermal absorption of the PDRN and mussel protein is greatly improved by utilizing the properties of the nano-particles, and a synergistic repairing effect is shown.
Owner:SHANGHAI HUARUI WANMEI BIOTECHNOLOGY CO LTD +1

Polydeoxyribonucleotide salt as well as preparation method and application thereof

The invention discloses a poly-deoxyribonucleotide salt and a preparation method and application thereof, the content of the poly-deoxyribonucleotide salt is greater than 95%, the protein content is less than 1.0%, and after high-pressure moist heat sterilization, the dynamic viscosity reduction amount does not exceed 25%, and the elastic index G'reduction amount does not exceed 30%. The polydeoxyribonucleotide salt disclosed by the invention is simple in preparation process, short in production period, low in cost and suitable for large-scale industrial production; and the preparation process is mild, few impurities are introduced, the product structure is less damaged, and the preparation method is environment-friendly. The polydeoxyribonucleotide salt disclosed by the invention has good physical support performance, has the effects of promoting skin cell repair, resisting skin sensitivity, whitening, resisting inflammation, preventing alopecia and growing hair, and has a wide market prospect.
Owner:BLOOMAGE BIOTECHNOLOGY CORP LTD

Efficient detection technology for double CRISPR (clustered regularly interspaced short palindromic repeats) coupled isothermal amplification

The invention discloses a double-CRISPR (clustered regularly interspaced short palindromic repeats) coupled isothermal amplification efficient detection technology, and a double-CRISPR coupled isothermal amplification reagent provided by the invention comprises a pair of efficient Cas12a variant-guide RNA (Ribonucleic Acid) complexes, an isothermal amplification system, bovine serum albumin, a fluorescence resonance energy transfer single-stranded DNA (Deoxyribose Nucleic Acid) probe, a reaction buffer solution and target nucleic acid to be detected, the double CRISPR coupling isothermal amplification detection technology disclosed by the invention has the remarkable advantages of high reaction speed, high signal-to-noise ratio, high sensitivity and strong specificity, can efficiently detect low-copy or low-quality target nucleic acid, and can be combined with a 3D printing chip to realize reagent freeze-drying and simultaneous detection of multiple types of target nucleic acid; the method shows a great application prospect, and particularly has a great potential in detection of bacteria deployed on site.
Owner:SOUTHEAST UNIV

Primer and method for quantitatively monitoring biomass of sargassum hemiphyllum based on environmental DNA (Deoxyribose Nucleic Acid) technology

The invention discloses a primer and a method for quantitatively monitoring the biomass of sargassum hemiphyllum based on an environmental DNA technology, and belongs to the technical field of molecular ecology. The primer probe group comprises an upstream primer, a downstream primer and a fluorescent probe which are specifically targeted to the sargassum hemiphyllum mitochondria COX1 gene, and the sequence is shown as SEQ ID NO.1-3. The kit comprises the primer probe group, a qPCR (quantitative polymerase chain reaction) premixed solution, nuclease-free water and a sargassum hemiphyllum plasmid positive control. The method comprises the following steps: collecting a water sample, enriching eDNA, performing qPCR detection by using the primer probe group after extraction and purification, and realizing qualitative detection and quantitative evaluation of sargassum hemiphyllum through a Cq value or a standard curve. The method disclosed by the invention has the advantages of high sensitivity, strong specificity, no damage to the environment and target organisms, capability of realizing large-scale rapid general survey and the like, and is suitable for early warning of gulfweed blooms, investigation of population distribution and evaluation of ecological influence.
Owner:SOUTH CHINA SEA INST OF OCEANOLOGY CHINESE ACAD OF SCI

Extraction and detection method of host cell residual DNA (Deoxyribose Nucleic Acid)

The invention provides a lysis binding solution, an extraction kit and a detection method for extracting residual DNA of host cells, the lysis binding solution comprises guanidine hydrochloride, PEG6000, tRNA, glycogen and isopropanol, the concentration of guanidine hydrochloride is 2.0-2.5 M, the concentration of PEG6000 is 1%-10% (m / v), and the concentration of isopropanol is 50-60%. According to the present invention, the host cell residual DNA extraction is performed by using the lysis binding liquid, such that the compatibility between the reagent and different sample types can be significantly enhanced, the sample pre-dilution is reduced, and the matrix interference is reduced so as to improve the extraction efficiency and the extraction accuracy of the residual DNA, and effectively overcome the limitation of the commercial kit.
Owner:YANTAI PATRONUS BIOTECH CO LTD +1

Recombinant III-type collagen and PDRN compound composition and preparation method thereof

The invention discloses a recombinant III-type collagen and PDRN compound composition and a preparation method thereof, and relates to the technical field of biological medicines. The composition is formed by compounding recombinant human III type collagen and polydeoxyribonucleotide according to the mass ratio of 1: 10-10: 1, the weight-average molecular weight of the recombinant human III type collagen and the weight-average molecular weight of the polydeoxyribonucleotide are 50-100 kDa, the ratio can generate synergistic interaction, fibroblast proliferation, migration and collagen secretion are remarkably promoted, and the activity of the composition is superior to that of a single component and commercially available products. The composition can be used for preparing medical instruments, cosmetics or water-light injections for skin repair, rejuvenation or skin improvement. The invention also provides a water-light injection containing the compound composition, and the obtained preparation is stable, clear, transparent, safe and non-irritant.
Owner:JIANGSU TIANPING PHARM CO LTD

Artificial non-coding RNA (Ribonucleic Acid) molecule, DNA (Deoxyribose Nucleic Acid) molecule, biological material and application of artificial non-coding RNA molecule, DNA molecule and biological material in improving carbon and nitrogen metabolism capability of

The invention provides an artificial non-coding RNA (Ribonucleic Acid) molecule, a DNA (Deoxyribose Nucleic Acid) molecule, a biological material and application of the artificial non-coding RNA molecule, the DNA molecule and the biological material in improving the carbon and nitrogen metabolism capability of rhizobium, and belongs to the technical field of genetic engineering, the nucleotide sequence of the artificial non-coding RNA molecule is as shown in SEQ ID NO.1, and the nucleotide sequence of the DNA molecule transcribing the artificial non-coding RNA molecule is as shown in SEQ ID NO.2; the invention also provides a recombinant vector and recombinant rhizobium with efficient carbon and nitrogen metabolism capability. According to the artificial non-coding RNA molecule and the recombinant expression vector constructed by using the RNA molecule, the utilization capacity of malic acid of the rhizobium can be remarkably improved, then the symbiotic nitrogen fixation capacity of the rhizobium is enhanced, the rhizobium and leguminous crops are symbiotic, and the yield and quality of the leguminous crops can be remarkably improved.
Owner:THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI

DNA methylation label-free fluorescence detection method, reagent composition and application

The invention belongs to the technical field of gene detection, and particularly relates to a DNA methylation label-free fluorescence detection method, a reagent composition and application. The method comprises the following steps: cracking target DNA (Deoxyribose Nucleic Acid) by adopting GLaI endonuclease, and carrying out GLaI endonuclease reaction to obtain a digestion product; carrying out a double-cascade chain displacement amplification reaction on the obtained digestion product to obtain a double-cascade chain displacement amplification reaction product; carrying out CRISPR / Cas12a reaction on the obtained double-cascade chain displacement amplification reaction product, so as to obtain a CRISPR / Cas12a reaction product; in the CRISPR / Cas12a reaction, a G triplex is used as a signal source; and adding a fluorescent reaction reagent into the CRISPR / Cas12a reaction product, and measuring the fluorescence intensity of the CRISPR / Cas12a reaction product to obtain a methylation detection result of the target DNA. The detection method has the characteristics of low cost, universality, high sensitivity, high accuracy, good selectivity and the like.
Owner:SOUTHWEST UNIV

A molecular marker tightly linked to the light green trait of ripe pepper fruit and its application

The present invention discloses a molecular marker tightly linked to the light green trait of green ripe pepper fruit and its application. The present invention provides the application of a substance for detecting whether the deoxyribonucleotide at position 174795925 on chromosome 10 in the pepper genome is A, G, or both A and G for the following purposes: identifying the color trait of green ripe pepper fruit; identifying the depth of the peel color of green ripe pepper fruit. The dCAPS10-1 marker developed by the present invention had a phenotypic matching rate of 95.92% in the constructed F2 population. In addition, the marker dCAPS10-1 was used to perform genotyping on 126 pepper materials with known green ripe fruit colors stored in the laboratory. The results showed that the success rate of verification of the 126 inbred line materials using the dCAPS10-1 marker was 76.20%, of which the phenotypic matching rate was 79.37% for 63 materials with light green green ripe fruit and 73.00% for 63 materials with green green ripe fruit, indicating that this marker has strong applicability and can be used for rapid identification of green ripe fruit color in practical breeding applications.
Owner:CHINA AGRI UNIV

Bo-white peony root self-incompatible strain screening method and application of identification primer in screening

The invention discloses a method for screening self-incompatible strains of Bo-white peony roots. The method is characterized by comprising the following steps: step 1, extracting genome DNA (Deoxyribonucleic Acid) of Bo-white peony roots; 2, carrying out a PCR amplification reaction; an identification primer is composed of 5 'ACTGGTGGAACGCAGGAAAA3'and 5' TCAAGTGTCACCTTCCTGC3 ', and an identification primer is composed of 5' ACTGGTGGAACGCAGGAAAA3 'and 5' A PCR reaction system is carried out in a centrifugal tube, the reaction system comprises a PCR buffer solution, magnesium dichloride, deoxyribonucleoside triphosphate, an identification primer, high-fidelity Taq DNA polymerase, a template and sterile ultrapure water, the centrifugal tube is placed in a PCR instrument, and PCR reaction parameters are set; 3, analyzing a PCR amplification product, and judging whether the Bo-white paeony root plant is a self-incompatible strain or not according to the characteristics of the product; the method is simple, reliable and efficient, and samples can be screened from the molecular level in the seedling stage. Meanwhile, the invention discloses application of the identification primer in screening of self-incompatible strains of Bo-white peony roots.
Owner:BOZHOU VOCATIONAL & TECHNICAL COLLEGE +2

Method for purifying single-stranded DNA and application thereof

The invention belongs to the technical field of bioengineering, and particularly relates to a method for purifying single-stranded DNA and application thereof. The invention provides a method for purifying single-stranded DNA (deoxyribonucleic acid). The method comprises the following steps: S1, carrying out polymerization reaction on a primer of which the 5'end is modified with an acrylamide group to generate a linear polyacrylamide modified primer LPA-primer; s2, by taking the LPA-primer as a primer, carrying out PCR (Polymerase Chain Reaction) amplification, so as to obtain a double-stranded DNA (Deoxyribose Nucleic Acid) NALPA-dsDNA (Deoxyribose Nucleic Acid) crosslinked by polyacrylamide; s3, carrying out denatured agarose gel electrophoresis on the LPA-dsDNA under an alkaline condition, and separating a target ssDNA from a non-target ssDNA by utilizing a mobility difference caused by a polyacrylamide modified group; and S4, carrying out gel cutting and recycling on the target ssDNA strip to obtain the purified ssDNA. The result of the embodiment shows that the method can effectively improve the purity of the single-stranded DNA and reduce the cost.
Owner:HUAZHONG UNIV OF SCI & TECH

Molecular marker primer for tailed amphibian and application of molecular marker primer

The invention provides a molecular marker primer for tailed amphibians and application of the molecular marker primer. The nucleotide sequence of the primer is ISSRSEQ6; and the sequence of the gene is 5 '-AATCAATCAATCAATCAATCAATCC-3'. The primer can be used for carrying out PCR (Polymerase Chain Reaction) amplification on genome DNA (Deoxyribose Nucleic Acid) of tailed amphibians to obtain SNPs.
Owner:SHENYANG NORMAL UNIV

Application of high-sensitivity multiplex methylation detection technology

The invention provides a multiple detection technology MMDEC for high-sensitivity detection of tumor methylated DNA from samples such as blood, belongs to the field of disease diagnosis markers, and more specifically relates to a method for detecting methylation of target DNA through the following steps: constructing oligonucleotide; the kit comprises a target specific multiple Rooptag primer capable of being complementarily combined with a plurality of tumor specific high-methylated CG island target DNAs (Deoxyribose Nucleic Acid) and a universal tag primer combined with the specific multiple Rooptag primer, wherein the target specific multiple Rooptag primer can be complementarily combined with a plurality of tumor specific high-methylated CG island target DNAs (Deoxyribose Nucleic Acid); the method comprises the following steps: performing exponential amplification on multiple methylation target DNA by using a specific multiple Rooptag primer as a primary primer to obtain a multiple amplification product; performing homogeneity amplification on the obtained multiplex amplification primer by using oligonucleotide (which can be complementarily combined with the linearly amplified target DNA) using a universal tag primer as a secondary primer; and detecting whether an amplification product exists or not through a probe. According to the method disclosed by the invention, MMDEC can be used for early screening and diagnosis of plasma / urine sample tumors, accords with clinical practice on the basis of research results, and has a good clinical application prospect.
Owner:SUZHOU ANWEI BIOTECHNOLOGY CO LTD

Method for distinguishing Clematis palustris from other Clematis plants and application of Clematis palustris and other Clematis plants

The invention discloses a method for distinguishing clematis palustris from other clematis plants and application of the method. The method for distinguishing the clematis from the other clematis plants comprises the following steps: detecting whether the genotype of 201st deoxyribonucleotide in a sequence 1 of a plant to be detected is an AA genotype or a CC genotype by adopting a primer pair consisting of a single-stranded DNA (Deoxyribonucleic Acid) shown in a sequence 2 and a single-stranded DNA shown in a sequence 3; the to-be-detected plant is clematis hispida; if the genotype of the plant to be detected is AA genotype, the plant to be detected is other clematis plants. Experiments prove that the method provided by the invention can be used for effectively distinguishing the clematis palustris from other 14 clematis plants, and an important tool is provided for quickly and accurately identifying the clematis palustris in the seedling stage.
Owner:BEIJING ACAD OF LANDSCAPING & LANDSCAPING SCI

Method for analyzing and identifying inter-well connectivity based on microbial genome DNA

PendingCN121993147ADetermine connectivityRealize full life cycle dynamic monitoringSurveyMicrobiological testing/measurementDynamic monitoringOil production
The invention belongs to the technical field of dynamic monitoring of oil production engineering, and particularly relates to a method for analyzing and identifying inter-well connectivity based on microbial genome DNA (Deoxyribose Nucleic Acid). Comprising the following steps: acquiring liquid samples of a producing well and a water injection well and rock debris samples of a new drilled well in the same area and the same stratum as the producing well; carrying out microbial genome DNA analysis on the obtained sample to obtain dominant strain compositions of the oil producing well, the water injection well and the newly-drilled well; comparing the number of the dominant strains shared by the producing well and the water injection well and the number of the dominant strains shared by the producing well and the new drilling well, and judging the connectivity of the producing well and the water injection well according to a comparison result. The invention provides a novel inter-well connectivity identification method, which can effectively solve the problems that the water breakthrough direction of an oil production well is complicated and is difficult to identify clearly due to the influence of dominant channels, natural fractures, water injection dynamic fractures and other factors on a water injection development oil reservoir.
Owner:PETROCHINA CO LTD

Sperm genome methylation detection method for evaluating safety of biological breeding crops by using primates and application of sperm genome methylation detection method

PendingCN121992108ASystematic assessment of potential impactsEfficiently assess transgenerational epigenetic effectsMicrobiological testing/measurementProteomicsBiotechnologyPrimate
The invention discloses a sperm genome methylation detection method for safety evaluation of biological breeding crops by using primates and application, and relates to the technical field of safety evaluation of crops, the sperm genome methylation detection method comprises the following steps: dividing non-human primates into three groups, collecting sperms after long-term feeding, and extracting DNA (Deoxyribose Nucleic Acid); carrying out whole genome sequencing and quality control after bisulfite treatment; the epigenetic safety of crops is comprehensively evaluated by analyzing the methylation level of a whole genome and a functional region and functional enrichment of a differential methylation region and related genes thereof; according to the sperm genome methylation detection method for evaluating the safety of the biologically bred crops by utilizing the primates and the application, by utilizing a high-resolution WGBS technology, subtle epigenetic changes which are difficult to find by traditional toxicology can be detected, and the sperm genome methylation detection method has important significance in cross-generation reproduction effect evaluation, and has a wide application prospect. A food safety evaluation system can be perfected, and a more scientific and reliable safety interpretation basis can be established.
Owner:INST OF MEDICAL BIOLOGY CHINESE ACAD OF MEDICAL SCI

Drug-resistant gene targeted enrichment method using dCas9 and application of drug-resistant gene targeted enrichment method

The invention relates to a drug-resistant gene targeted enrichment method using dCas9 and application of the drug-resistant gene targeted enrichment method, and belongs to the technical field of nucleic acid enrichment. The drug-resistant gene targeted enrichment method comprises a CRISPR-dCas9 system for targeting a target gene and a target capture magnetic bead matched with the CRISPR-dCas9 system; the CRISPR-dCas9 system comprises a target DNA (Deoxyribose Nucleic Acid), a dCas9 protein and a target nucleic acid targeted sgRNA (Single Guide Ribonucleic Acid), and the targeted capture magnetic bead is a His tag protein purified agarose magnetic bead. According to the method, a CRISPR-dCas9 system and His tag protein are integrated to purify agarose magnetic beads, and dCas9 protein with a His tag is combined with the magnetic beads to construct a novel enrichment scheme; his magnetic beads are combined with dCas9 with a His tag under the condition that protein denaturation is not achieved, and drug-resistant gene targeted enrichment is achieved; the whole scheme is easy to operate, mild in condition, low in cost and suitable for common laboratories and on-site rapid detection to improve sensitivity. According to the method, the target gene is highly specifically recognized through sgRNA, magnetic bead capture is combined, and the method has the advantages of being efficient, specific and easy to operate and has application value in the fields of drug-resistant gene screening and diagnosis, third-generation sequencing and the like.
Owner:ACADEMY OF MILITARY MEDICAL SCIENCES

Method for screening candidate genes and SNP (Single Nucleotide Polymorphism) sites related to residual feed intake of Sahu hybrid sheep

The invention provides a method for screening candidate genes and SNP (Single Nucleotide Polymorphism) loci related to residual feed intake of Sahu hybrid sheep, which is characterized by comprising the following steps: S1, collecting jugular vein blood samples of the Sahu hybrid sheep, and extracting genomic DNA (Deoxyribose Nucleic Acid) of the blood samples for quality detection; the method comprises the following steps: S1, extracting DNA, S2, carrying out whole genome re-sequencing on the extracted DNA and carrying out genotyping to obtain SNP genotype data, and S3, carrying out reference genome comparison, SNP detection and genotype quality control. And S4, carrying out whole genome association analysis on the residual feed intake character of the Sahu hybrid sheep to obtain a significant SNP site. The nucleotide sequence of the SNP site obviously related to the residual feed intake of the Sahu hybrid sheep, which is obtained by the method provided by the invention, is as shown in SEQ ID NO.1, the basic group R at the 51st site of the sequence is A or G, the gene mutation causes the nucleotide of the sequence to generate polymorphism, and when the marker is mutated into G, the Sahu hybrid sheep shows lower residual feed intake.
Owner:LANZHOU UNIV

Application of alspiramycin and / or imiquimod in preparation of medicine for treating VACV

The invention relates to the technical field of medicines, in particular to application of aspiramycin and / or imiquimod in preparation of a medicine for treating VACV. Aspiramycin and imiquimod which are screened from medicines on the market have antiviral activity, and experimental data show that the Aspiramycin and the imiquimod have anti-VACV medicine activity. Aspiramycin and imiquimod (especially combined application) are used for preparing the medicine for treating VACV, so that the time and cost of preclinical research can be greatly reduced. As the action mechanism of the pox viruses is not unique to the VACV, the combined strategy has the potential to be expanded to infection treatment of other pox viruses (such as monkey pox virus MPXV) and even other DNA (Deoxyribose Nucleic Acid) viruses.
Owner:HUNAN UNIV

Hydrogel for repairing osteoarthritis as well as preparation method and application of hydrogel

The invention discloses hydrogel for repairing osteoarthritis as well as a preparation method and application of the hydrogel, and relates to the technical field of biological medicines. The hydrogel is prepared from polydeoxyribonucleotide and polyglutamic acid, the hydrogel has a porous structure, and the average pore size is 50-200 [mu] m. The preparation method comprises the following steps: mixing a PDRN solution with a PGA solution, then adding a cross-linking agent solution, uniformly stirring and mixing, and standing for reaction to form the hydrogel. The mechanical strength of the hydrogel can be improved after PDRN and PGA are crosslinked, meanwhile, PDRN can be slowly released in the hydrogel, the anti-inflammatory effect is achieved, and the obvious treatment effect on osteoarthritis is achieved.
Owner:SHANDONG ACADEMY OF PHARMACEUTICAL SCIENCES