378 results about "Deoxyribose" patented technology

The invention relates to bionic matrix hydrogel for constructing bone organs and a preparation method of the bionic matrix hydrogel. The bionic matrix hydrogel is prepared from a bone acellular extracellular matrix, a salmon DNA (Deoxyribose Nucleic Acid) network and a calcium phosphate oligomer under the combination of photo-crosslinking and self-assembly physical crosslinking. The acellular extracellular matrix in the bionic matrix hydrogel can simulate organic components in natural bones, the calcium phosphate oligomer can simulate inorganic components in the natural bones, and sufficient phosphate ions can be provided for biomineralization due to introduction of a DNA network. The biomimetic matrix hydrogel can replace Matrigel to act in bone organoid culture, provide a living environment similar to bone tissue for three-dimensional culture cells, enhance substance exchange and signal transduction between cells, promote proliferation, adhesion and osteogenic differentiation of bone marrow mesenchymal stem cells, and further accelerate the process of biomineralization. The invention provides an optional new material for preparing the functional bone organ.

The invention discloses a molecular marker closely linked with a wheat powdery mildew resistance gene PmL424. The molecular marker is YTU024-L10; the nucleotide sequence of an upstream primer of the molecular marker is as shown in SEQ ID NO: 1; the nucleotide sequence of the downstream primer is as shown in SEQ ID NO: 2; a marker primer of the molecular marker YTU024-L10 is used for carrying out PCR (Polymerase Chain Reaction) amplification on wheat genome DNA (Deoxyribose Nucleic Acid) to be detected to obtain a corresponding amplification product with the molecular weight of 238 bp, namely the molecular marker closely linked with the wheat powdery mildew resistance gene PmL424. The molecular marker provided by the invention can more accurately and efficiently detect a genetic mapping population of PmL424, and map-based cloning and fine positioning of PmL424 are facilitated; and secondly, the marker is used for molecular marker-assisted selection of PmL424, so that the wheat breeding cycle can be shortened, and the breeding efficiency can be improved.

The invention belongs to the technical field of gene engineering, and particularly relates to PDRN, a gene engineering vector, a cell, a preparation method and application thereof. The polydeoxyribonucleotide (PDRN) provided by the invention comprises a nucleotide sequence as shown in SEQ ID NO. 1; 1 or a partial fragment containing a nucleotide sequence shown in SEQ ID NO. 1; 1 or a sequence having 80% or more of homology with the nucleotide sequence as shown in SEQ ID NO. 1. The PDRN provided by the invention can effectively reduce and inhibit the expression level of inflammatory factors TNF-alpha and IL-6 and increase the wound healing rate of HUVEC cells, and is concentration-dependent. The PDRN provided by the invention has a good application prospect in preparation of anti-inflammatory or healing-promoting products.

The invention relates to a single nucleotide polymorphism (SNP) primer of a DSTN gene related to musk ketone content in natural musk and application of the single nucleotide polymorphism (SNP) primer, and belongs to the technical field of biological detection. The invention provides a single nucleotide polymorphism (SNP) primer of a DSTN gene related to the musk ketone content in natural musk, a molecular marker corresponding to the SNP primer is located at a 682371th basic group of a chromosome 23 of a forest musk deer reference genome, the basic group is mutated into A or C, the genotypes are AA and AC, and deoxyribonucleotide sequences of the SNP primer are shown as SEQ ID NO: 1 and SEQ ID NO: 2. According to a breeding target, by eliminating A / A genotype individuals and retaining A / C genotype individuals, the method has the beneficial effects that the relative content character of musk ketone in musk of the forest musk deer is efficiently and quickly identified, and a scientific basis is provided for early breeding of high-quality forest musk deer. The detection method disclosed by the invention is simple and easy to operate, can be carried out in a laboratory, and can also be applied to a genome breeding technology.

The invention provides a genetically engineered bacterium for producing O-succinyl-L-homoserine as well as a construction method and application of the genetically engineered bacterium. In a chassis bacterium genome, the expression of a 2-ketoglutaric acid decarboxylase encoding gene sucA is enhanced, and the expression of a succinyl-coenzyme A synthetase encoding gene sucD is weakened, so that the supply of succinyl-coenzyme A is increased; the method comprises the following steps: increasing the NADPH (Nicotinamide Adenine Dinucleotide Phosphate) reducing capacity and ATP (Adenosine Triphosphate) energy supply of a chassis bacterium, increasing DNA (Deoxyribose Nucleic Acid) in combination with a transcription dual regulatory factor ompR to improve the stress resistance of escherichia coli under high osmotic pressure, and introducing an overexpression plasmid containing a homoserine transsuccinylase coding gene metA to construct the genetically engineered bacterium for producing O-succinyl-L-homoserine. The engineering strain obtained through a systematic metabolic engineering modification strategy can realize effective accumulation of OSH, the shake flask yield of OSH reaches 19.8 g / L, the fed-batch fermentation yield of a 5L fermentation tank reaches 110.5 g / L, the sugar-acid conversion rate reaches 52.6%, and a foundation is laid for subsequent construction of high-yield OSH engineering bacteria.

The invention relates to the technical field of biological detection, and discloses an in-situ detection method for the tissue level of a protein and phosphoinositide compound, which comprises the following steps: providing a to-be-detected tissue sample containing the protein and phosphoinositide compound; incubating the sample to be detected by using a primary antibody mixture; incubating a product obtained in the previous step by using a second antibody mixture containing a PLA probe, and reacting to obtain circular DNA (Deoxyribose Nucleic Acid); carrying out in-situ amplification by taking the circular DNA as a template; and acquiring and analyzing a signal of the detection probe. According to the method, the interaction between the protein and the phosphoinositide compound can be specifically detected in situ at the tissue level, the actual state of the protein and the phosphoinositide compound in the physiological and pathological processes of cells can be more truly reflected by the technology, and more accurate information is provided for researching the function and regulation mechanism of the protein and the phosphoinositide compound; wide application prospects are realized.

The invention relates to an SLC26A11 gene SNP (Single Nucleotide Polymorphism) primer related to androstenediol content in forest musk and application, and belongs to the technical field of biology. The invention provides an SLC26A11 gene SNP primer related to androstenediol content in moschus berezovskii, a molecular marker corresponding to the SNP primer is located at the 55966787 base of chromosome 21 of a moschus berezovskii reference genome, the base is mutated into A or G, the genotypes are AG and GG, and deoxyribonucleotide sequences of the SNP primer are shown as SEQ ID NO: 1 and SEQ ID NO: 2. The detection method disclosed by the invention is simple and easy to operate, can be carried out in a laboratory, and can also be applied to a genome breeding technology. The method has the beneficial effects that the relative content character of androstenediol in the forest musk deer can be efficiently and quickly identified, and a scientific basis is provided for early breeding of high-quality forest musk deer.

The invention belongs to the technical field of microbiological detection, and discloses a composite probe for detecting salmonella enteritidis and a preparation method. The composite probe for detecting the salmonella enteritidis comprises magnetic nanoparticles FeO, wherein the surface of the magnetic nanoparticles FeO is modified with an aptamer apt which is specifically combined with the salmonella enteritidis; the surface of the long afterglow nano particle PLNPs is modified with a DNA (Deoxyribose Nucleic Acid) sequence cDNA (Complementary Deoxyribonucleic Acid) complementary with the aptamer; the aptamer apt and the complementary DNA sequence cDNA are subjected to hybridization to form a composite probe structure FeO-SEapt (at) PLNPs-cDNA (complementary deoxyribonucleic acid). The long afterglow luminescence characteristic of PLNPs (ZnGaO: Cr) is utilized, and an excitation light source is stopped before detection, so that signal acquisition completely avoids autofluorescence of a sample matrix, background fluorescence interference is thoroughly eliminated, and the signal-to-noise ratio is remarkably improved.

The invention relates to the technical field of biomedicine, in particular to a method for constructing a plasma ctDNA organ distribution characteristic spectrum of advanced colorectal cancer. The method comprises the following steps: collecting a peripheral blood sample at multiple time points, separating plasma by adopting a double-centrifugal method, and extracting circulating tumor DNA (Deoxyribose Nucleic Acid); carrying out whole exome sequencing based on ctDNA to obtain genome variation information and calculating variation allele frequency, and synchronously detecting the expression quantity of immune-related proteins by adopting an Olink proteomics technology; integrating the genome data, the protein expression data and the clinical pathological features, and constructing a multi-dimensional feature data matrix; and taking the organ metastasis condition confirmed by iconography as a supervision label, training a model by applying a machine learning algorithm, screening key prediction factors, constructing a quantitative prediction model, and finally generating a visual organ metastasis tendency prediction map. According to the method, early and accurate prediction of the advanced colorectal cancer organ metastasis tendency is realized through multi-omics data collaborative analysis and machine learning modeling.

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker combination for constructing a hazel DNA (Deoxyribose Nucleic Acid) fingerprint spectrum and application thereof. The SNP molecular marker combination comprises 50 SNP molecular markers, can be applied to construction of the hazel plant DNA fingerprint spectrum and further applied to variety identification of hazel plants, fills the blank of the hazel plant SNP molecular markers and the hazel plant DNA fingerprint spectrum based on the SNP molecular markers, and can be used for identifying the hazel plant variety by utilizing DNA fingerprint spectrum information of different hazel varieties. The method can accurately and efficiently distinguish and identify the germplasm resources of the hazel plants, and is of great significance to development and protection of the germplasm resources of the hazel plants.

The invention provides a polyethylene glycol derivative-collagen cartilage repair gel which is characterized by being prepared from the following components in parts by weight: 8 to 12 parts of collagen (namely COL) solution, 0.5 to 2 parts of polydeoxyribonucleotide (namely PDRN), 4 to 8 parts of polyethylene glycol disuccinimide succinate (namely SS-PEG-SS) solution and 0.1 to 0.4 part of tannic acid (namely TA), and particularly discloses a preparation method and application of the polyethylene glycol derivative-collagen cartilage repair gel. In a word, the composite gel and the collagen are subjected to efficient amidation reaction through SS-PEG-SS to form a stable three-dimensional network, so that the structural support of the type I collagen, the tissue repair of PDRN and the anti-inflammatory and anti-oxidation characteristics of tannic acid are successfully integrated; therefore, the composite material has the comprehensive performance of good structural stability, high mechanical strength, good biocompatibility, controllable degradation period, excellent needle passing performance and the like, and shows the wide application prospects of clear repair effect, remarkable component synergistic effect, mature production process, outstanding cost effectiveness and the like.

The invention discloses extraction of polydeoxyribonucleotide as well as preparation and application of a PDRN-Ce (Polydeoxyribonucleotide-Ce) microsphere cluster. The extraction and purification method comprises the following steps: mixing in-vitro fish testis tissues with water, carrying out crushing treatment and homogenization treatment on an obtained premix, carrying out proteolysis and solid-liquid separation, and collecting supernate to obtain enzymatic hydrolysate; wherein protease used for proteolysis comprises neutral protease; carrying out alcohol precipitation on the enzymatic hydrolysate by adopting an alcohol solvent, and collecting a precipitate; and dissolving the precipitate in water, desalting and drying. According to the extraction method, the purity and the yield of the poly-deoxyribonucleotide are remarkably improved, the preparation method is low in cost and convenient to operate, the prepared poly-deoxyribonucleotide is stable in property, small in molecular weight and easy to absorb by skin, in order to further improve the bioavailability of the extracted poly-deoxyribonucleotide, the PDRN-Ce microsphere cluster is prepared, and the PDRN-Ce microsphere cluster can be used for preparing the poly-deoxyribonucleotide. Good application prospects are realized.

The invention discloses a molecular marker closely linked with a wheat powdery mildew resistance gene PmCWI16926. The molecular marker is YTU2BS-P12, and the molecular marker is a molecular marker PmCWI16926. The nucleotide sequence of an upstream primer of the molecular marker is as shown in SEQ ID NO: 1; the nucleotide sequence of the downstream primer is as shown in SEQ ID NO: 2; the molecular marker is used for carrying out PCR (Polymerase Chain Reaction) amplification on to-be-detected wheat genome DNA (Deoxyribose Nucleic Acid) to obtain a corresponding amplification product with the molecular weight According to the molecular marker YTU2BS-P12 closely linked with the wheat powdery mildew resistance gene PmCWI16926, provided by the invention, a genetic mapping group of the PmCWI16926 can be more efficiently detected, and map-based cloning of the PmCWI16926 is facilitated; when the marker is used for molecular marker-assisted selection of PmCWI16926, the breeding period can be shortened, the breeding efficiency can be improved, and the marker can be better applied to wheat breeding for disease resistance.

The invention provides a preparation method and application of a high-activity salmon salmon sperm PDRN (DNA sodium) raw material. The preparation method comprises the following steps: crushing and freezing a salmon testis at an ultralow temperature, adding a mixed solution of a Tris-HCl buffer solution and sodium chloride, and dispersing at a low temperature; adding a compound enzyme preparation with the total enzyme activity of more than or equal to 350KU / L, and carrying out low-temperature appropriate pH enzymolysis; and adjusting the pH value to a suitable range, and carrying out frequency conversion ultrasonic and high-pressure homogenization alternate synergistic treatment in an ice-water bath to obtain the DNA fragmentation liquid, so that the defects of low PDRN activity retention rate, insufficient purity and high protein residue in the prior art are overcome.

The invention provides a repairing composition and application thereof. The repairing composition at least comprises the following components: (1) polydeoxyribonucleotide; (2) gamma-polyglutamic acid or a salt thereof; and (3) hyaluronic acid or salts thereof, and the three components of polydeoxyribonucleotide, gamma-polyglutamic acid or salts thereof and hyaluronic acid or salts thereof in the repairing composition are compounded to achieve a synergistic effect, so that the repairing composition is beneficial to improving skin sensitivity, repairing skin barriers, stimulating collagen regeneration and the like.

The invention provides a genetically engineered bacterium for producing polydeoxyribonucleotide as well as a construction method and application of the genetically engineered bacterium. The genetically engineered bacterium comprises kluyveromyces marxianus for expressing a salmon DNA polymerase I gene. According to the invention, the edible probiotic Kluyveromyces marxianus is transformed through genetic engineering, efficient, safe and controllable production of PDRN is realized, the biological activity of PDRN is equivalent to that of PDRN from a natural source, and large-scale production and application of PDRN are facilitated.

The invention relates to a poly (deoxyribonucleotide) self-assembled supramolecular nanoparticle composition, a preparation method and application thereof and cosmetics, the poly (deoxyribonucleotide) self-assembled supramolecular nanoparticle composition comprises PDRN and mussel protein, and the mass ratio of the PDRN to the mussel protein is 1: (0.05-10). The PDRN-mussel protein self-assembled supramolecular nano-particles have the beneficial effects that the PDRN-mussel protein self-assembled supramolecular nano-particles are prepared by utilizing the inherent charge properties of PDRN and mussel protein, so that the microscopic sizes of the PDRN and mussel protein are compressed, the transdermal absorption of the PDRN and mussel protein is greatly improved by utilizing the properties of the nano-particles, and a synergistic repairing effect is shown.

The invention belongs to the technical field of genes, and particularly relates to an amplification primer group of a renal cyst disease gene PKD1, a mutation detection method and application, the amplification primer group comprises four pairs of primers for specifically amplifying first to 34 exons of the PKD1 gene; the mutation detection method comprises the following steps: acquiring genome DNA (Deoxyribose Nucleic Acid); carrying out ultra-long fragment PCR amplification on the genome DNA through the primers, carrying out electrophoresis detection, and purifying a target fragment; mixing the purified amplification product with genome DNA in proportion, constructing a sequencing library, and performing high-throughput sequencing through target area capture; and analyzing sequencing data, and screening pathogenic PKD1 gene mutation. Compared with the prior art, the PKD1 ultra-long fragment PCR amplification primer and the renal cyst disease gene PKD1 mutation detection method have the advantages that true and false genes of PKD1 can be distinguished, the diagnosis accuracy is greatly improved, the operation process is simplified, the timeliness is improved, and the detection flux is improved.

The invention discloses a poly-deoxyribonucleotide salt and a preparation method and application thereof, the content of the poly-deoxyribonucleotide salt is greater than 95%, the protein content is less than 1.0%, and after high-pressure moist heat sterilization, the dynamic viscosity reduction amount does not exceed 25%, and the elastic index G'reduction amount does not exceed 30%. The polydeoxyribonucleotide salt disclosed by the invention is simple in preparation process, short in production period, low in cost and suitable for large-scale industrial production; and the preparation process is mild, few impurities are introduced, the product structure is less damaged, and the preparation method is environment-friendly. The polydeoxyribonucleotide salt disclosed by the invention has good physical support performance, has the effects of promoting skin cell repair, resisting skin sensitivity, whitening, resisting inflammation, preventing alopecia and growing hair, and has a wide market prospect.

The invention discloses a double-CRISPR (clustered regularly interspaced short palindromic repeats) coupled isothermal amplification efficient detection technology, and a double-CRISPR coupled isothermal amplification reagent provided by the invention comprises a pair of efficient Cas12a variant-guide RNA (Ribonucleic Acid) complexes, an isothermal amplification system, bovine serum albumin, a fluorescence resonance energy transfer single-stranded DNA (Deoxyribose Nucleic Acid) probe, a reaction buffer solution and target nucleic acid to be detected, the double CRISPR coupling isothermal amplification detection technology disclosed by the invention has the remarkable advantages of high reaction speed, high signal-to-noise ratio, high sensitivity and strong specificity, can efficiently detect low-copy or low-quality target nucleic acid, and can be combined with a 3D printing chip to realize reagent freeze-drying and simultaneous detection of multiple types of target nucleic acid; the method shows a great application prospect, and particularly has a great potential in detection of bacteria deployed on site.

The invention discloses a primer and a method for quantitatively monitoring the biomass of sargassum hemiphyllum based on an environmental DNA technology, and belongs to the technical field of molecular ecology. The primer probe group comprises an upstream primer, a downstream primer and a fluorescent probe which are specifically targeted to the sargassum hemiphyllum mitochondria COX1 gene, and the sequence is shown as SEQ ID NO.1-3. The kit comprises the primer probe group, a qPCR (quantitative polymerase chain reaction) premixed solution, nuclease-free water and a sargassum hemiphyllum plasmid positive control. The method comprises the following steps: collecting a water sample, enriching eDNA, performing qPCR detection by using the primer probe group after extraction and purification, and realizing qualitative detection and quantitative evaluation of sargassum hemiphyllum through a Cq value or a standard curve. The method disclosed by the invention has the advantages of high sensitivity, strong specificity, no damage to the environment and target organisms, capability of realizing large-scale rapid general survey and the like, and is suitable for early warning of gulfweed blooms, investigation of population distribution and evaluation of ecological influence.

The invention discloses a terahertz metasurface biosensor which is modified by a single-stranded DNA (deoxyribonucleic acid) nucleic acid aptamer and is used for specifically detecting a tumor necrosis factor-alpha. Under the simulation condition, the surface of the biosensor is covered with a layer of analyte with the thickness of 20 microns, and when the refractive index of the analyte is changed from n = 1 to n = 2, the theoretical sensitivity of the metasurface biosensor can reach 124.71 GHz / RIU. In an experiment, the metasurface is prepared on a copper-plated polyethylene glycol terephthalate sheet by using photoetching and chemical corrosion processes. Then, according to the characteristic that the nucleic acid aptamer is specifically combined with the tumor necrosis factor-alpha, the nucleic acid aptamer is modified on the surface of the sensor, so that the super-surface biological immunosensor is prepared, the concentration detection of the tumor necrosis factor-alpha is realized, the detection limit reaches 0.1 ng / ml, and the detection sensitivity can reach 13.9 GHz / 1g (ng / ml). Besides, ovalbumin and whey protein with the same concentration are compared and detected, and the result shows that only the tumor necrosis factor-alpha can be obviously distinguished, so that the sensor has a specific detection function. The terahertz metasurface immunosensor provided by the invention realizes the specific detection of the tumor necrosis factor-alpha. The work can be used for biomarker detection and early diagnosis of diseases.

The invention provides a lysis binding solution, an extraction kit and a detection method for extracting residual DNA of host cells, the lysis binding solution comprises guanidine hydrochloride, PEG6000, tRNA, glycogen and isopropanol, the concentration of guanidine hydrochloride is 2.0-2.5 M, the concentration of PEG6000 is 1%-10% (m / v), and the concentration of isopropanol is 50-60%. According to the present invention, the host cell residual DNA extraction is performed by using the lysis binding liquid, such that the compatibility between the reagent and different sample types can be significantly enhanced, the sample pre-dilution is reduced, and the matrix interference is reduced so as to improve the extraction efficiency and the extraction accuracy of the residual DNA, and effectively overcome the limitation of the commercial kit.

The invention relates to the technical field of DNA (Deoxyribose Nucleic Acid) detection, in particular to a triple fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection kit for simultaneously detecting equine encephalomyelitis viruses, a detection method and application. According to the invention, oriental equine encephalomyelitis, western equine encephalomyelitis and Venezuela equine encephalomyelitis viruses can be simultaneously and specifically detected in one reaction, and the sensitivity is as low as about 10 <-8 >.

The invention discloses a recombinant III-type collagen and PDRN compound composition and a preparation method thereof, and relates to the technical field of biological medicines. The composition is formed by compounding recombinant human III type collagen and polydeoxyribonucleotide according to the mass ratio of 1: 10-10: 1, the weight-average molecular weight of the recombinant human III type collagen and the weight-average molecular weight of the polydeoxyribonucleotide are 50-100 kDa, the ratio can generate synergistic interaction, fibroblast proliferation, migration and collagen secretion are remarkably promoted, and the activity of the composition is superior to that of a single component and commercially available products. The composition can be used for preparing medical instruments, cosmetics or water-light injections for skin repair, rejuvenation or skin improvement. The invention also provides a water-light injection containing the compound composition, and the obtained preparation is stable, clear, transparent, safe and non-irritant.

The invention provides an artificial non-coding RNA (Ribonucleic Acid) molecule, a DNA (Deoxyribose Nucleic Acid) molecule, a biological material and application of the artificial non-coding RNA molecule, the DNA molecule and the biological material in improving the carbon and nitrogen metabolism capability of rhizobium, and belongs to the technical field of genetic engineering, the nucleotide sequence of the artificial non-coding RNA molecule is as shown in SEQ ID NO.1, and the nucleotide sequence of the DNA molecule transcribing the artificial non-coding RNA molecule is as shown in SEQ ID NO.2; the invention also provides a recombinant vector and recombinant rhizobium with efficient carbon and nitrogen metabolism capability. According to the artificial non-coding RNA molecule and the recombinant expression vector constructed by using the RNA molecule, the utilization capacity of malic acid of the rhizobium can be remarkably improved, then the symbiotic nitrogen fixation capacity of the rhizobium is enhanced, the rhizobium and leguminous crops are symbiotic, and the yield and quality of the leguminous crops can be remarkably improved.

The invention belongs to the technical field of gene detection, and particularly relates to a DNA methylation label-free fluorescence detection method, a reagent composition and application. The method comprises the following steps: cracking target DNA (Deoxyribose Nucleic Acid) by adopting GLaI endonuclease, and carrying out GLaI endonuclease reaction to obtain a digestion product; carrying out a double-cascade chain displacement amplification reaction on the obtained digestion product to obtain a double-cascade chain displacement amplification reaction product; carrying out CRISPR / Cas12a reaction on the obtained double-cascade chain displacement amplification reaction product, so as to obtain a CRISPR / Cas12a reaction product; in the CRISPR / Cas12a reaction, a G triplex is used as a signal source; and adding a fluorescent reaction reagent into the CRISPR / Cas12a reaction product, and measuring the fluorescence intensity of the CRISPR / Cas12a reaction product to obtain a methylation detection result of the target DNA. The detection method has the characteristics of low cost, universality, high sensitivity, high accuracy, good selectivity and the like.

The present invention discloses a molecular marker tightly linked to the light green trait of green ripe pepper fruit and its application. The present invention provides the application of a substance for detecting whether the deoxyribonucleotide at position 174795925 on chromosome 10 in the pepper genome is A, G, or both A and G for the following purposes: identifying the color trait of green ripe pepper fruit; identifying the depth of the peel color of green ripe pepper fruit. The dCAPS10-1 marker developed by the present invention had a phenotypic matching rate of 95.92% in the constructed F2 population. In addition, the marker dCAPS10-1 was used to perform genotyping on 126 pepper materials with known green ripe fruit colors stored in the laboratory. The results showed that the success rate of verification of the 126 inbred line materials using the dCAPS10-1 marker was 76.20%, of which the phenotypic matching rate was 79.37% for 63 materials with light green green ripe fruit and 73.00% for 63 materials with green green ripe fruit, indicating that this marker has strong applicability and can be used for rapid identification of green ripe fruit color in practical breeding applications.

The invention discloses a method for screening self-incompatible strains of Bo-white peony roots. The method is characterized by comprising the following steps: step 1, extracting genome DNA (Deoxyribonucleic Acid) of Bo-white peony roots; 2, carrying out a PCR amplification reaction; an identification primer is composed of 5 'ACTGGTGGAACGCAGGAAAA3'and 5' TCAAGTGTCACCTTCCTGC3 ', and an identification primer is composed of 5' ACTGGTGGAACGCAGGAAAA3 'and 5' A PCR reaction system is carried out in a centrifugal tube, the reaction system comprises a PCR buffer solution, magnesium dichloride, deoxyribonucleoside triphosphate, an identification primer, high-fidelity Taq DNA polymerase, a template and sterile ultrapure water, the centrifugal tube is placed in a PCR instrument, and PCR reaction parameters are set; 3, analyzing a PCR amplification product, and judging whether the Bo-white paeony root plant is a self-incompatible strain or not according to the characteristics of the product; the method is simple, reliable and efficient, and samples can be screened from the molecular level in the seedling stage. Meanwhile, the invention discloses application of the identification primer in screening of self-incompatible strains of Bo-white peony roots.