Gene-specific molecular marker Pi2SNP of rice blast-resistant gene Pi2 as well as preparation method and application thereof

A resistance gene and molecular marker technology, applied in the field of agricultural biology, can solve the problem of mis-selection or missed selection in resistance breeding work, and achieve low-cost effects.

Active Publication Date: 2013-09-25
PLANT PROTECTION RES INST OF GUANGDONG ACADEMY OF AGRI SCI
View PDF1 Cites 28 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these markers are located on the flanks of the resistance gene Pi2, and there is a certain physical distance from the target gene. Therefore, there is a risk of exchange with the target gene during meiosis, and misselection is prone to occur in resistance breeding. or omission

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene-specific molecular marker Pi2SNP of rice blast-resistant gene Pi2 as well as preparation method and application thereof
  • Gene-specific molecular marker Pi2SNP of rice blast-resistant gene Pi2 as well as preparation method and application thereof
  • Gene-specific molecular marker Pi2SNP of rice blast-resistant gene Pi2 as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1: Rice blast resistance gene Pi2 gene-specific molecular marker and its primer design and detection

[0041] (1) Analysis of Pi2-specific single base difference (SNP) sites:

[0042] Using multiple sequence alignment software tools, the nucleotide sequences of the coding regions of Pi2, Piz-t, and Pi9 (Genebank accession numbers: DQ352453, DQ352040, and DQ285630) that have been published have been compared to screen Pi2-specific, The specific single base (SNP) difference site that can be distinguished from other rice blast allelic resistance genes at this site. The multiple sequence results of rice blast resistance genes Pi2, Pi9, and Piz-t with gene-specific SNPs are as follows:

[0043] Pst I Hinf I

[0044] Pi2: CCTCCAATCTCTCCATGTGGATG CTGC A TC TCAG;

[0045] Pi9: CCTCCAATCTCTCTATGTGAATGCTGCGTTATTATCAG;

[0046] Piz-t: CCTCCAATCTCTCCATGTGGATGCTGTGTTATTCTCAG;

[0047] Among them, the nucleotides shown in bold italics are...

Embodiment 2

[0081] Example 2: Application of resistance gene Pi2 gene-specific molecular markers in identifying different rice blast resistance genes in the Pi2 / 9 gene cluster region.

[0082] According to the polymorphic PCR product bands, the target gene Pi2 can be distinguished from the resistance genes on other Pi2 / 9 gene clusters. Such as figure 1 As shown, according to the position of the band, Pi2 can be distinguished from other resistance genes identified at this site. The size of the nucleotide fragment after PstI digestion is 406bp or the size of the nucleotide fragment after Hinf I digestion is 235bp Indicates that the Pi2 gene is contained, and the size of the nucleotide fragment after PstI digestion is not 406bp or the size of the Hinf I digestion nucleotide fragment is not 235bp, which means that the Pi2 gene is not contained. It can be seen that the test results are consistent with the design analysis, indicating that the resistance gene Pi2 gene-specific molecular marker...

Embodiment 3

[0083] Example 3: Detection and application of resistance gene Pi2 gene-specific molecular markers in other rice varieties in South China

[0084] Select 13 important rice varieties in South China, in order: Zhenshan 97B, Gufeng B, Wufeng B, Tianfeng B, Xieqingzao B, Digu B, Fuyi B, Guanghui 880, Batai Xiangzhan, Huahang Simiao, Kangbaixiangzhan, Fengbazhan, and Maba Yinzhan.

[0085] Zhenshan 97B has been disclosed in the literature "Li Daopin et al., Comparative study on the seed production yield of Zhenshan 97B improved new male sterile line and Zhenshan 97A. Hybrid rice, 2012 Issue 03, pp. 28-29";

[0086] Gu Feng B and Fu Yi B have been published in the literature "Huang Lixing et al., Classical genetic analysis of resistance genes of rice blast-resistant rice parents. Journal of Fujian Agriculture and Forestry University (Natural Science Edition), 2011, 03, pp. 225-230 "Disclosed in;

[0087] Wufeng B has been disclosed in the document "Liang Shihu et al., Breeding of ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene-specific molecular marker Pi2SNP of a rice blast-resistant gene Pi2 as well as a preparation method and application thereof. The molecular marker Pi2SNP is a nucleotide fragment II in a specific banding pattern with the rice blast-resistant gene Pi2 obtained by amplifying F1 and R1 from the total DNA (Deoxyribose Nucleic Acid) of the rice blast-resistant variety carrying rice blast-resistant gene Pi2 by use of a primer to obtain a nucleotide fragment I and then performing enzyme digestion of the nucleotide fragment I by use of restriction endonuclease Pst I or Hinf I. The molecular marker is the first Pi2 gene-specific SNP marker developed for the sequence in the Pi2 gene, and has the advantages of high specificity and low cost and high flux in practical application, and can be widely applied to the colonies with different inheritance backgrounds. By adopting the molecular marker, the utilization efficiency of the gene in molecular marker-assisted selective breeding, gene pyramiding breeding and transgenic breeding can be improved.

Description

technical field [0001] The invention relates to the field of agricultural biotechnology, in particular to the field of rice blast technology, in particular to a rice blast resistance gene Pi2 gene-specific molecular marker Pi2SNP and its preparation and application. Background technique [0002] Rice is one of the most important food crops in the world, and more than half of the population uses rice as a staple food. Rice blast caused by Magnapothe oryzae is one of the most serious diseases to rice production, causing serious grain loss every year. From the point of view of environmental protection and agricultural sustainable development, breeding and utilizing disease-resistant varieties is the safest and most effective way to control rice blast. In addition, due to the frequent pathogenic variation of rice blast physiological races, the resistance of single-resistant varieties will gradually lose within 3 to 5 years after planting (Yin Desuo et al. 2011). Spectrum resis...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12N15/10C12Q1/68
Inventor华丽霞苏菁朱小源陈深曾列先汪文娟汪聪颖杨健源
OwnerPLANT PROTECTION RES INST OF GUANGDONG ACADEMY OF AGRI SCI