Gene-specific molecular marker Pi2SNP of rice blast-resistant gene Pi2 as well as preparation method and application thereof
A resistance gene and molecular marker technology, applied in the field of agricultural biology, can solve the problem of mis-selection or missed selection in resistance breeding work, and achieve low-cost effects.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Example 1: Rice blast resistance gene Pi2 gene-specific molecular marker and its primer design and detection
[0041] (1) Analysis of Pi2-specific single base difference (SNP) sites:
[0042] Using multiple sequence alignment software tools, the nucleotide sequences of the coding regions of Pi2, Piz-t, and Pi9 (Genebank accession numbers: DQ352453, DQ352040, and DQ285630) that have been published have been compared to screen Pi2-specific, The specific single base (SNP) difference site that can be distinguished from other rice blast allelic resistance genes at this site. The multiple sequence results of rice blast resistance genes Pi2, Pi9, and Piz-t with gene-specific SNPs are as follows:
[0043] Pst I Hinf I
[0044] Pi2: CCTCCAATCTCTCCATGTGGATG CTGC A TC TCAG;
[0045] Pi9: CCTCCAATCTCTCTATGTGAATGCTGCGTTATTATCAG;
[0046] Piz-t: CCTCCAATCTCTCCATGTGGATGCTGTGTTATTCTCAG;
[0047] Among them, the nucleotides shown in bold italics are...
Embodiment 2
[0081] Example 2: Application of resistance gene Pi2 gene-specific molecular markers in identifying different rice blast resistance genes in the Pi2 / 9 gene cluster region.
[0082] According to the polymorphic PCR product bands, the target gene Pi2 can be distinguished from the resistance genes on other Pi2 / 9 gene clusters. Such as figure 1 As shown, according to the position of the band, Pi2 can be distinguished from other resistance genes identified at this site. The size of the nucleotide fragment after PstI digestion is 406bp or the size of the nucleotide fragment after Hinf I digestion is 235bp Indicates that the Pi2 gene is contained, and the size of the nucleotide fragment after PstI digestion is not 406bp or the size of the Hinf I digestion nucleotide fragment is not 235bp, which means that the Pi2 gene is not contained. It can be seen that the test results are consistent with the design analysis, indicating that the resistance gene Pi2 gene-specific molecular marker...
Embodiment 3
[0083] Example 3: Detection and application of resistance gene Pi2 gene-specific molecular markers in other rice varieties in South China
[0084] Select 13 important rice varieties in South China, in order: Zhenshan 97B, Gufeng B, Wufeng B, Tianfeng B, Xieqingzao B, Digu B, Fuyi B, Guanghui 880, Batai Xiangzhan, Huahang Simiao, Kangbaixiangzhan, Fengbazhan, and Maba Yinzhan.
[0085] Zhenshan 97B has been disclosed in the literature "Li Daopin et al., Comparative study on the seed production yield of Zhenshan 97B improved new male sterile line and Zhenshan 97A. Hybrid rice, 2012 Issue 03, pp. 28-29";
[0086] Gu Feng B and Fu Yi B have been published in the literature "Huang Lixing et al., Classical genetic analysis of resistance genes of rice blast-resistant rice parents. Journal of Fujian Agriculture and Forestry University (Natural Science Edition), 2011, 03, pp. 225-230 "Disclosed in;
[0087] Wufeng B has been disclosed in the document "Liang Shihu et al., Breeding of ...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com