Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

TaqMan probe real-time fluorescence PCR (Polymerase Chain Reaction) method for detecting HLA (Human Leukocyte Antigen)-B*5801 alleles

An HLA-B and allele technology, applied in the allele field, can solve the problems of difficult primer-probe combination, low detection throughput, complicated operation, etc., and achieve the effect of saving experimental time and consumables, high sensitivity, and improving sensitivity.

Active Publication Date: 2014-12-24
SHANXI LIFEGEN
View PDF5 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, it is very difficult to design a primer-probe combination suitable for the high-specificity amplification of the HLA-B*5801 gene in the fluorescent quantitative PCR reaction.
[0007] At present, domestic detection technologies for HLA‐B*5801 are mainly based on PCR‐SSP and fluorescent PCR. Among them, the currently available fluorescent PCR method patents and related kits basically use multiple probes, multi-tube The methods for detection at the same time, because these methods are multi-tube reactions, compared with the technology of the present invention, they generally have the disadvantages of low detection flux, cumbersome operation, and high cost.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • TaqMan probe real-time fluorescence PCR (Polymerase Chain Reaction) method for detecting HLA (Human Leukocyte Antigen)-B*5801 alleles
  • TaqMan probe real-time fluorescence PCR (Polymerase Chain Reaction) method for detecting HLA (Human Leukocyte Antigen)-B*5801 alleles
  • TaqMan probe real-time fluorescence PCR (Polymerase Chain Reaction) method for detecting HLA (Human Leukocyte Antigen)-B*5801 alleles

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1 Detection of HLA‐B*5801 alleles by TaqMan probe method

[0045] 1. DNA sample extraction and dilution

[0046] After collecting venous blood in vacuum blood collection tubes anticoagulated with ethylenediaminetetraacetic acid (EDTA) according to conventional methods, DNA was extracted using the QIAamp DNA Mini Blood Kit (Qiagen, Germany) kit; the extracted DNA was concentrated using NanoDrop 2000 Determination (A 260 / 280 =1.95~2.15). Using the above method, respectively measure the concentration of 104 cases of Bouyei DNA samples, and then use PCR grade H 2 O Dilute the sample to 10 ng / μL.

[0047] 2. Design primers and probes

[0048] In the area where the polymorphic sites are concentrated, use the ARMS method to design specific primers for HLA‐B*5801, the upstream primer F: 5'‐GGGCCGGAGTATTGGGATG‐3', the downstream primer R: 5'‐TTGGCCTCAACTGAAAATGAAAC‐3', and matching Fluorescent probe probe: 5'‐HEX‐TCAGGGAGGCGGATCTCGGAC–BHQ2‐3'; In addition, internal ...

Embodiment 2

[0055] Example 2 Sensitivity detection of HLA-B*5801 genotype-specific primers

[0056] 1. Dilution of DNA samples

[0057] Take HLA‐B*5801 standard DNA as the test sample, and its concentration is 10ng / μL. with PCR grade H 2 O 5-fold serially diluted samples, namely 1:5, 1:25, 1:125, 1:625; the DNA concentrations were: 10ng / μL, 2ng / μL, 0.4ng / μL, 0.08ng / μL.

[0058] 2. Design primers and probes

[0059] In the area where the polymorphic sites are concentrated, use the ARMS method to design specific primers for HLA‐B*5801, the upstream primer F: 5'‐GGGCCGGAGTATTGGGATG‐3', the downstream primer R: 5'‐TTGGCCTCAACTGAAAATGAAAC‐3', and matching Fluorescent probe probe: 5'‐HEX‐TCAGGGAGGCGGATCTCGGAC–BHQ2‐3'; In addition, internal reference primers were designed on the β‐actin gene, upstream primer Actin‐F: 5'‐CAGCAGATGTGGATCAGCAAG‐3', downstream primer Actin‐R: 5 '‐GCATTTGCGGTGGACGAT‐3', and the matching fluorescent probe probe: 5'‐FAM‐AGGAGTATGACGAGTCCGGCCCC–BHQ2‐3'.

[0060] Am...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer probe assembly for high-specificity amplification HLA (Human Leukocyte Antigen)-B*5801 alleles on the basis of a TaqMan probe detection method. The primer probe assembly comprises an upstream primer Fp: 5'-AGGGGCCGGAGTATTGGGATG-3', a downstream primer Rp: 5'-TTGGCCTCAACTGAAAATGAAAC-3' and a probe: 5'-HEX-TCAGGGAGGCGGATCTCGGAC-BHQ2-3'. Primers and probes of reference genes ACTB are used simultaneously, target genes and the reference genes are added into a tube for dual-channel fluorescent quantitative PCR reaction, and a result is analyzed through an amplification curve. The method has the characteristics of simplicity, convenience, flexibility, quickness, high specificity, high flux, zero pollution, high resolution and the like, and is applicable to detection of the HLA-B*5801 alleles of a whole-genome DNA (Deoxyribonucleic Acid) sample in the peripheral blood and the saliva of a human body.

Description

technical field [0001] The invention belongs to the fields of pharmacogenomics and gene diagnosis, and in particular relates to a method for detecting HLA‐B*5801 alleles. Background technique [0002] Allopurinol is an isomer of hypoxanthine and an inhibitor of xanthine oxidase (XO), which can prevent the metabolism of hypoxanthine and xanthine into uric acid, thereby reducing the production of uric acid. Drugs that synthesize uric acid. It is mainly used clinically for the treatment of hyperuricemia and gout. However, with the large-scale application of medicines, its adverse reactions have become increasingly prominent, and it is one of the medicines most likely to cause severe drug eruptions. The adverse reactions of allopurinol mainly manifest as skin and mucous membrane damage, the most common one is exfoliative dermatitis, and the more serious ones include Stevens-Johnson syndrome, toxic epidermal necrolysis, systemic diseases (eosinophilia , vasculitis, and disease...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6858C12Q1/6876C12Q2561/101
Inventor 康星王会娟陈融刘金辉戴鹏高李斌陈超
Owner SHANXI LIFEGEN
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com