TaqMan probe real-time fluorescence PCR (Polymerase Chain Reaction) method for detecting HLA (Human Leukocyte Antigen)-B*5801 alleles
An HLA-B and allele technology, applied in the allele field, can solve the problems of difficult primer-probe combination, low detection throughput, complicated operation, etc., and achieve the effect of saving experimental time and consumables, high sensitivity, and improving sensitivity.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] Example 1 Detection of HLA‐B*5801 alleles by TaqMan probe method
[0045] 1. DNA sample extraction and dilution
[0046] After collecting venous blood in vacuum blood collection tubes anticoagulated with ethylenediaminetetraacetic acid (EDTA) according to conventional methods, DNA was extracted using the QIAamp DNA Mini Blood Kit (Qiagen, Germany) kit; the extracted DNA was concentrated using NanoDrop 2000 Determination (A 260 / 280 =1.95~2.15). Using the above method, respectively measure the concentration of 104 cases of Bouyei DNA samples, and then use PCR grade H 2 O Dilute the sample to 10 ng / μL.
[0047] 2. Design primers and probes
[0048] In the area where the polymorphic sites are concentrated, use the ARMS method to design specific primers for HLA‐B*5801, the upstream primer F: 5'‐GGGCCGGAGTATTGGGATG‐3', the downstream primer R: 5'‐TTGGCCTCAACTGAAAATGAAAC‐3', and matching Fluorescent probe probe: 5'‐HEX‐TCAGGGAGGCGGATCTCGGAC–BHQ2‐3'; In addition, internal ...
Embodiment 2
[0055] Example 2 Sensitivity detection of HLA-B*5801 genotype-specific primers
[0056] 1. Dilution of DNA samples
[0057] Take HLA‐B*5801 standard DNA as the test sample, and its concentration is 10ng / μL. with PCR grade H 2 O 5-fold serially diluted samples, namely 1:5, 1:25, 1:125, 1:625; the DNA concentrations were: 10ng / μL, 2ng / μL, 0.4ng / μL, 0.08ng / μL.
[0058] 2. Design primers and probes
[0059] In the area where the polymorphic sites are concentrated, use the ARMS method to design specific primers for HLA‐B*5801, the upstream primer F: 5'‐GGGCCGGAGTATTGGGATG‐3', the downstream primer R: 5'‐TTGGCCTCAACTGAAAATGAAAC‐3', and matching Fluorescent probe probe: 5'‐HEX‐TCAGGGAGGCGGATCTCGGAC–BHQ2‐3'; In addition, internal reference primers were designed on the β‐actin gene, upstream primer Actin‐F: 5'‐CAGCAGATGTGGATCAGCAAG‐3', downstream primer Actin‐R: 5 '‐GCATTTGCGGTGGACGAT‐3', and the matching fluorescent probe probe: 5'‐FAM‐AGGAGTATGACGAGTCCGGCCCC–BHQ2‐3'.
[0060] Am...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 