1207 results about "Biological materials" patented technology

The invention belongs to the field of biological materials, and particularly relates to recombinant V-type humanized collagen and application thereof. The invention provides a recombinant V-type humanized collagen, the amino acid sequence of the recombinant V-type humanized collagen comprises (repetitive unit) n, and the repetitive unit comprises a sequence as shown in SEQ ID NO.1; each repeating unit is directly linked and the number n of repeating units is 10. The recombinant V-type humanized collagen can comprehensively resist skin aging.

The invention relates to the technical field of synthetic biology, in particular to recombinant XVII type collagen as well as a preparation method and application thereof.The amino acid sequence of the recombinant XVII type collagen comprises a sequence shown in any one of SEQ ID NO.1-SEQ ID NO.3. The recombinant XVII type collagen can be highly expressed in an escherichia coli and pichia pastoris system, the expression system is simple, the cost is low, and the recombinant XVII type collagen is suitable for industrial production. The yield is high; the biological activity is good. The protein can be compounded with other proteins to form raw materials of tissue engineering products, cosmetics, health care products or medicines, so that the protein can be widely applied to the fields of medicines, medical instruments, biological materials, tissue engineering, cosmetics and the like.

Microparticles for detecting biological materials are provided. Each of the microparticles includes: a core-shell structured microparticle consisting of a core including a magnetically responsive metal and a shell layer surrounding the core and having a uniform thickness; and capture probes introduced onto the shell layer to capture biological materials.

The invention discloses an injectable material for promoting bone regeneration through piezoelectric and conductive integrated nanofiber hydrogel with ultrasonic response and a preparation method of the injectable material. The injectable material is composed of piezoelectric and conductive nanofibers and hydrogel. Wherein the piezoelectric conductive nanofiber is prepared from an inorganic piezoelectric material and a piezoelectric polymer through electrostatic spinning, or is prepared from an inorganic / organic composite piezoelectric material and a biological material with conductive performance through electrostatic spinning.

The invention provides glycosaminoglycan hydrogel with a physical and chemical double crosslinking mechanism as well as a preparation method and application thereof, and relates to the technical field of biological materials. The glycosaminoglycan hydrogel is prepared from the following raw materials: oxidized sodium hyaluronate, chondroitin sulfate, epsilon-polylysine hydrochloride, a polydopamine-titanium dioxide compound and a stabilizer. The glycosaminoglycan hydrogel is prepared through a physical and chemical double-crosslinking mechanism under the specific raw materials and proportion, the problems of cytotoxicity and the like caused by use of a crosslinking agent or introduction of other solvents are avoided, a stable covalent network is constructed through chemical crosslinking, the gel is endowed with the self-repairing characteristic through physical crosslinking, and the self-repairing performance of the hydrogel is improved. And the viscosity of the product is remarkably improved, so that the hydrogel has stronger mechanical support performance, is suitable for wound repair, wound healing and the like, and has good antibacterial activity and stability.

The invention belongs to the technical field of biological materials, and particularly relates to nano composite hydrogel as well as a preparation method and application thereof. In the preparation process of the hydrogel, preparation of gelatin hydrazide and preparation of pullulan oxidation are sequentially completed, then preparation of active component loaded PLGA nanoparticles and self-assembly coating with metal-polyphenol are completed, and finally, the metal-polyphenol coated PLGA nanoparticles are mixed with gelatin hydrazide and pullulan oxidation to form gel in situ. The hydrogel has the characteristics of injectability, self-healing, wet adhesion and the like, the metal-polyphenol layer has the effects of resisting inflammation, resisting oxidation and promoting angiogenesis and generates photo-thermal response to near infrared rays, on-demand controllable release of the drug-loaded nanoparticles is achieved, the composite hydrogel can improve the wound surface microenvironment, promote angiogenesis and inhibit inflammation and scar formation, and the drug-loaded nanoparticles can be applied to wound healing. The ointment is suitable for burns, scalds and various complex wounds.

The invention provides a valine production strain and a construction method and application thereof, a designed acetohydroxy acid synthase mutant is that the 88th basic group of an ilvB gene is changed from a to c, the 382nd basic group is changed from a to g, the 413th basic group is changed from c to t, the gene sequence of a designed artificial operon comprises a promoter, an ilvB (A138V) gene or ilvB (Q30K, S128G, A138V) gene of coding mutated acetohydroxy acid synthase, and an ilvN (G20D, I21D, I21D, I21D, I21D, I21D, I21D, I21D) gene. I22F) gene, a pyk gene for coding pyruvate kinase, and a terminator; by designing a specific acetohydroxyacid synthase mutant and related biological materials and artificial operon, the strain constructed by directional modification of the strain by using a pK18mobsacB system gene editing technology based on allele exchange has the advantages of good genetic stability, high fermentation yield and the like, and valine can be stably produced.

The invention belongs to the technical field of food safety detection, and discloses a preparation method of an aptamer colorimetric sensor constructed by amorphous cobalt-based nano-enzyme and detection application of the aptamer colorimetric sensor to zearalenone (ZEN) in food, and the preparation method comprises the following steps: constructing amorphous Co3O4 (at) CN / SiO2 nano-enzyme; and constructing an aptamer (Apt) colorimetric sensor to detect the ZEN. The amorphous Co-based nano material is simple in preparation process, high in catalase-like activity, easy to modify by biological materials and low in cost. The colorimetric sensor for detection is based on Co3O4 (at) CN / SiO2 nano-enzyme adsorption aptamers, the construction process is simple, the used aptamers are TCATCTATGGTACATACTATCTGTAATGTGATATG and are marked as ZEN-Apt, a detection system of the colorimetric sensor is characterized in that Co3O4 (at) CN / SiO2, ZEN-Apt and ZEN with different concentrations are incubated at a proper temperature to form a competitive reaction, and ZEN-Apt and ZEN are preferentially combined, so that the aptamers on the nano-enzyme are reduced. When the sensor constructed by the invention is used for detecting and analyzing unknown ZEN in an actual sample, the operation is convenient, the specificity is good, the sensitivity is high, the speed is high, and the repeatability and the reproducibility are good.

Systems, compositions, and methods related to injectable hydrogels are generally described. In some embodiments, a composition comprises a first polymer and a plurality of particles comprising a second polymer capable of forming a hydrogel at elevated temperatures, such as body temperature. The plurality of particles (e.g., hydrogel particles) may comprise an active substance, such as a biological material and / or a therapeutic agent. Together, the first polymer and the second polymer may interact with each other (e.g., the first polymer may interpenetrate the second polymer, and / or the first polymer may cross-link with the second polymer) at elevated temperatures to form a hydrogel. Interactions between the first and second polymer, and / or between hydrophobic domains thereof, may facilitate the relatively slow and / or controlled release of the active substance. In some embodiments, the plurality of particles may have advantageously high loadings of biological materials (e.g., antibodies, proteins, peptides).

The invention relates to the technical field of biological materials, in particular to a pillararene-based photoresponse MOF-based ion gating nanochannel and a preparation method thereof. According to the pillararene-based photoresponse MOF-based ion gating nano-channel, a bullet-shaped nano-channel is prepared by taking PET (Polyethylene Terephthalate) as a substrate, and the substrate can provide structural support; p5A-MOF-1 based on pillararene is used as a core functional layer, and the core functional layer can provide a stable cavity environment; a P5A-MOF-1 cavity is filled with an organic aromatic azo compound, so that the light response structure change is realized. And the effective volume of the P5A-MOF-1 cavity is regulated and controlled through the photoisomerization effect of the azo group, so that precise gating of ion transmission is achieved. The preparation method provided by the invention is simple and convenient to operate, mild and controllable in condition and beneficial to large-scale production.

The invention discloses a biological material disinfection method, system and equipment based on big data analysis, and relates to the technical field of disinfection. The method comprises the following steps: determining a target disinfectant; the method comprises the following steps: performing Micro-CT scanning on a biological material to construct a 3D digital model; physical attribute information of a target disinfectant and an interaction relation between the target disinfectant and the biological material are read, spatial-temporal dynamic distribution of flowing, diffusion and permeation of the target disinfectant in pore channels in the material is simulated on the basis of the 3D digital model, and flow field and concentration field optimization is carried out on internal disinfection blind areas through pulse type pressure circulation; and generating a target disinfection parameter to perform disinfection control on the biological material. The technical problems that in the prior art, disinfection is not thorough and the material structure is damaged due to insufficient adaptability of a disinfectant and a biological material are solved, and the technical effects that the adaptability between the disinfectant and the biological material is achieved, pore channels in the material are fully disinfected, and meanwhile the damage risk of the material is effectively reduced are achieved.

The invention relates to the technical field of biology, and particularly discloses application of OsDjA5 protein or a coding gene thereof to regulation and control of resistance of plants to southern rice black-streaked dwarf viruses. The research finds that after the expression quantity of the OsDjA5 gene is reduced, the resistance of rice to the southern rice black-streaked dwarf virus is enhanced. The invention further provides application of the OsDjA5 protein or the coding gene thereof, or a biological material containing the coding gene thereof in regulating and controlling the resistance of plants to the southern rice black-streaked dwarf virus. The invention provides a new method capable of improving the resistance of the plants to the southern rice black-streaked dwarf virus, and a new thought is provided for creating new varieties of disease-resistant plants.

The invention relates to the technical field of biological materials, in particular to a pH response collagen microneedle patch loaded with antibacterial nanoparticles as well as a preparation method and application of the pH response collagen microneedle patch loaded with the antibacterial nanoparticles, and the microneedle patch is prepared by loading the antibacterial nanoparticles, aldehyde modified F127 and recombinant three-type collagen COL3 on a polymer matrix. When the microneedle patch is applied to a chronic wound of a diabetic patient, the microneedle penetrates through the skin in a minimally invasive mode and directly reaches a wound focus area. Under the irradiation of 808nm near-infrared light, the mesoporous polydopamine absorbs light energy, so that the loaded lyase LysAB2 is quickly released, bacterial cell walls are specifically recognized and cracked, and bacteria are efficiently killed; meanwhile, the collagen hydrogel constructs an appropriate microenvironment at the wound, cell adhesion, proliferation and migration are promoted, and the wound healing process is accelerated. Compared with a traditional diabetes mellitus chronic bacterial infection wound treatment means, the microneedle patch provided by the invention provides an efficient and safe new strategy for treating the chronic bacterial infection wound of a diabetes mellitus patient.

The invention discloses a manganese-enriched albumin boron-containing nano preparation as well as a preparation method and application thereof, and belongs to the field of medicines and nano biological materials. According to the manganese-enriched albumin boron-containing nano preparation, albumin serves as a core carrier, phenylboronic acid derivatives are loaded through covalent or electrostatic interaction, then a manganese oxide layer is deposited on the surface in situ, and the prepared manganese-enriched albumin boron-containing nano preparation can remarkably increase the boron accumulation amount in tumor tissue; local and systemic immune response of tumors is promoted through the immune activation effect of manganese ions, so that the treatment effect of boron neutron capture therapy (BNCT) is remarkably improved. According to the invention, a phenylboronic acid derivative with tumor targeting is compounded with albumin, and manganese oxide is deposited in situ on the surface of the phenylboronic acid derivative, so that a multifunctional nano preparation with high boron delivery efficiency, immunological enhancement and magnetic resonance imaging functions is formed.

The invention relates to the technical field of synthetic biology, in particular to polypeptide with a triple helix structure, recombinant XII type humanized collagen and application of the recombinant XII type humanized collagen. The recombinant XII type humanized collagen is successfully expressed and prepared, has a triple-helix structure and good biological activity including promotion of cell proliferation activity, cell adhesion activity and inhibition of MMP-1, is used as a biological material derived from a human body, does not generate immunological rejection and anaphylactic reaction when applied to the human body, and has a good application prospect. The composition can be used for medical or non-medical application of a plurality of tissues and organs of a human body, filling, compatibilizing or repairing, and promotion of skin compactness or wrinkle resistance and other scenes.

The present invention concern a method and a device for the isolation of non-magnetic cells from a heterogeneous sample solution containing biological material including desired and undesired cells. The method comprises the steps of: —adding magnetic or magnetizable particles to the sample, wherein said particles have sizes in a range from 100 nm to 4 μm and exhibit surface components which support specific association with target cells, wherein said target cells comprise are either said desired or said undesired cells; —decreasing said external magnetic field gradient; —incubating said sample solution with said magnetic particles to obtain a magnetized cell fraction; —washing said magnetized cell fraction using a washing solution to reduce non-specific binding; —increasing said external magnetic field gradient; —separating said magnetized cell fractionation of target cells from said sample; wherein said sample solution is subjected to an external magnetic field gradient throughout said adding, incubating, washing and separating steps, and wherein said sample solution is rotated at least during said adding, incubating and washing steps.

The invention belongs to the field of microorganisms, and particularly relates to a high-efficiency denitrification heterotrophic nitrification-aerobic denitrification klebsiella and a culture method and application thereof.A biological material of the high-efficiency denitrification heterotrophic nitrification-aerobic denitrification klebsiella is named as Klebsiella oxytoca CT4 and is preserved in Guangdong Microbial Culture Collection Center (GDMCC) on July 21, 2025, the preservation number of the Klebsiella oxytoca CT4 is CGMCC NO.9687, and the preservation number of the Klebsiella oxytoca CT4 is CGMCC NO.987. The preservation address is Institute of Microbiology, Guangdong Academy of Sciences, on the fifth floor of building 59, No. 100 courtyard, Xianlie Middle Road, Guangzhou, Guangdong Province; the preservation number of the strain is GDMCCNO: 66723; according to the strain, the ammonia nitrogen removal rate can reach 98.7% through nitrification-denitrification, the nitrite accumulation amount in the whole process is lower than 0.5 mg / L, and accumulation of toxic intermediate products is avoided. The strain has wide environmental adaptability, can keep efficient denitrification activity under the conditions that the pH is 5.0-10.0 and the C / N ratio is 5-30, can tolerate fluctuation of wastewater quality, does not need to repeatedly adjust the pH value when being used for treating aquaculture wastewater with a high C / N ratio (greater than 20), and can still stabilize the total nitrogen removal rate to be 80% or above, so that the addition cost in a conventional process is remarkably reduced.

The invention belongs to the field of continuous fiber reinforced resin-based composite material layer design methods, and particularly relates to a variable-stiffness curve spiral impact-resistant composite material layer structure and an automatic laying forming method of the variable-stiffness curve spiral impact-resistant composite material layer structure. The method is inspired by a fiber microstructure of a natural spiral biological material, the design freedom degree of the material in the in-plane direction is further activated by adopting a continuous curve fiber ply configuration, the ply angle is linearly increased, and a symmetrical curve spiral ply configuration laminated plate is stacked according to the ply sequence; a three-dimensional bionic microstructure is constructed by cooperatively designing an in-plane curve fiber path and a spiral stacking sequence in the thickness direction, the impact resistance, the deformation resistance and the damage tolerance of the composite material are remarkably improved, and meanwhile, the interlayer performance can be further improved by inhibiting layering damage. The variable-stiffness curve spiral laminated plate is prepared by adopting an automatic fiber placement technology (AFP) and a hot pressing process. The invention provides a new thought for design and manufacturing of the high-performance impact-resistant composite material.

The invention discloses application of protein and related biological materials thereof in promoting accumulation of grape fruit monoterpene in the field of variation or genetic engineering. The technical problem to be solved by the invention is how to improve the monoterpene content of grape fruits. A technical scheme to be protected by the invention is application of a protein with an amino acid sequence as a sequence 2 in a sequence table in increasing the content of grape fruit monoterpenes. Experiments prove that VvHYH from grapes can promote accumulation of monoterpene substances of grape fruits and leaves, and the VvHYH can be applied to grape flavor improvement and breeding.

The invention relates to application and a method of a biological material for regulating and controlling MYB4 gene overexpression in the aspect of improving the yield of pleurotus edible fungi. The biomaterial exerts an effect of increasing the yield of a Pleurotus edible fungus by overexpressing MYB4 in the fungus. Experimental results show that the expression quantity of the MYB4 gene in the overexpression strain is remarkably higher than that of a wild strain, and the yield of the strain with the overexpression MYB4 gene during fruiting is remarkably improved compared with that of the wild strain.

The invention provides a palm vein high-security identity authentication system based on spectral analysis and deep learning, and relates to the technical field of biological recognition, the system comprises a hardware layer, a data processing layer, an algorithm layer and an application layer, through an antagonistic living body detection module in the algorithm layer, in combination with physical modeling and a GAN (Generative Adversarial Network), the high-security identity authentication of a complex imitation is realized. The method comprises the following steps: carrying out effective identification of a high-biomimetic material, carrying out physical modeling to analyze the absorption characteristics of palm veins in a hyperspectral range, such as the difference between oxyhemoglobin and oxyhemoglobin and periodic spectrum micro-interference caused by heart rate, and providing living body evidence based on physiological dynamics; meanwhile, a high-simulation template sample generated by the GAN is used for training a discriminator, the insight ability of the system to a template means is further enhanced, and compared with single traditional texture or static signal detection, the system combines physical characteristics with deep learning, and the confidence coefficient of in-vivo detection reaches up to 99.99%.

The invention belongs to the technical field of plant genetic engineering, particularly relates to application of a transcription factor CitNAC71 in regulation and control of synthesis of citrus withered water and juice sac secondary walls, and discloses application of the transcription factor CitNAC71 or a biological material for regulating and controlling expression of the transcription factor CitNAC71 in regulation and control of synthesis of citrus withered water and / or secondary walls, and the amino acid sequence of the transcription factor CitNAC71 is shown as SEQ ID NO: 1. The invention discovers that the gene expression level of the coding gene CitNAC71 of the transcription factor CitNAC71 has a significant negative correlation trend with the juice cell withering degree and the cellulose and hemicellulose content, and experiments prove that the CitNAC71 is a conservative fruit hardness regulation factor. The invention lays a theoretical foundation for preventing and controlling the occurrence of dry water before and after the harvesting of the citrus, and provides a potential target for improving the texture of the citrus fruit by a genetic engineering technology.

The disclosed invention provides a cartridge, method and cartridge processing systems for molecular tests that include extracting one or more biological materials from a tissue. The cartridge includes a base having a receptacle inside the base, a lid placed over the receptacle, and a gasket in the base. The base includes a transparent window placed under the receptacle, and the receptacle contains a slide on which the tissue is disposed. A film is disposed on an inner surface of the lid, and the film is suitable to extract the one or more biological materials from the tissue. The gasket surrounds the slide, and the lid creates a sealed chamber around the gasket that encloses the slide, and vacuum suction is applied through a port of the base to press the film against the tissue on the slide.

The invention provides recombinant III-type collagen and application thereof, and relates to the technical field of genetic engineering. According to the invention, the yield of the collagen is improved by optimizing the nucleotide sequence of the target gene and optimizing the culture conditions of pichia pastoris, so that the collagen is efficiently expressed in engineering bacteria. The recombinant engineering bacterium shows strong potential in the aspect of improving the yield of protein with high economic value, and is suitable for large-scale industrial production. The recombinant III-type collagen is high in expression quantity, simple in preparation process and suitable for preparation of biological materials for medical cosmetology, wound repair and the like, and has a wide application prospect.

The invention discloses a hydrophilic magnetic graphene material for fixing an FcRn receptor and a synthesis method, and relates to the technical field of biological materials, the method comprises the following steps: preparing graphene oxide; synthesizing Fe3O4 microspheres on the surface of the graphene oxide to obtain magnetic graphene; coating the surface of the magnetic graphene with a polydopamine layer; grafting a PAMAM (Polyamidoamine) dendritic macromolecule; and fixing the FcRn receptor to obtain the hydrophilic magnetic graphene material for fixing the FcRn receptor. The method has the advantages of large specific surface area, high protein immobilization amount and excellent extraction efficiency, and can accurately reflect the dynamic characteristics of strict pH dependent binding and dissociation of the antibody and FcRn, thereby solving the problems that the existing antibody-FcRn affinity analysis method cannot truly reflect the in-vivo dynamic characteristics and the material extraction efficiency is low.

The invention provides a near-infrared light mediated hybrid hydrogel multi-bioactivity synergistic tissue repair promoting material as well as a preparation method and application thereof, and relates to the technical field of biological materials. The method comprises the following steps: 1) dispersing calcium peroxide in a solvent, and adding a 3-hydroxytyramine hydrochloride solution for reaction to obtain CaO2 (at) PDA nanoparticles; enabling the CaO2 (at) PDA nano-particles to react with a catalase solution, so as to obtain ORN oxygen release particles; (2) mixing the ORN oxygen release particles with the surfaces rich in sulfydryl with Se-NPs with the surfaces rich in selenol after reduction treatment under the protection of inert atmosphere to obtain ORN-coated Se composite particles; the preparation method comprises the following steps: dissolving hyaluronic acid methacrylate in deionized water, adding the ORN-coated Se composite particles, uniformly mixing, adding a photoinitiator, and carrying out ultraviolet curing to obtain the ORN-coated Se-HAMA hydrogel which can realize local response oxygen supply on an anoxic wound surface and has antibacterial and antioxidant characteristics.

The invention provides application of an MsMYBS3 gene or a biological material thereof in regulation and control of plant cold resistance, and belongs to the technical field of plant genetic engineering. The amino acid sequence coded by the MsMYBS3 gene disclosed by the invention is as shown in SEQ ID NO. 4. The invention provides an application of a medicago sativa MYB transcription factor gene MsMYBS3 in the aspect of regulating and controlling the cold resistance of medicago sativa. A gene editing technology is adopted to directionally change the development and the cold resistance of the medicago sativa. The cold resistance of an MsMYBS3 gene editing strain constructed by the invention is reduced, and the MsMYBS3 gene has the effect of regulating and controlling the cold resistance of alfalfa, so that a theoretical basis and a candidate gene are provided for cultivating new varieties of high-resistance leguminous forage, and the application of alfalfa in production is promoted.

Provided is a use of a biological material in preparing a product for limiting gastric volume. The biological material is selected from a decellularized matrix, an artificial extracellular matrix and a high molecule compound. The wrapping of a remaining stomach after gastric volume reduction surgery by the biological material can effectively reduce the expansion of the gastric volume after the surgery for a long time. The gastric volume of the remaining stomach can be effectively maintained, avoiding the occurrence of weight regain caused by the expansion of the remaining stomach. The decellularized matrix and a biological material remolded tissue have the viscoelasticity equivalent to or close to natural tissue, avoiding gastric wall stiffness, and thus not affecting gastric wall peristalsis.

The invention belongs to the technical field of biological materials, and particularly relates to a long-term stable silk fibroin solution and a preparation method thereof, and the preparation method comprises the following steps: (1) dissolving a composite stabilizer in water, and uniformly mixing to obtain a stable solution; wherein the compound stabilizer comprises a micromolecular hydrogen bond chelating agent and a macromolecular steric hindrance agent; (2) freeze-drying and dissolving silk fibroin in the stabilizing solution to obtain a silk fibroin solution; and (3) sterilizing the silk fibroin solution. By utilizing the synergistic effect of the micromolecular hydrogen bond chelating agent and the macromolecular steric hindrance agent, the stabilizing effect can be adjusted according to the storage environment, and the stable silk fibroin solution can be stored at 4-7 DEG C for a long time (more than or equal to 6 months) and can be stored at room temperature for more than or equal to 3 months.