229 results about "Mgb probe" patented technology

The invention provides an amphimorphic FQ-PCR detection reagent kit for identifying African swine fever and swine fever virus wild strains. A P72 gene of ASFV and a 5'UTR noncoding region of CSFV arerespectively used as an amplification target area, a pair of specific primers and a TaqMan MGB probe (SEQ ID NO:1-6) are designed, a real-time fluorescent quantitation PCR(FQ-PCR) technique is used, and identification and detection of ASFV and CSFV are realized. The detection reagent kit provided by the invention is suitable for detecting viral nucleic acid in samples of serum, spleen, lymph nodes, tonsil, kidney and the like of suspected ASFV or CSFV infected pigs, the sensitivity can reach 1.0*10<1>copy / [mu]L, and the detection reagent kit does not have any cross reactions with other pathogens which are liable to be in mixed infection with the ASFV and the CSFV or of which the infection symptoms are similar such as PRRSV, PRV, PCV2, PPV, JEV and HPS.

The invention discloses a method for detecting gene mutation genotyping based on a Taqman-ARMS (Amplification Refractory Mutation System) technology, relating to the field of molecular biology. According to the method, an ARMS mutation enrichment technology and a Taqman-MGB (Minor Groove Binder) specificity fluorescence detection technology are combined, a mutation target sequence is subjected to specificity PCR (Polymerase Chain Reaction) amplification by using an ARMS primer, a Taqman-MGB probe is used for carrying out specificity locus detection on an amplification product, and specific mutation is identified on the basis of Real-time PCR. Compared with mutation detection technologies such as direct sequencing, chip detection and the like, the method has the advantages of strong specificity, high sensitivity, simplicity and rapidness in operation, high flux and the like when used for detecting gene mutation.

The invention discloses a human K-ras (K-rat sarcoma) gene mutation parting type fluorescent quantitation PCR (polymerase chain reaction) detecting reagent kit and a detecting method. The detecting reagent kit comprises PCR mixed reaction liquid, a peptide nucleic acid probe, a taqman-MGB (minor groove binder) probe, an inner control forward and reverse primer and probe, an external control forward and reverse primer and probe and a positive reference article, wherein the inner control forward and reverse primer and probe is used for K-ras gene mutation detection, and the external control forward and reverse primer and probe is used for the K-ras gene mutation detection. The PNA (peptide nucleic acid) technology and the taqman-MGB technology are combined, relevant ARMS (amplification refractory mutation system) primers are designed, PNA can be stably combined with wild K-ras genes 12 or 13 codon sequences, only mutation specimens can be amplified, and the K-ras gene mutation can be detected. The method has the advantages that the speed is high, simplicity and convenience are realized, the specificity is good, the sensitivity is high, and the method can be used for the clinical K-ras gene mutation screening.

The invention belongs to the field of biotechnology and clinical molecular diagnosis and in particular relates to a fluorescent genotyping detection kit and a detection method for eight human K-ras gene mutations. According to the method, an MGB (minor groove binder) probe technology is combined with a mismatch ARMS (amplification refractory mutation system) technology, an MGB probe complementary with a DNA (deoxyribonucleic acid) plus strand and an ARMS downstream primer complementary with a DNA minus strand are designed at allelic gene loci, a mismatch locus is introduced in the ARMS downstream primer, the MGB probe is overlapped with the ARMS primer by not more than 5 bp, and the eight human K-ras gene mutations are subjected to genotyping detection by four reaction pipes based on multiple fluorescent PCR (polymerase chain reaction). The method has the advantages of good specificity, high sensitivity, simplicity and quickness for operation, accuracy for genotyping, simplicity for result interpretation and the like, and can be used for detecting the clinical K-ras gene mutations and helping doctors screen the crowed with effective anti-EGFR (epidermal growth factor receptor) treatment.

The invention belongs to the technical field of biology, in particular to an HPA allelic gene typing detection reagent kit. The reagent kit of the invention comprises a primer and an MGB-probe. The reagent kit can judge the gene type of the allelic gene according to the observation of the difference of two kinds of fluorescence curves and the distribution of scattergrams after the amplification, so the HPA allelic gene typing detection can be completed. The reagent kit of the invention can meet the experiment requirement of high flux, and the whole typing experiment can be completed in two hours under the condition of the existence of proper DNA detection materials. The problem of fast systemic typing on HPA-1 to 5 and 15 on people groups in China can be solved, at the same time, the condition of homozygotes and heterozygotes can be identified, the typing results can be directly obtained, and the invention has the characteristics of flexibility, stability, accuracy and high efficiency.

The invention discloses a primer and a kit for detecting septin9 gene methylation. The primer comprises a target gene primer pair Septin9 forward primer F and an Septin9 reverse primer R. The kit comprises the primer and optimally further comprises a reference gene primer, a TaqMan-MGB probe and two Blocker primers. The kit is simple and convenient to operate, is easy to judge and is low in requirement for instruments; the whole PCR process is fully closed; the cross contamination possibility is avoided; the result is more accurate. Compared with the method of detecting by adopting PCR specific primer, the method of identifying the methylated site by utilizing the probe has higher flexibility and accuracy. Two Blocker primers are utilized to strictly control the amplification of the non-specific stripe, so that the kit has higher detection sensitivity and specificity and is especially fit for early screening of free DNA of colorectal cancer plasma.

The invention discloses a fluorescent quantitative PCR reaction fluid and a method; the fluorescent quantitative PCR reaction fluid at least includes DNA polymerase with ordinary excision enzyme activity, a basic fluorescent stabilizer, DNA polymerase enhancer and protection agent. The fluorescent quantitative PCR reaction fluid of the invention is able to obviously improve the 5'-3- excision enzyme activity of the DNA polymerase, so that the ordinary DNA polymerase can hydrolyze Taqman-MGB probe, improve the amplification efficiency and keep strong stability. The fluorescent quantitative PCR reaction fluid has stronger sensitivity in the application of Taqman-MGB probe, the effect is obviously better than that of the prior art; therefore, the fluorescent quantitative PCR reaction fluid has very wide market prospect.

The invention discloses a primer and kit for the real-time fluorescence quantification PCR detection of a wild strain TaqMan-MGB of a cattle nodular skin disease virus and a detection method. According to the method, two primers and a specific MGB probe are designed and respectively have the DNA sequences of SEQ ID NOs.1-3. The kit contains amplification reaction liquid, a positive control, a negative control and sterilized deionized water. A target sequence can be rapidly, efficiently, specifically and sensitively detected by virtue of a two-step amplification method, the operation is simpleand convenient, expensive instruments and reagents are not used, the technical requirements on operators are not required, the detection cost is low, the flux is high, and the detection period is short.

The invention discloses an EGFR (epidermal growth factor receptor) gene mutation site detection kit which detects EGFR gene mutation sites by combining the ARMS (amplification refractory mutation system) specific mutant enrichment technology with the Taqman-MGB (minor groove binder) probe specific detection technology. The kit comprises ARMS primer pairs and corresponding Taqman-MGB probes, and the ARMS primer pairs and the corresponding Taqman-MGB probes are used for detecting the EGFR gene mutation sites. The EGFR gene mutation site detection kit is high in sensitivity, capable of detecting multiple samples simultaneously and low in cost, provides guidance for pharmacy of clinicians, realizes individualized treatment of patients suffering from tumors and is capable of reducing treatment risk and burden of the patients and wide in application prospect.

The invention provides a fluorescent polymerase chain reaction (PCR) kit for detecting CYP2C19 genotypes, and belongs to the field of in-vitro nucleic acid testing. The fluorescent PCR kit comprises PCR reaction liquids for detecting CYP2C19*2 and CYP2C19*3 genotypes, Taq DNA polymerase, and uracil-DNA glycosylase, wherein the PCR reaction liquids for detecting the CYP2C19*2 and CYP2C19*3 genotypes respectively comprise PCR amplification primers, minor groove binder (MGB) probes and the like; and nucleotide sequences for detecting the CYP2C19*2 and CYP2C19*3 genotypes are shown as SEQ ID NO:3-4 and SEQ ID NO:5-6 respectively. The kit has high sensitivity and specificity, can monitor the reaction progress in real time, ensures short reaction time, avoids subsequent treatment, can avoid reaction product pollution to the greatest extent, and can replace the traditional protein detection or the common PCR detection to diagnose the CYP2C19 genotypes.

The invention discloses a method for detecting 29 respiratory pathogens by using a Taqman low-density microfluidic chip (TAC) technology. According to the method, the TAC detection technology is established for the 29 respiratory pathogens, the advantages of MGB probe detecting are fully used, the defects of previous multiple detection of the respiratory pathogens are overcome, 29-respiratory-pathogen multi-target detection of the respiratory pathogens can be achieved on a sample in two hours, and the good sensitivity and the good specificity are achieved. According to the method for detectingthe 29 respiratory pathogens by using the TAC technology, a quick, accurate and high-throughput technological mean is provided for monitoring and outbreak investigation of respiratory diseases in China.

The invention discloses a kit for detecting methylation of a lung cancer-associated gene SHOX2 (short stature homebox2). Methylated loci of target genes in a free DNA (deoxyribonucleic acid) are detected, and the kit comprises primers corresponding to three methylated target genes and an internal reference gene primer, and preferably further comprises MGB (minor groove binder) probes corresponding to methylated loci of the three target genes, an MGB probe corresponding to an internal reference gene and MGB probes corresponding to the three methylated target genes. The detection loci comprise promoter areas of the genes and coding areas of the genes, and multi-area detection is favorable for improving the methylation accuracy and specificity of the SHOX2. The methylated loci are preferably detected more accurately by specifically combining the MGB probes and a methylation sequence. The kit is convenient to operate and easy to read, and apparatus requirements are low; a complete sealing form is adopted for the whole PCR (polymerase chain reaction) process, so that the probability of cross infection is avoided, and a result is more accurate. The kit with high detection sensitivity is applied to early screening of lung cancer.

The invention provides a double FQ-PCR detection kit for identifying PCV (porcine circoviruses) type 2 and type 3. By aiming at the characteristic of low Rep protein and Cap protein gene homology of PCV2 and PCV3, a pair of specific primers and a TaqMan MGB probe (SEQ ID NO:1-6) are designed by using Rep protein gene of PCV2 and Cap protein gene of PCV3 as amplification target regions; the real-time fluorescence quantitative PCR technology is used; the identification detection of the PCV2 and the PCV3 is realized. The detection kit provided by the invention is applicable to viral nucleic aciddetection in samples such as nose swab, oral cavity secreta, faeces, serum, lungs, lymph gland and kidneys of a suspected PCV infectious pig; the sensitivity can reach 1.0*10<1> copy / mu L; the crossedreaction with other pathogene capable of generating mixed infection or with similar of infection symptoms do not exist.

The invention discloses a composition for noninvasive screening of an early lung cancer and application of the composition. The composition comprises three pairs of methylation-specific primer probes of SHOX2 (Short Stature Homebox2) genes, three pairs of methylation-specific primers of PTGER4 (Prostaglandin E Receptor 4) genes and one pair of reference gene primer probes and further comprises three MGB probes corresponding to non-methylation target genes in the SHOX2 genes and three MGB probes corresponding to the non-methylation target genes in the PTGER4 genes. A methylation detection kit for the noninvasive screening of the early lung cancer comprises the composition. Patients suffering from the early lung cancer are screened by detecting promoters of the SHOX2 genes and the PTGER4 genes of free DNA in blood of high-risk lung cancer individuals and methylation conditions of three target sites in gene coding and non-coding areas, and early diagnosis of the lung cancer is aided. The methylation-specific PCR / MSP detection method is simple and convenient in operation and low in time consumption, and the results are easily analyzed.

The invention relates to the technical field of molecular biology detection, in particular to a TaqMan-MGB fluorescent quantitative polymerase chain reaction (PCR) detection specific primer (as shown in SEQ ID No. 1 and SEQ ID No. 2), a TaqMan-MGB fluorescent quantitative PCR detection probe as shown in SEQ ID No. 3) and a TaqMan-MGB fluorescent quantitative PCR detection method for seneca valley virus (SVV). The method comprises the steps of drawing a standard curve; extracting ribonucleic acid (RNA) of a sample virus; carrying out reverse transcription on the RNA of the sample virus; enabling the product of the reverse transcription to have a TaqMan-MGB fluorescent quantitative PCR, and reading the result. The primer provided by the invention has better specificity and sensitivity; the MGB probe provided by the invention is shorter and is beneficial to probe design, and the Tm value difference between a paired template and a non-paired template is improved, so that the experimental result is more stable and accurate; the method provided by the invention has the advantages of being simple and rapid, easy to operate, visual in results, high in sensitivity, good in stability, real-time quantitative, and the like, and shortens the reaction time.

The invention discloses a probe and primer composition for rapidly detecting seven coronaviruses and other respiratory tract pathogens. A group of specific primers and the Taqman or MGB probe are designed mainly according to the specificity of N genes of OC43-CoV, NL63-CoV, 229E-CoV, HKU1-CoV, SARS-CoV, FluB and RSV, ORF1a, ORF1b and N genes of MERS-CoV, ORF1ab and N genes of 2019-nCoV, an M geneof FluA and an HEXON gene of HadV, and by utilizing a melting curve technology, CoV-OC43, HCoV-NL63, HCoV-229E, HCoV-HKU1, SARS-CoV, MERS-CoV, 2019-nCoV, FluA, FluB, HAdV and RSV are rapidly identified according to the change of the melting temperature. By means of the design, multiple pathogens can be detected in one fluorescent channel at the same time, and a relatively high sensitivity can be met.

The invention discloses a kit for investigating polymorphism of an MTHFR (Methylene Tetrahydrofolate Reductase) and / or MTRR (Methylenetetrahydrofolate Reductase) gene on the basis of a Taqman-MGB probe. The kit comprises a primer group and a probe, wherein the primer group is at least one selected from the following three groups: primers of SEQ ID NO.1 and SEQ ID NO.4 for an MTHFR gene at a C677Tsite, primers of SEQ ID NO.7 and SEQ ID NO.10 for an MTRR gene at an A1298C site, primers of SEQ ID NO.13 and SEQ ID NO.14 for an MTRR gene at an A66G site, primers of SEQ ID NO.22 and SEQ ID NO.19, primers of SEQ ID NO.29 and SEQ ID NO.15, and primers of SEQ ID NO.33 and SEQ ID NO.30. The kit disclosed by the invention has the advantages that three mutation sites can be detected simultaneously, high sensitivity is achieved, plasma as low as 10copies can be accurately detected, and oral cavity swabs which are too long in preservation time or relatively low in concentration can be still accurately detected.

The invention relates to a fluorescent quantitative detecting method for CYP2C19 genotyping fluorescent and a diagnostic kit. At present, CYP2C19 genotyping techniques at home and abroad are mainly RFLP technique and ALA technique which determine genotypes according to the size of a DNA fragment, with the disadvantages of time-consuming operation and low flux. The invention provides a novel point mutating or SNP detecting method which utilizes the ASA combination primer sequence designed for the polymorphic loci of the CYP2C19 gene exons 4 and 5, the referential ASA primer combination or the degenerated primer sequence for quality control, specific TaqMan-MGB probe sequences for amplified products, an ASA amplifying reaction method, the amplifying reaction result of real-time fluorescent quantitative detection, the fast analysis of mutation locus type and genotyping. The quantitative detecting method has the advantages of time saving compared with a conventional ASA method, no need for electrophoresis detection, fastness, accuracy, and the like, and can be used for detecting other drug-metabolizing enzymes, or more extensive genetic variation or mutation.

The invention belongs to the technical field of animal epidemic disease detection and quarantine, and discloses a canine distemper virus (CDV) and canine parvovirus (CPV) duplex TaqMan-MGB fluorescent quantitative PCR (polymerase chain reaction) detection kit and a detection method thereof. The detection kit comprises a pair of specific primers designed based on CDVH genes, a TaqMan-MGB probe with the 5' end marked as FAM, a pair of specific primers designed based on CPVVP2 genes and a TaqMan-MGB probe with the 5' end marked as VIC. The detection method comprises the following steps: designing two pairs of primer sequences and two TaqMan-MGB marked probe sequences, and performing fluorescent labeling; preparing total RNA (ribonucleic acid) and total DNA (deoxyribonucleic acid); performing reverse transcription; performing fluorescent PCR amplification; performing result judgment. According to the detection method, the nucleic acids of a CDV and a CPV can be detected at the same time and the CDV / CPV can be quickly, specifically and sensitively identified at the same time. The detection kit is of great significance on prevention and control of CDV and CPV diseases.

The invention discloses a case of rapid, sensitive, precise pine beam nematology detecting box and method, which consists of TaqMan-MGB probe and mating primer. The method adopts super-low temperature (-70 deg.c) freezing method to extract nematology DNA rapidly as form to proceed PCR augmentation, which judges the detecting result according to fluorescent curve. The invention is convenient to operate within 1.5 h to finish the whole detecting course, which is fit for animal quarantine, plant protection, packing company and forestry department.

The invention discloses a composition and reagent kit for early cervical cancer detection. The composition comprises 3 CpG island regions subjected to high methylation in an EPB41L3 gene and 3 CpG island region amplifying primers subjected to high methylation in a JAM3 gene, 98% or above of different types of cervical cancer can be covered, and detection of polygene polymethylation regions can berealized through a one-pipe reaction and detection. A specific MGB probe and a degenerate closed primer are preferably selected for cooperation, so that sensitivity and accuracy are further increased.The whole detection process is free from wounds, simple and convenient to operate and easy to interpret, universal qPCR equipment can meet detection, a wholly-closed form is adopted in the PCR process, and the possibility of cross-contamination can be avoided; besides, three segments of two markers are detected at the same time, so that the result is more accurate; and all the factors are integrated, so that the composition disclosed by the invention has social promotion properties. Due to high sensitivity of detection, the composition is suitable for non-invasive early cervical cancer screening.

The invention belongs to the technical field of biology. K-ras gene mutation plays an important role in occurrence and development of pancreatic cancer, but the current universal K-ras gene mutation detection methods comprise a limited fragment length polymorphism analysis method and an amplification blocked mutation system method, and the two methods have low specificity and cannot qualitativelyand quantitatively detect the mutation of K-ras genes at the same time. The invention aims to provide a double fluorescent marker probe real-time quantitative detection method for K-ras gene 12 codonmutation with operation convenience, high sensitivity and high specificity. The method comprises the following steps of: designing wild K-ras gene 12 codon-targeted peptide nucleic acid (PNA) and corresponding mutation detection probes, namely a K-ras-FAM Tagman MGB probe and a K-ras-VIC Tagman MGB probe; performing real-time quantitative polymerase chain reaction (PCR) detection on a plasmid standard substance of known mutation quantity by using the PNA and the probes to acquire a standard curve and a fluorescent type; and extracting and purifying sample DNA, measuring the concentration, performing real-time quantitative PCR detection, and judging K-ras gene mutation quantity and mutation type according to the standard curve and the fluorescent type.

The invention provides primers and specific TaqMan MGB probes for accurately and efficiently detecting SLC35A3 gene V180F mutation bits. When the primers and the probes are used, and the real-time fluorescence quantitative PCR (Polymerase Chain Reaction) technology is utilized, the gene type of the cow SLC35A3 gene V180F mutation bits to be detected can be fast and sensitively detected, so that the cow CVM (Complex Vertebral Malformation) hereditary defect carriers can be accurately sieved. Compared with the traditional detection technology, the primers and the probes have various advantages including high detection speed, high sensitivity and high automation degree, in addition, the types can be judged through one PCR, the whole reaction process is carried out in a sealed tube, and the cross contamination is reduced.

The invention belongs to the technical field of biological products, and relates to a genetic diagnosis reagent for the Citrin deficiency disease and an application of the genetic diagnosis reagent. The quantitative PCR technology of Taqman MGB probes is used for detecting one or more of nine mutation sites of a Citrin deficiency disease gene SLC25A13, and therefore the majority of pathogenic mutations can be detected. According to the genetic diagnosis reagent for the Citrin deficiency disease, a quantitative PCR instrument and a common PCR reagent can be used; the nine Citrin deficiency disease mutant genetic loci are detected in an amplification mode so that a detection result can be obtained within 3-5 hours; the genetic diagnosis reagent can be used for detecting the Citrin deficiency disease in a single laboratory closed tube provided with the quantitative PCR instrument, thereby avoiding the situation that high concentration samples are contaminated; moreover, the genetic diagnosis reagent can be conveniently produced in a biotechnological company and used for detection in a biomedical detection mechanism, thereby meeting the requirement for industrialization promotion.

The invention discloses a primer group for detecting EGFR (epidermal growth factorreceptor) gene T790M mutation based on ARMS fluorescent quantitative PCR. The primer group comprises the following primers: T790M-F: CTCCACCGTGCAGCTCATCTT; T790M-R: TGCACACACCAGTTGAGCAGGT; and TaqMan-MGB probe 1: TCGGCTGCCTCCTGGA, wherein the T790M-R is a wild type downstream primer, and the upstream primer T790M-F is an ARMS primer. A mismatched base T is additionally introduced at the second position of a 3'end, so that a wild type template has two mismatched bases, and the amplification efficiency is remarkably reduced; and a T790M mutation template has only one mismatched base which is not at the 3' tail end, and specific amplification still can be conducted, so that the T790M mutation lower than 1 percent in 5 ng of a sample can be detected sensitively. The invention also discloses preparation methods of the primers and the probe. The primer group has the beneficial effects: (1) the specificity is high; (1) the quick and efficient amplification is realized; (3) the sensitivity is high; (4) the simple and convenient authentication is realized; and (5) the application is wide.

The invention relates to the technical field of primer and probe sequences for detecting nucleonic acid of human metapneumovirus: a biotechnology and a virus detection technology and provides a primer and MGB (Myohaemoglobin) probe sequence for real-time RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection of human metapneumovirus nucleonic acid. The sequence is a primer and probe sequence which is designed and synthesized by carrying out sequence detection and analysis on an N gene and an L gene of known hMPV (human Metapneumovirus) and takes the L gene as a target. The sequence is researched and verified by 200 clinical samples detected with the real-time RT-PCR method, and the degenerate base group of the sequence includes the variation rule of 4 genetic subtypes of the hMPV, therefore, the sequence can be used for the research and the development of detection technology of nucleonic acid infected by the hMPV.

The invention discloses an rs8099917 locus gene based genotyping dual-color fluorescence PCR rapid detection kit. Primers and TaqMan-MGB probes are redesigned to optimize the reaction system, a two-component hot start DNA polymerase composes an enzyme activity automatic regulating system, ROX Reference Dye can eliminate a signal background and correct the fluorescence signal error generated between holes, thus realizing accurate, high amplification efficiency, high sensitivity, good specificity, good repeatability, simple operation and short-time detection. Therefore, the technology can achieve clinical application and promotion.

The invention discloses a one-step process real-time fluorescent quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction) method and kit as well as a primer and a probe for detecting Z / S subtype ebola viruses (EBOV). The one-step process real-time fluorescent quantitative RT-PCR method is a general detection method; and the PCR detection process can be used for detecting Z and S subtype EBOVs after being carried out once. A sample is positive as long as any one of the Z and S subtype EBOVs or both the Z and S subtype EBOVs exist in the sample to be detected. The one-step process MGB (Minor Groove Binder) probe fluorescent quantitative RT-PCR technology provided by the invention combines the advantages of efficient amplification of nucleic acids in a PCR technology and sensitivity of a MGB probe and a computer-assisted fluorescence detection technology, overcomes the shortcomings of conventional PCR detection and greatly increases detection sensitivity, specificity and convenience of operation.

The invention relates to a preparation and technical method of a novel reagent (kit) required for detecting tiny RNA (miRNA) used in the field of biomedicine, and application thereof to the fields of clinical medicine, biology, molecular biology and the like. The invention belongs to the design, preparation and technical method application of the experiment reagent which uses specially designed primers and synthesized MGB probes for detecting and identifying mature miRNAs on the basis of a fluorescence quantitative PCR method. Compared with other methods, the technical method established by the invention has the characteristics of high sensitivity, high specificity, high throughput detection capability, short time consumption, relatively simple operation and the like. Thereby, the invention relates to the preparation of the novel miRNA detection reagent or reagent kit, the establishment of the technical method, the basic research of the reagent or the reagent kit, and the relevant prevention, treatment and research in clinical medicine such as malignant tumor, cardiovascular system diseases, nervous system diseases and the like.