388 results about "Fetus" patented technology

The invention provides methods, systems, and computer readable medium for detecting ploidy of chromosome segments or entire chromosomes, for detecting single nucleotide variants and for detecting both ploidy of chromosome segments and single nucleotide variants. In some aspects, the invention provides methods, systems, and computer readable medium for detecting cancer or a chromosomal abnormality in a gestating fetus.

Systems and methods are provided for aiding the detection and diagnosis of critical heart defects during fetal ultrasound examinations, in which image data (e.g., motion video clips and / or image frames) is analyzed with machine learning algorithms to detect and identify morphological and / or flow abnormalities indicative of critical CHDs. The results of the analyses are presented for review to the clinician, optionally with an overlay, for the selected image frames that identifies the abnormalities with graphical or textual indicia. The overlay further may be annotated by the clinician and stored to create documentary record of the fetal ultrasound examination.

The invention relates to the field of biological detection, in particular to the field of paternity test and detection, and particularly relates to a method for non-invasive prenatal genetic relationship judgment by adopting a two-state SNP (Single Nucleotide Polymorphism) site. According to the method, the minimum number of SNP sites required for judging the genetic relationship is calculated, the genetic relationship is judged by screening the sites containing fetal information in the free DNA sample of the pregnant woman and combining the indexes, the genotype of the pregnant woman sample does not need to be additionally detected, meanwhile, whether the parent-child relationship between a fetus and a suspected parent conforms to the parent-child relationship or not can be accurately judged, and the application range is wider.

A vacuum extractor for use in childbirth includes a vacuum cup and a handle coupled to the vacuum cup. The handle includes a grip member and a pump member movably mounted on the grip member. The pump member is configured to be manually moved relative to the grip member by a user between a first position and a second position to generate a vacuum within the vacuum cup when the vacuum cup is disposed on the head of a fetus. The grip member includes a first laterally extending member and a second laterally extending member, which are separated from one another in a longitudinal direction. The user can grip either the first laterally extending member or the second laterally extending member while pushing the pump member toward the grip member to move the pump member from the first position to the second position during use of the vacuum extractor.

The invention provides a MedLP and HAFB collaborative driving fetal II-level ultrasonic image classification method, which comprises the following steps of S1, collecting fetal II-level ultrasonic section images of key parts; performing section marking and preprocessing on the collected ultrasonic images, and randomly disrupting the sequence of all the images and the corresponding labels for model training; s2, a MedLP-HAFB-CLIP model is constructed, and the MedLP- S3, the constructed MedLP-HAFB-CLIP model is trained, and the HAFB-CLIP model is constructed; s4, inputting an ultrasonic image into the trained MedLP-HAFB-CLIP model, performing feature extraction, fusion and processing on the input ultrasonic image to generate unified feature representation, matching the feature representation with predefined anatomical category text prompt features to generate a similarity score matrix, and performing feature extraction, fusion and processing on the similarity score matrix; and according to the similarity score matrix, obtaining a model, and distributing a category index with the highest similarity to each image to serve as a prediction result of the input ultrasonic image. According to the method, the classification accuracy and efficiency of the fetal ultrasonic image are remarkably improved.

The invention relates to the technical field of biology, and discloses a fetus genotype detection method based on haplotype. The method comprises the following steps: 1) performing cfDNA sequencing on a to-be-tested pregnant woman plasma sample with known haplotype parting of a mother and a father to obtain a sequencing read section; 2) comparing the sequencing read segment to a reference genome, and estimating depth distribution and mutation of the sample according to a comparison result; 3) for four types of allele sites, the concentration of the fetal sample is calculated according to the secondary allele frequency, and the four types of allele sites comprise mother homozygous fetal homozygous, mother homozygous fetal heterozygous, mother heterozygous fetal homozygous and mother heterozygous fetal heterozygous; and 4) for genotype combinations AAAB, ABAA and ABAB of the mother and the father, deducing fetal SNP and InDel genotypes. The method disclosed by the invention can be used for detecting the single-point variation in the whole genome range, so that the accuracy is improved, and the sequencing depth is effectively reduced.

The present invention relates to an incubation system for liquid-based incubation of prematurely born infants, comprising: —an inner chamber forming an amniotic basin comprising amniotic fluid, said basin being configured for holding said infant and being made from a flexible material configured for expanding said inner chamber volume in correspondence with the growth of said infant; —an outer chamber enclosing said inner chamber and comprising a temperature regulation fluid, —a fetal connection port, arranged for connecting with the umbilical cord of said infant, said umbilical cord providing a port in said inner chamber to said infant for providing dialyzation and nutrition compounds to said infant via said umbilical cord; —a fetal control unit, connected to said fetal connection port for control of said dialyzation and control of said provided nutrition by monitoring and controlling one or more of a pressure, flow and temperature thereof; an amniotic fluid circulation unit, arranged for connecting with an inlet / outlet port of said inner chamber and comprising a pump for circulating said amniotic fluid from said inner chamber and through a purification system located outside said inner chamber; and —a temperature regulation fluid control unit, arranged for connecting with an inlet / outlet port of said outer chamber and comprising a pump for circulating said temperature regulation fluid from said outer chamber and through a heat exchanger system located outside said inner chamber.

Compositions, methods, kits, systems, and software are provided for non-invasive prenatal testing for autosomal recessive diseases. Next generation sequencing is used to sequence maternal and fetal DNA isolated from maternal plasma by probe capture. The fetal fraction of the sequencing reads for DNA isolated from maternal plasma is estimated by counting single nucleotide polymorphisms (SNPs) for which an allele is detected that is present in the paternal haplotype but absent in the maternal haplotype, based on the assumption that SNPs having a paternal allele belong to the fetal DNA. The fetal fraction is bioinformatically enriched by excluding sequencing reads over a specified length via in-silico size selection, which increases fetal genotype prediction accuracy. Parental haplotype information together with the read ratios observed at the linked SNPs is used to predict the fetal genotype at a site of a mutation linked to the autosomal recessive disease.

The invention provides a non-invasive fetal trisomy 21 syndrome prenatal screening kit based on digital PCR, and relates to the technical field of fetal trisomy 21 syndrome screening, according to a method for enriching fetal cfDNA in pregnant woman plasma, SPRIselect magnetic beads with low enrichment multiple and silicon hydroxyl magnetic beads are combined for use, and under a certain dosage, the recovery rate of fetal cfDNA short fragments reaches 95%; according to the provided multiple system construction method, positive gDNA and negative gDNA are obtained on the basis of a 21 trisomy positive cell line and a 21 trisomy negative cell line, low-proportion reference substances are prepared and used, internal reference sites and detection sites which are high in detection capacity and stable in detection performance are screened from the beginning, and compared with existing multiple system establishment and verification through direct use of pregnant woman plasma samples, the multiple system construction method has the advantages that the detection efficiency is high, and the detection cost is low. The to-be-detected sample with lower fetal cfDNA content can be stably detected.

The invention discloses a self-adaptive noninvasive fetal electrocardiosignal extraction method based on a logarithmic hyperbolic secant function. The method comprises the following steps: constructing a mother abdomen electrocardiosignal model; based on a self-adaptive filtering framework, inputting a chest electrocardiosignal MECG of the mother as a reference signal and an abdomen signal AECG as an expected signal, and calculating filtering output; defining a target function and updating a weight coefficient; the extracted fetal electrocardiosignals are output through Monte Carlo experiment optimization parameter combination; the invention further lays a foundation for long-term real-time monitoring of puerperae and fetuses through portable equipment.

Systems and methods are provided for aiding the detection and diagnosis of critical heart defects during fetal ultrasound examinations, in which image data (e.g., motion video clips and / or image frames) is analyzed with machine learning algorithms to detect and identify morphological and / or flow abnormalities indicative of critical CHDs. The results of the analyses are presented for review to the clinician, optionally with an overlay, for the selected image frames that identifies the abnormalities with graphical or textual indicia. The overlay further may be annotated by the clinician and stored to create documentary record of the fetal ultrasound examination.

The invention provides a breeding method for improving the production performance of pregnant sows, and the breeding method comprises the following steps: (1) from the 25th-35th day of pregnancy to the 55th-65th day of pregnancy of the sows, adding a first nutritional supplement into a sow feed; (2) from the 55th-65th day of pregnancy of the sows to the 85th-95th day of pregnancy of the sows, adding a second nutritional supplement into the feed of the sows; and (3) adding a third nutritional supplement into the sow feed from the 85th-95th day of pregnancy to delivery of the sows. The breeding method provided by the invention can fully meet the nutritional requirements of the pig fetuses, promote the growth and development of the pig fetuses, avoid intrauterine development retardation, relieve oxidative stress of the sows, shorten the birth process, reduce postpartum inflammation of the sows, promote rapid recovery of the sows, reduce the number of weak piglets, improve the birth weight of the piglets, and further improve the survival rate and health state of the piglets.

The invention belongs to the field of food, and particularly relates to application of active folic acid substances to regulation of intestinal flora of a mother and a child. The invention provides an application of active folic acid substances in preparation of food which is taken by a mother and contributes to regulation of intestinal flora of the mother and offspring of the mother; wherein the active folic acid substances are selected from 6S-5-methyltetrahydrofolic acid and salts thereof, the mother is in a gestation period and / or a lactation period, and the offspring is in a fetal period, an infant period and / or a children period. The invention accidentally finds that the active folic acid substances are taken by the mother in the gestation period, so that the intestinal flora of the mother and the offspring can be obviously improved, and the active folic acid substances can promote the increase of beneficial bacteria in the intestinal tracts of the mother in the gestation period and the lactation period and the offspring of the mother and reduce the relative content of conditioned pathogens; furthermore, by adjusting the intestinal flora, the health of nervous systems of the mother and the offspring of the mother can be maintained through the intestinal brain axis.

The invention relates to a middle-late pregnancy fetus ultrasonic cerebellum standard section image parallel recognition and measurement method and device, computer equipment, a storage medium and a computer program product, and the method comprises the steps: obtaining a middle-late pregnancy fetus ultrasonic image and a deep learning model of cerebellum standard section recognition, the deep learning model is obtained based on multi-node parallel technology accelerated training; inputting the fetus ultrasonic image in the middle-late pregnancy period into a deep learning model to identify a detection frame of each structure in a cerebellar section and a corresponding confidence coefficient; screening each structure in the recognized cerebellar section based on the detection frame and the corresponding confidence to obtain a structure recognition result in the cerebellar section; determining a cerebellum center line according to a structure identification result in the cerebellum section; and measuring the transverse diameter of the cerebellum according to the midline of the cerebellum. According to the whole scheme, efficient and accurate parallel recognition and measurement of the ultrasonic cerebellum standard section image of the fetus in the middle-late pregnancy period can be achieved.

Neonatal congenital digestive tract obstruction is digestive system structural deformity caused by various factors in the fetal development process, the invention provides a method for establishing a zebra fish model for neonatal congenital digestive tract obstruction, a gRNA target sequence is designed on an amino acid structural domain of a zebra fish ZIC3 gene, the specific sequence of sgRNA is GCGCCATAAGGTTCCGTACGAGG-3 or GCCCCGGACCATGGTGTGGGG, and a primer is synthesized; the ZIC3 mutation zebrafish juvenile fish grows to 6-7 days, and the zebrafish with the effective mutation type in embryo detection is obtained through multi-step detection.

The first problem addressed is to provide a novel noninvasive prenatal paternity appraisal method capable of genotyping a fetus using simple criteria. The present invention for solving the first problem is a noninvasive prenatal paternity appraisal method that comprises performing a two-sample appraisal step by performing fetal genotyping by a criterion a determination method or performing a three-sample appraisal step by performing fetal genotyping by a criterion a determination method or a criterion b determination method.

The invention discloses a quality grade and risk identification acquisition method for a prenatal ultrasound key anatomical structure. The method comprises the following steps: firstly, automatically identifying a standard section of a fetus and carrying out pixel-level segmentation on the key anatomical structure; on the basis, indexes such as visibility, orientation consistency and boundary integrity are extracted, a comprehensive quality score is calculated, and corresponding quality grades and risk identifiers are output according to threshold rules, so that an objective, consistent and traceable quality evaluation closed loop is formed, segmentation results are structured into quantitative indexes and graded alarms, and the quality evaluation accuracy is improved. The system can realize automatic evaluation and risk prompt of the standard section quality on the premise of not changing the existing clinical process, and improves the quality control efficiency and consistency.

The invention provides methods for non-invasive prenatal testing that allow for detecting risk of chromosomal and subchromosomal abnormalities, including but not limited to aneuploidies, microdeletions and microduplications, insertions, translocations, inversions and small-size mutations including point mutations and mutational signatures. The methods of the invention utilize a pool of TArget Capture Sequences (TACS) to enrich for sequences of interest in a mixed sample containing both maternal and fetal DNA, followed by massive parallel sequencing and statistical analysis of the enriched population to thereby detect the risk of a genetic abnormality in the fetal DNA. Kits for carrying out the methods of the invention are also provided.

The generation of complex organ tissues from human embryonic and pluripotent stem cells (PSCs) remains a major challenge for translational studies. It is shown that PSCs can be directed to differentiate into intestinal tissue in vitro by modulating the combinatorial activities of several signaling pathways in a step-wise fashion, effectively recapitulating in vivo fetal intestinal development. The resulting intestinal “organoids” were three-dimensional structures consisting of a polarized, columnar epithelium surrounded by mesenchyme that included a smooth muscle-like layer. The epithelium was patterned into crypt-like SOX9-positive proliferative zones and villus-like structures with all of the major functional cell types of the intestine. The culture system is used to demonstrate that expression of NEUROG3, a pro-endocrine transcription factor mutated in enteric anendocrinosis is sufficient to promote differentiation towards the enteroendocrine cell lineage. In conclusion, PSC-derived human intestinal tissue should allow for unprecedented studies of human intestinal development, homeostasis and disease.

The invention provides methods for assessment of fetal DNA samples using target-enriched multiplexed parallel analysis. The methods of the invention utilize TArget Capture Sequences (TACS) to thereby enrich for target sequences of interest, followed by massive parallel sequencing and statistical analysis of the enriched population. The methods can be used with fetal or embryonic DNA samples, for example for detection of the presence of genetic abnormalities, e.g., for purposes of IVF Pre-implantation Genetic Screening (PGS) and Diagnosis (PGD). Kits for carrying out the methods of the invention are also provided.

Provided herein are computer-implemented methods for assigning maternal or fetal origin to one or more genetic variations in cell-free DNA (cfDNA) of a sample from a pregnant mammal, preferably a pregnant human, it uses a probabilistic model for assigning maternal or fetal origin to genetic variations in DNA from a sample obtained from a pregnant mammal, where the model assigns maternal or fetal origin based on a combination of fetal fraction and DNA fragment size.

Methods, systems, and apparatus are provided for determining whether a nucleic acid sequence imbalance exists within a biological sample. One or more cutoff values for determining an imbalance of, for example, the ratio of the two sequences (or sets of sequences) are chosen. The cutoff value may be determined based at least in part on the percentage of fetal DNA in a sample, such as maternal plasma, containing a background of maternal nucleic acid sequences. The percentage of fetal DNA can be calculated from the same or different data used to determine the cutoff value, and can use a locus where the mother is homozygous and the fetus is heterozygous. The cutoff value may be determined using many different types of methods, such as sequential probability ratio testing (SPRT).

The invention relates to the field of image processing, in particular to a fetal hydrocephalus three-dimensional reconstruction and operation planning method based on multiple modalities, which comprises the following steps: obtaining key points and ventricular postures in a three-dimensional point cloud during each three-dimensional reconstruction, predicting the ventricular postures during the next three-dimensional reconstruction, and obtaining prediction residual errors; historical three-dimensional reconstruction key points are clustered based on prediction residual errors to obtain all categories, and when three-dimensional reconstruction is carried out again, the obtained three-dimensional point clouds are further deleted and added based on the categories. According to the invention, errors in a matching fusion process and errors in a prediction process during three-dimensional reconstruction are avoided, and the accuracy of a three-dimensional reconstruction result is improved.

The application relates to the technical field of data management control, and particularly discloses a data management control method and system based on a maternal and infant one-stop learning cloud platform, which comprises the following steps: based on real-time collected maternal and infant physiological data, maternal and infant historical health records and user learning behavior data, a multi-modal maternal and infant user portrait containing dynamic health state labels and dynamic learning ability labels is constructed; based on multi-modal maternal and infant user portraits of all maternal and infant users, multi-dimensional health horizontal comparison factors of pregnant women and fetuses or infants in each maternal and infant user under each division attribute and each division level are determined, and maternal and infant health deviations of each maternal and infant user are analyzed; based on the multi-dimensional health horizontal comparison factors of the pregnant women and the fetuses or the infants in each maternal and infant user under each division attribute and each division level and the maternal and infant health deviations, intelligent adaptation of multiple services is driven; and a closed loop from health deviation to education content, health plan and deviation improvement is formed.

Disclosed herein is deuterated buprenorphine as a protective agent for fetal subjects against full-agonist opioid exposure. Use of deuterated buprenorphine prevents or reduces exposure of the fetus to opioids used by the mother. Use of deuterated buprenorphine may prevent or reduces exposure of the fetus to harmful metabolites of buprenorphine.

The application provides a fetal posture evaluation method, an ultrasonic imaging method and an ultrasonic imaging system. The fetal posture evaluation method comprises the following steps: acquiring three-dimensional ultrasonic data of an early-pregnancy fetus; acquiring a head region and a body region of the early-pregnancy fetus in the three-dimensional ultrasonic data; evaluating a posture of the early-pregnancy fetus based on a relative positional relationship between the head region and the body region of the early-pregnancy fetus, to obtain a posture evaluation result; and displaying the posture evaluation result. The method can facilitate a doctor to observe the posture of the fetus and quickly learn whether the posture of the early-pregnancy fetus is in a natural posture.

The present disclosure provides compositions and methods for inducing an immune response in a fetus or newborn. In particular, the disclosure provides compositions and methods for transamniotic administration of a polynucleotide encoding a pathogen antigen.

A wearable birthing simulator and method of operating thereof are disclosed. The simulator includes a housing that is securable to a subject and the housing defines an opening. Positioned within the housing is a uterus simulator and a removable fetal model contained therein. Coupled to the uterus simulator is a birth canal simulator. A birthing device comprises an actuator assembly in communication with the controller for automatically moving the fetal model towards the birth canal simulator. One or more sensors are mounted to the housing and are electrically connected to the controller for detecting movement of the fetal model by the birthing device. The feedback device is configured to provide the haptic feedback to the subject in response the movement of the fetal model toward the birth canal simulator. The disclosed simulator may be used to simulate a variety of childbirth scenarios.