Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Numerator mark concatenated with whitebacked planthopper resistance genes of rice, and developing method thereof

A technology of molecular markers and white-backed planthoppers, applied in the field of agricultural biotechnology engineering, can solve problems such as practical application difficulties and difficult selection of markers, and achieve strong resistance to brown planthoppers and strong resistance

Inactive Publication Date: 2008-10-29
CHINA NAT RICE RES INST
View PDF0 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

McCouch was the first to carry out molecular mapping research on rice white-backed planthopper resistance. He first used the TN1 (Taichung Local No. 1) / IR36 near-isogenic line to map Wbphl between the two RFLP markers RG146 and RG445, but due to the RFLP The marker is a multi-copy marker, and it is difficult to be used as a selection marker; since then, Wbph2 and Wbph6(t) have also been mapped successively, but their genetic distances are 25.6cM and 21.2cM, respectively, and practical application is still very difficult

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Numerator mark concatenated with whitebacked planthopper resistance genes of rice, and developing method thereof
  • Numerator mark concatenated with whitebacked planthopper resistance genes of rice, and developing method thereof
  • Numerator mark concatenated with whitebacked planthopper resistance genes of rice, and developing method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1. Using SSR molecular markers to obtain molecular marker RM6917 linked to the rice white-backed planthopper resistance gene:

[0049] The specific method is: the parent of the insect-resistant gene donor came from the japonica rice variety Chunjiang 06 (CJ06) of the China National Rice Research Institute, and crossed with the susceptible ordinary indica variety Taichung Local No. 1 (TN1). Crossing and selfing, the obtained resistant and susceptible near-isogenic lines were used for matching group and gene mapping, and 76 recessive individuals were identified from the progeny of this population for linkage analysis.

[0050] In all the following steps, deionized water is used as the solution for those that are not notified in detail.

[0051] 1. Extract DNA

[0052] 1). Prepare DNA extraction buffer:

[0053] Add 1 volume of DNA extraction solution (0.35M sorbitol; 0.1M Tris, pH8.2; 0.005MEDTA;), 1 volume of nuclear lysis solution (0.2M Tris, pH7.5; 0.05M EDTA; 2M N...

Embodiment 2

[0078] Example 2: Using STS molecular markers to obtain the molecular marker AP4741 plant material linked to the rice white-backed planthopper resistance gene is the same as in Example 1, and the specific procedures are as follows:

[0079] 1. Extract DNA

[0080] 1). First prepare DNA extraction buffer:

[0081] The same as in Example 1.

[0082] 2). Perform the following treatments on each rice leaf:

[0083] The same as in Example 1.

[0084] 2. STS analysis:

[0085] STS primer design According to the results of Nipponbare and 93-11 sequence alignment, suitable primers were designed for the polymorphism screening of CJ06 and TN1, and Shanghai Shenergy Group was commissioned to synthesize and design 3 pairs of STS primers, as shown in Table 2:

[0086] Table 2. Sequences of 3 pairs of STS primers synthesized

[0087] Primer name

Left-wing primer sequence

Right-wing primer sequence

AP4687

AGCTTCCCCACGACTCCC

GAGCCACACCGCCTCCAC

AP4741

Aat...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular mark linked with rice gene resistant to Whitebacked Planthopper. Rice is selected, and a molecular mark primer is selected from following primer pairs, wherein the nucleotide sequence is 5' arrow 3'; RM6917 forward: CTGGTTGTTTTCTGAACTCCGT, reverse: GCATTAACCATAGCTGTCCACTC; and AP4741 forward: AATCATGCTAGGTTATTACTCG, reverse: GTGCAGAGATCATGCTTTTG. The invention also provides the development method of the molecular mark. The molecular mark is tightly linked with the gene resistant to Whitebacked Planthopper, and can be used for auxiliary selection and breeding of rice resistant to Whitebacked Planthopper.

Description

Technical field [0001] The invention belongs to agricultural biotechnology engineering, and particularly relates to a molecular marker linked to a rice white-backed planthopper resistance gene and a method for obtaining the same. Background technique [0002] The rice white-backed planthopper (Sogatella furcifera, Horváth) is one of the main pests in rice-producing areas in my country and Southeast Asia. Since the 1980s, with the promotion of high-yield hybrid rice technology in my country and the crop physiological factors that may be related to heterosis, the white-backed planthopper Planthoppers have become the main pests of rice. According to the China Agricultural Yearbook, in the year of recurrence of rice planthoppers, the affected area exceeded 50% of the total rice area in my country. In 1991, my country’s widespread rice planthopper damage caused nearly 1.6 billion kilograms of rice to be lost, and the affected area reached 29.33 million hectares. 2 In 2005, there was a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/11C12N15/10
Inventor 曾大力李家洋钱前胡江张光恒郭龙彪董国军刘坚
Owner CHINA NAT RICE RES INST
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com