Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

53 results about "Sogatella furcifera" patented technology

1,5-disubstituted aryl-1,4-pentadiene-3-ketoxime ether compound and preparation method thereof and insecticidal activity application

The invention discloses a 1,5-disubstituted aryl-1,4-pentadiene-3-ketoxime ether compound (I) and a preparation method thereof and insecticidal activity application. In the formula, Ar is aryl and can be substituted by one or more groups, and R1O can be in o, m and p positions. R1 and R2 are respectively C1-6 alkyl, C2-6 chain alkenyl or C2-6 chain alkynyl, benzyl, acyl and heterocyclic ring radical and can be substituted by one or more groups, wherein n is 0-3. In the invention, a series of novel curcumin derivatives 1,5-disubstituted aryl-1,4-pentadiene-3-ketoxime ether prepared by the oxime ether structure based on the structure of curcumin derivative 1,5-disubstituted aryl-1,4-pentadiene-3-ketone is prepared and the compounds and preparations have the function of preventing and treating crop pests, in particular a highly preventing and treating effect for plutella xylostella, nilaparvata lugens, snout moth's larva, sogatella furcifera, cnaphalocrocis medinalis, cabbage caterpillar, beet armyworm and aphid.
Owner:GUIZHOU UNIV

Method for automatically monitoring and reporting insect condition of rice planthopper

InactiveCN102096808AImproving the technical level of automatic measurement and forecastingCharacter and pattern recognitionFrequency spectrumNatural state
The invention discloses a method for automatically monitoring and reporting the insect condition of rice planthopper. The method comprises the following steps: (1) designing a wild insect automatic photographing device to acquire digital insect images of the rice planthopper in a natural state and with a white background; (2) segmenting the images to obtain the image of the back region of the insect body with integral information; (3) transforming the image of the back region of the insect body into the frequency domain by means of Flourier transformation to obtain a Flourier spectrum reflecting the color and texture features of the insect back, and extracting the two-dimensional Flourier spectrum window data to describe the features of the insect; and (4) constructing an insect classifier to respectively classify Sogatella furcifera, Nilaparvata lugens and Laodelphax striatellus into a first type, a second type and a third type, and the other insects into a fourth type, and counting the Sogatella furcifera, the Nilaparvata lugens and the Laodelphax striatellus. By utilizing the method, the population density of the rice planthopper can be substantially reflected, thereby guiding the production and experience, and improving the technical level for automatic insect monitoring and reporting in the agricultural industry.
Owner:NANJING AGRICULTURAL UNIVERSITY

Method for obtaining sogatella furcifera carrying SRBSDV (southern rice black-streaked dwarf virus) and application of sogatella furcifera

InactiveCN102630640AOvercome technical bottlenecks that are difficult to preserve for a long timeRapid identificationHorticulture methodsRice cultivationDiseaseDiseased plant
The invention discloses a method for obtaining sogatella furcifera carrying SRBSDV (southern rice black-streaked dwarf virus) and an application sogatella furcifera. The method for obtaining the sogatella furcifera carrying the SRBSDV, comprises the following steps of: feeding the sogatella furcifera by utilizing rice infecting the SRBSDV or cryopreserved rice diseased plant so that the sogatella furcifera obtains the SRBSDV, transferring the infected sogatella furcifera to a healthy rice to be fed till passing through a circulation period of virus, and detecting the sogatella furcifera by utilizing an RT-PCR (reverse transcription-polymerase chain reaction) technology and a serology method to obtain the sogatella furcifera carrying the SRBSDV, wherein the carrier rate of the sogatella furcifera can reach more than 50% through a manual feeding manner based on the experiment. Through utilizing the method for obtaining the sogatella furcifera carrying the SRBSDV, the obtained sogatella furcifera carrying the SRBSDV can be applied to screening of SRBSDV-resisting monoclonal antibody to carry out a rice inoculation experiment to identify the resistance of the rice, screen disease-resistant variety and provide a service of the breeding for disease resistance. The invention can be further applied to researching mutual relation between the SRBSDV and a vector insect sogatella furcifera and provides powerful theoretical evidence for prevention and treatment on the viruses.
Owner:ZHEJIANG UNIV

Rice seed dressing agent composition used for preventing and treating black-streaked dwarf disease and its preparation method

The invention relates to a rice seed dressing agent composition used for preventing and treating black-streaked dwarf disease and its preparation method. The composition is prepared from effective components, a microelement fertilizer regulator, a solvent, a carrier, a surfactant, and other additives, and can be prepared into suspending agents, water dispersible granules or wettable powder. The effective components include an insecticide and an antiviral agent. The composition can improve seed germination rate, ensure whole, strong and neat seedlings, and can promote growth and development ofthe seedlings and increase crop yield. The rice seeds that undergo seed dressing treatment can substantially improve the autoimmune system of crops, and can consciously resist disease attack. When effected by the agent, pests can take migratory flight or stop causing harm. The rice seed dressing agent composition of the invention especially have obvious antifeeding and repelling effects on Sogatella furcifera, Nilaparvata lugens, Oulema oryzae, Stenchaetothrips biformis, naranga aenescens moore and other pests of rice, reduce harm and virus spread, decrease or alleviate the occurrence of riceblack-streaked dwarf disease, thus having very obvious social and ecological benefits.
Owner:HUBEI XIANLONG CHEM IND

Fipronil and etofenpronx mixed pesticide

The invention relates to a composite Fipronil and Ethofenprox insecticide comprising effective active constituents, auxiliary agent and solvent, wherein the effective active constituents include Fipronil and Ethofenprox by the weight ratio of 1-20 : 1-40. The insecticide can be used for controlling Chilo supperssalis, Laodelphax srtiatellus, Nilaparvata lugens, Sogatella furcifera and Cnaphalocrocis medinalis Guenee.
Owner:JIANGSU ACADEMY OF AGRICULTURAL SCIENCES

Molecular marker interlocked with rice Sogatella furcifera resisting gene and application thereof

The invention discloses a molecular marker interlocked with a rice Sogatella furcifera resisting gene. Rice is used as a species, and molecular marker primers are selected from any of the following primer pairs, wherein the nucleotide sequence is from 5' to 3': RM401 forward: TGGAACAGATAGGGTGTAAGGG, reverse: CCGTTCACAACA CTATACAAGC; Wbsca1 forward: CAATGTTAGTATCGATCTGCTCAT, reverse: TCCTTTGACAGAATGAAACACC. RM401 is located on the rice chromosome 4, and Wbsca1 is located on the rice chromosome 4. The invention also discloses a method for developing the molecular marker. The molecular marker is used for identifying rice Sogatella furcifera resisting varieties and assisting selective breeding of rice Sogatella furcifera resisting offsprings.
Owner:CHINA NAT RICE RES INST

Internal reference gene capable of stable expression in different tissues of Sogatella furcifera, and screening method and application thereof

InactiveCN104962643ARich internal reference gene resourcesSpecificMicrobiological testing/measurementFermentationNucleotideScreening method
The invention relates to an internal reference gene capable of stable expression in different tissues of Sogatella furcifera, and a screening method and application thereof, belonging to the technical field of biology. The nucleotide sequence of the internal reference gene RPL9 is disclosed as SEQ ID NO:7. The method comprises the following steps: designing degenerate primers according to other insect related gene sequences disclosed in NCBI, carrying out PCR (polymerase chain reaction) to obtain 6 common internal reference gene partial nucleotide sequences of Sogatella furcifera, and carrying out cloning, sequencing and NCBI database Blast comparison to determine the partial sequences of the Sogatella furcifera internal reference gene; and designing specific quantitative primers on the basis of the partial sequences, establishing an RT-qPCR (reverse transcription-quantitative polymerase chain reaction) process based on an SYBR Green I dye technique, and screening out the internal reference gene RPL9 capable of stable expression in different tissue parts of Sogatella furcifera by using a fluorescent quantitative PCR technique. The internal reference gene lays solid foundation for researching gene expression level of different tissue parts and gene functions of Sogatella furcifera in future.
Owner:INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI

Method for evaluating resistance of rice in adult-plant stage against sogatella furcifera under semi-field conditions

The invention discloses a method for evaluating resistance of rice in the adult-plant stage against sogatella furcifera under semi-field conditions. The method comprises: planting rice in a cement pond, wherein the rice comprises to-be-tested rice varieties, an insect-resistant check variety and a susceptible check variety; planting the susceptible check variety around the to-be-tested rice varieties and the insect-resistant check variety, and carrying out normal water and fertilizer management; in an initial tillering stage of rice, inoculating each tiller with a pair of newly emerged adults of sogatella furcifera, and allowing the sogatella furcifera to perform natural propagation; and according to the sogatella furcifera resistance identification and evaluation criteria for rice varieties in the adult-plant stage, when the damage of the susceptible check variety reaches level 7, starting evaluating resistance of the to-be-tested rice varieties until all the plants of the susceptible check variety are dead; wherein when all the plants of the susceptible check variety are dead, the resistance of the to-be-tested rice varieties is the final resistance. The method disclosed by the invention overcomes the problem in the prior art that rice planthopper resistance of massive rice varieties in the adult-plant stage cannot be identified in bulk, so that the defect that evaluation on resistance against sogatella furcifera can only be identified in a seedling period is remedied.
Owner:CHINA NAT RICE RES INST

Method for stimulating rice induced insect resistance

ActiveCN105145572AActivate insect resistanceDecreased nymph survivalBiocidePlant growth regulatorsObserved SurvivalSogatella furcifera
The invention discloses a method for stimulating rice induced insect resistance. Nilaparvata lugens (St l), Sogatella furcifera (Hrovath) and Laodelphax striatellus (Fallen) are involved. By means of p-fluorophenoxyacetic acid, the resistance of rice to rice planthopper is improved, and then the damage of rice planthopper to rice is reduced. By applying p-fluorophenoxyacetic acid with certain concentration to rice, the induced resistance of rice to rice planthopper is produced, and the survival rate of rice planthopper nymph is remarkably decreased.
Owner:ZHEJIANG UNIV

Device suitable for sogatella furcifera feeding method RNA interference experiment and using method thereof

The invention discloses a device suitable for a sogatella furcifera feeding method RNA interference experiment. The device comprises a hollow and transparent glass tube, opening sealing layers and a light-proof sleeve, wherein the light-proof sleeve is arranged in the middle of the outer surface of the glass tube in a sleeving mode, the opening sealing layers are arranged at the two ends of the glass tube, fodder layers are arranged on the opening sealing layers, dsRNA and artificial fodder are arranged in the fodder layers, and the dsRNA is double-stranded RNA of a specific gene of sogatella furcifera. A characteristic that insects utilize optical driving is utilized, the sogatella furcifera moves to the two ends of the glass tube and reaches the opening sealing layers, the artificial fodder and the dsRNA are fixed in the opening sealing layers through two layers of films, the sogatella furcifera can pierce thinned Parafilm opening sealing films through mouthparts, and convenience is brought to the sogatella furcifera to take fodder and corresponding dsRNA. In addition, research specialist staff can conveniently observe sogatella furcifera phenotypic change such as death rate, malformation and the like by arranging the transparent glass tube after some gene expression is silenced by a feeding method RNA interference technology, and a sogatella furcifera gene function researching technology can be further obtained.
Owner:ZUNYI MEDICAL UNIVERSITY

Mixture preparation of nitenpyram and abamectin and preparation method

The invention discloses a mixture preparation of nitenpyram and abamectin and a preparation method. The mixture preparation comprises nitenpyram, abamectin, a cosolvent DMF (Dimethyl Formamide), an emulsifying agent I, an emulsifying agent II and a solvent. The preparation method comprises the following steps of: (1) weighing an abamectin active compound and putting into a container, adding dimethylbenzene and stirring; (2) adding the emulsifying agent I and the emulsifying agent II into the container, stirring and at the same time adding the cosolvent DMF; (3) after the abamectin active compound is substantially dissolved, adding a nitenpyram active compound, and stirring; (4) complementing the calculated volume by using the dimethylbenzene according to calculation, stirring till the prepared product is homogeneous and transparent. The mixture preparation is good in fast-acting property, long in lasting period and good in prevention and treat effect, and the amount of medicament is reduced; at the same time the environmental pollution is reduced; the preparation method has easily-accessible raw materials, is low in cost and convenient in machining in small insecticide factories; and meanwhile the machined preparation is wide in prevention and treatment range, and rice pests such as rice brown planthopper, sogatella furcifera, Chilo suppressalis and the like can be controlled.
Owner:HUAZHONG AGRI UNIV

Reference genes stably expressing sogatella furcifera at different ages, screening method and application thereof

The invention relates to reference genes stably expressing sogatella furcifera at different ages, and a screening method and application thereof and belongs to the technical field of biology. The nucleotide sequence of the reference genes A1TU is shown as SEQ ID NO:2. A degenerate primer is designed according to the other insect related gene sequence having already been disclosed by NCBI, a PCR is used for obtaining a part of the nucleotide sequence of six frequently-used reference genes of the sogatella furcifera, and the nucleotide sequence is determined to be a part of the sequence of the reference genes of the sogatella furcifera by means of cloning, sequencing and comparing with NCBI database Blast; soon afterwards, a specific quantitative primer is designed on the basis of the sequence, an RT-qPCR method based on the SYBR Green I dye technology is set up, and the fluorogenic quantitative PCR technology is utilized for screening the most stable reference genes A1TU of the sogatella furcifera at the different ages, so that the solid basis is provided for studying the expression levels of the genes at the different ages and setting up the gene function of the sogatella furcifera in the future.
Owner:INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI

Method for rearing sogatella furcifera indoors

The invention discloses a method for rearing sogatella furcifera indoors. Sponges are laid in a hatching jar and a container respectively, Kimura culture solution is poured into the hatching jar and the container and immerses the sponges, rice seeds are sowed on the sponges in the hatching jar and the container, adult sogatella furcifera is led into the hatching jar in a female and male paired manner, sealed in a manual incubator by gauze and reared until spawning when the rice seeds in the hatching jar sprout by 2-3cm, nymphs are transferred into the container, similarly sealed in the manual incubator by the gauze and reared until growing into adults when hatched in the hatching jar, the adults are led into the hatching jar in the paired manner again and spawn, and the process is repeated. The adults reared in the hatching jar are low in density and large in spawning quantity. After hatching, newly-hatched nymphs in the jar are conveniently removed. The nymphs are transferred into a transparent storage box, the adults are led into the hatching jar again after growing into the adults, and the process is repeated, so that a large quantity of sogatella furcifera pest sources can be provided. Besides, used articles can be repeatedly used, and cost is saved.
Owner:贵州省植物保护研究所

Composite pesticide containing nicotine type compound and applications thereof

A composite pesticide containing a nicotine type compound is disclosed. Effective components of the composite pesticide comprise the nicotine type compound and dibenzoyl-1-tert-butylhydrazine. The nicotine type compound comprises one and / or a mixture of more selected from clothianidin, imidacloprid, pymetrozine, dinotefuran, thiachloprid, thiamethoxam, and other nicotine type pesticide compounds. The composite pesticide has good control effects for mixed damage of a plurality of pests such as sesamia inferens, chilo suppressalis, tryporyza incertulas, cnaphalocrocis medinalis guenee, nilaparvata lugens, laodelphax striatellus, and sogatella furcifera in rice fields, can effectively control damage of a plurality of snout moth's larvae, plant hoppers, aphid, vegetable diamondback moth, spodoptera litura, and the like for rice and sugarcane, avoids error and waste when a farmer temporarily mixes and uses a plurality of agents at an edge of a field, and enhances control effects.
Owner:张长平

Insecticidal microemulsion compounded by chlorantraniliprole and azadirachtin and preparation method thereof

InactiveCN101961016ADelay drug resistanceMake up for your own shortcomingsBiocideAnimal repellantsTreatment effectSolvent
The invention discloses an insecticidal microemulsion compounded by chlorantraniliprole and azadirachtin and a preparation method thereof, wherein the microemulsion comprises the following compounds according to weight percentages: 0.1-60% of chlorantraniliprole, 0.1-25% of azadirachtin, 3-22% of emulsifier, 2-16% of penetrant, 1-15% of stabilizer, 2-20% of cosolvent and 22-72% of de-ionized water by weight; the preparation method comprises the following steps: putting the chlorantraniliprole, azadirachtin, emulsifier, penetrant, stabilizer and cosolvent into a high speed shearer, stirring to mix uniformly, adding the de-ionized water, stirring to mix uniformly, standing for 3-14h, heating to 47-63 DEG C and stirring uniformly to obtain the microemulsion. The microemulsion has obvious prevention and treatment effect on rice fulgorid, aphid and sogatella furcifera and use water as substrate, thereby overcoming the shortage that the missible oil preparation uses the toxic solvent such as dimethylbenzene. The invention is safe to the environment, human, poultry and other beneficial organisms, and does not generate chemical injury easily.
Owner:SOUTH CHINA UNIV OF TECH

Method for inducing wing shortening of Sogatella furcifera

The invention relates to a method for inducing the wing shortening of Sogatella furcifera by utilizing an exogenous hormone, namely ZR-515 solution. The adopted technical scheme comprises the following steps of: freezing nymphs of the Sogatella furcifera at 3 to 4 ages, then dripping a small amount of juvenile hormone analogue, namely the ZR-515 solution on the backs of the nymphs, and raising the treated nymphs in a raising container for 2 to 8 days. The invention aims to design a novel, simple and convenient scheme for inducing the wing shortening of the Sogatella furcifera to improve the acquisition of short-winged individuals in the process of raising for experimental research materials, or provide a possible way for applying the method to fields and controlling the migration and dispersion hazard of the Sogatella furcifera in the future.
Owner:SUN YAT SEN UNIV

Flubendiamide and azadirachtin compound pesticide microemulsion as well as preparation method thereof

The invention discloses a flubendiamide and azadirachtin compound pesticide microemulsion as well as a preparation method thereof. The flubendiamide and azadirachtin compound pesticide microemulsion comprises the following components in percentage by weight: 0.1-65% of flubendiamide, 0.1-25% of azadirachtin, 3-22% of emulsifier, 2-16% of penetrant, 1-15% of stabilizer, 2-20% of complex solubilizer and 22-72% of deionized water. The preparation method comprises the steps of firstly mixing flubendiamide, azadirachtin, emulsifier, penetrant, stabilizer and solubilizer in a high-speed shearing machine and evenly stirring, adding deionized water and evenly stirring, then standing for 4 to 13 hours, heating to 43 to 60 DEG C and stirring completely. The microemulsion has remarkable effect of preventing and treating beet armyworm, vegetable-crop pest-insect plutella xylostella and rice sogatella furcifera, in addition, water is used as the matrix in the invention, which overcomes the defect that toxic solvent, such as dimethylbenzene and the like, are used in the missible oil preparation, is safe to the environment, man, livestock and other beneficial organisms without easily generating chemical injury.
Owner:SOUTH CHINA UNIV OF TECH

Compound agent for controlling Sogatella furcifera and synergism evaluation method of compound agent

The invention discloses a compound agent for controlling Sogatella furcifera and a synergism evaluation method of the compound agent. The agent is formed by compounding nitenpyram and Dursban or compounding imidacloprid and isoprocarb. The nitenpyram and the Dursban are prepared in the mass ratio of 1:30 when compounded. The imidacloprid and the isoprocarb are prepared in the mass ratio of 7:40, 7:200, 7:400 or 7:1,000 when compounded. The co-toxicity factor and the co-toxicity coefficient are combined, the nitenpyram and the Dursban as well as the imidacloprid and the isoprocarb are prepared in different ratios, indoor biological assay is performed with a rice-stem dipping method, and a new agent formula ratio is provided for controlling the Sogatella furcifera. The nitenpyram has the good effect on pests with sucking mouthparts, the Durban can control rice planthoppers and rice stem borers such as rice lead rollers, chilo suppressalis and the like, and the nitenpyram and the Dursban can expand the control spectrum when compounded.
Owner:贵州省植物保护研究所

Molecular markers of rice sogatella furcifera resistant gene qWBPH3.2 and application of molecular markers

The invention relates to a molecular marking method of a rice variety sogatella furcifera resistant gene qWBPH3.2. Rice or breeding material DNA is amplified by the molecular marker C3-2122 primer shown in SEQ ID NO.1 / SEQ ID NO.2, the molecular marker C3-2233 primer shown in SEQ ID NO.3 / SEQ ID NO.4, the molecular marker C3-W2 primer shown in SEQ ID NO.5 / SEQ ID NO.6, or the molecular marker C3-W4 primer: SEQ ID NO.7 / SEQ ID NO.8. If the molecular marker C3-2122 primer can amplify a 202 bp amplified fragment, or the molecular marker C3-2233 primer can amplify a 229 bp amplified fragment, or the 866 bp fragment amplified by the molecular marker C3-W2 primer can be digested into two fragments of 268 bp and 598 bp by a restriction enzyme Hap II, or the 954 bp fragment amplified by the molecularmarker C3-W4 primer can be digested into two fragments of 264 bp and 690 bp by the restriction endonuclease Hind III, it indicates the existence of the rice variety sogatella furcifera resistant geneqWBPH3.2. The resistance level of rice to sogatella furcifera can be predicted with the method, and selection efficiency of the sogatella furcifera resistant line is greatly improved.
Owner:NANJING AGRICULTURAL UNIVERSITY

New gene Wbph 9 (t) for resisting rice sogatella furcifera, molecular marking method thereof and application

The invention discloses a molecular marking method for tight interlocking of new gene Wbph 9 (t) for resisting rice sogatella furcifera, and application thereof. Through genetic linkage analysis, a variety F41 of the high resistant sogatella furcifera and a variety laurel 1025 of high sensitive sogatella furcifera to obtain F2 which consists of 3 family groups and recombinant inbred line groups; a rice resistant sogatella furcifera gene Wbph 9 (t) on the #6 chromosome of the rice is accurately positioned; the gene is positioned in a 120kb zone between the molecular marker MG11 and MG 32; the selecting efficiency of 1 molecular market MG21 of the zone for the antigen single plant is about 98%; the molecular market tightly interlocked by Wbph 9 (t) is applied to detect if the insect resisting variety K41 and its derivative variety (series) contains the gene; thus new material for resisting sogatella furcifera can be selected. The invention is applied to the molecular marking of the rice sogatella furcifera resistance so as to assist the seed breeding and pyramiding breeding, so as to perform the gene type selection on the low generation of breeding material in seedling period; thus the breeding efficiency is improved, and the breeding progress is accelerated.
Owner:GUANGXI ZHUANG AUTONOMOUS REGION ACAD OF AGRI SCI

Sogatalla furcifera UDP-N-acetylglucosamine pyrophosphorylase gene segment and application of its dsRNA

InactiveCN108753804ABlocking translationBiocideTransferasesAgricultural sciencePest control
The invention discloses a sogatalla furcifera UDP-N-acetylglucosamine pyrophosphorylase gene segment and application of its dsRNA and belongs to the technical field of insect genetic engineering. Thecandidate gene is provided for sogatalla furcifera RNA mediated pest control strategies, and meanwhile, a theoretical basis is provided for research and development of novel insecticides.
Owner:KAILI UNIV

Gene fragment of chitin synthetase 1 (SfCHS1) of Sogatella furcifera and application of dsRNA of gene fragment in pest control

The invention discloses a gene fragment of chitin synthetase 1 (SfCHS1) of Sogatella furcifera and application of dsRNA of the gene fragment in pest control. A partial sequence of a chitin synthetase1 (SfCHS1) gene is obtained through analyzing a transcriptome database of Sogatella furcifera, cloning and sequencing are carried out on the basis of the partial sequence so as to obtain a nucleotidesequence as shown in SEQ ID NO: 3 in a sequence listing, dsRNA of the gene is synthesized on the basis of the sequence, i.e., SEQ ID NO: 3, thus, a candidate gene is provided for a Sogatella furciferaRNA interference mediated pest control strategy in the future, and meanwhile, a theoretical basis is provided for the research and development of novel insecticides. The invention belongs to the technical field of genetic engineering of insects.
Owner:GUIZHOU UNIV

Bacillus subtilis engineering bacteria resistant to rice white-backed planthopper, preparation method and application

InactiveCN102277328APromote research progressEnhanced anti-insect activityBiocideBacteriaBacteroidesShuttle vector
The invention discloses a Bacillus subtilis engineering bacterium resistant to rice white-backed planthopper and its preparation method and application. The steps are: A. screening and isolation of Bacillus subtilis; B. classification and identification of bacteria: conducting 16SrRNA and Morphological identification; C. Construction of a recombinant vector expressing Pinellia lectin: using Pinellia lectin to construct a secretory expression shuttle vector, pP43NMK and Pinellia lectin encoding genes were digested with PstⅠ and HindⅢ double enzymes to construct a recombinant vector containing Pinellia lectin A vector of a lectin-encoding gene; D. Construction of Bacillus subtilis engineering strain WH2: the constructed pP43NMK-pta plasmid was transformed into Bacillus subtilis by Spizizen method. It has obvious anti-insect activity, the method is simple, Bacillus subtilis can stably colonize in plants, and the recombinant bacteria Bacillus subtilis has obvious anti-white-backed planthopper activity; LB medium, storage: Take the cultured Bacillus subtilis WH2 bacterial liquid and add glycerol to the final concentration for storage.
Owner:HUAZHONG AGRI UNIV

Major QTL for regulating and controlling resistance of sogatella furcifera of rice, molecular marker and application

The invention discloses a major QTL for regulating and controlling the resistance of sogatella furcifera, and belongs to the technical field of rice breeding and molecular biology, the QTL is locatedon chromosome 3 of rice, the genetic distance is 55.98-62.91 cM, and the physical distance is 13058915-14674834 bp; and the invention also discloses a molecular marker closely linked with the QTL. TheQTL and the molecular marker thereof are used for breeding rice with sogatella furcifera resistance, so that the screening efficiency can be improved.
Owner:ZHEJIANG NORMAL UNIVERSITY

Use of tenvermectin in control of harmful insects in agricultural and forest crops

Disclosed herein are compounds tenvermectin A and B and mixtures of compounds tenvermectin A and B for the control of harmful insects in agricultural and forest crops. The tenvermectin A and / or the tenvermectin B of the present invention have a significant control effect on harmful insects in agricultural and forest crops, for example, Bemisia tabaci, Frankliniella occidentalis Pergande, Laodelphax striatellus, Nilaparvata lugens, Sogatella furcifera, Cnaphalocrocis medinalis, rice Chilo suppressalis, rice Scirpophaga incertulas and Coptotermes formosanus Shiraki, and have low toxicity, and are more environmentally friendly and have good application prospects.
Owner:ZHEJIANG HISUN PHARMA CO LTD

Metarhizium flavoviride MFYY090714 and applications thereof

The invention provides a Metarhizium flavoviride MFYY090714 and applications thereof. The Metarhizium flavoviride MFYY090714 is preserved in China General Microbiological Culture Collection Center on April 8th, 2014. The preservation number is CGMCC No.9020. The bacterium strain is a novel bacterium strain separated from the body of sogatella furcifera. The culture is simple, the growth is rapid, the spore yield is high, and the germination rate of the spores is high. The pathogenicity of the Metarhizium flavoviride spore suspension liquid on sogatella furcifera is high, moreover, the Metarhizium flavoviride spore suspension liquid is environment-friendly and pollution-free, does not generate any drug resistance, and can be widely used to control sogatella furcifera in practice.
Owner:YUNNAN AGRICULTURAL UNIVERSITY

Rice seed treatment agent and application thereof

InactiveCN107996583ABoth treatment effect is goodLong durationBiocideAnimal repellantsIntermediate stageBakanae
The invention relates to a rice seed treatment agent and an application thereof. The rice seed treatment agent is composed of a rice seed treatment agent composite, an addition agent and a carrier. The rice seed treatment agent composite is composed of metconazole and imidacloprid. According to the rice seed treatment agent, diseases and insect pests of rice are prevented and treated by treating rice seeds, in particular to rice bakanae diseases, laodelphax striatellus, stenchaetothrips biformis and sogatella furcifera. The rice seed treatment agent is reasonable in component and remarkable ineffect and has the synergistic effect; bacteria and insect pests can be killed at the same time, and diseases and insect pests at the early stage and middle stage of rice growth are effectively reduced; the application amount of pesticide is effectively lowered, and the use frequency of the pesticide is reduced.
Owner:江苏省植物保护植物检疫站

Insecticidal composition containing indoxacarb and cycloxaprid

The invention relates to the pesticide field, and specifically discloses an insecticidal composition containing indoxacarb and cycloxaprid; indoxacarb and cycloxaprid are used as effective components, and the insecticidal composition has an optional dosage form of one of a suspending agent, a microemulsion, an aqueous emulsion, missible oil, a wettable powder and granules. The insecticidal composition is used for prevention and control of beet armyworm, plutella xylostella, cabbage caterpillar, spodoptera litura, cabbage moth, cotton bollworm, oriental tobacco budworm, leaf roller moth, codling moth, leafhoppers, earias, colorado potato beetle and other injurious insects in wild cabbage, broccoli and other crops, has high efficiency on all rice brown planthopper, whitebacked planthopper and small brown planthopper, has good control effect on cabbage aphids and cucumber aphids, also has better assistant prevention effect on rice leaf folder, has the characteristics of high efficiency, low toxicity, low residues, wide insecticidal spectrum, significant synergy, use cost reduction and the like, particularly high efficiency, low toxicity and low residues, and is especially beneficial for production of green foods.
Owner:JINGBO AGROCHEM TECH CO LTD

Sogatella furcifera phosphorus acetylglucosamine mutase gene fragment and application thereof

The invention discloses a sogatella furcifera phosphorus acetylglucosamine mutase gene fragment and application thereof. By analyzing a transcriptome database of a sogatella furcifera, a first phosphorus acetylaminoglucose mutase gene fragment is obtained, and the nucleotide sequence of the first phosphorus acetylaminoglucose mutase gene fragment is shown in the sequence table SEQ ID NO:1. A second phosphorus acetylglucosamine mutase gene fragment with the sequence of SEQ ID NO:4 is selected and is used for synthesizing dsRNA of a gene. The dsRNA is transferred to a body of the sogatella furcifera through a microinjection method, and a target gene can be specifically silenced. Abnormal phenotypes of difficult molting or abnormal phenotypes of eclosion are generated during the growth and development of the sogatella furcifera, death is eventually caused, and the death rate reaches 37% after interference for 5 days. The sogatella furcifera phosphorus acetylglucosamine mutase gene fragment provides candidate genes for the future RNA interference mediated pest control strategy of theogatella furcifera, and provides theoretical basis for researching and developing novel pesticides.
Owner:KAILI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More