New gene Wbph 9 (t) for resisting rice sogatella furcifera, molecular marking method thereof and application

A white-backed planthopper and molecular marker technology, applied in the field of plant molecular genetics, can solve problems such as unclear Wbph1, and achieve the effects of facilitating timely hybridization and breeding, improving the resistance level, and speeding up the breeding process.

Active Publication Date: 2017-03-08
GUANGXI ZHUANG AUTONOMOUS REGION ACAD OF AGRI SCI
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

McCouch et al. (1991) detected RFLP markers RG146 and RG445 that co-segregated with Wbph1, but RG146 and RG445 were multicopy markers, and no other polymorphic markers were detected. It is still unclear which chromosome Wbph1 is on

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • New gene Wbph 9 (t) for resisting rice sogatella furcifera, molecular marking method thereof and application
  • New gene Wbph 9 (t) for resisting rice sogatella furcifera, molecular marking method thereof and application
  • New gene Wbph 9 (t) for resisting rice sogatella furcifera, molecular marking method thereof and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1 : Acquisition of molecular markers

[0027] (1) Gui 1025 / K41 F 2 Construction and phenotyping of family groups and RILs

[0028] 1. In the previous research, we used O. sativa and cultivated rice IR24 hybridization and backcrossing, combined with embryo rescue and molecular marker-assisted selection techniques, to construct a set of O. sativa introductory lines, which were identified and screened for resistance to white-backed planthopper. A rice line K41 with high resistance to white-backed planthopper and stable agronomic characters was obtained. In order to excavate the resistance gene and its closely linked molecular markers in K41, the present invention uses the insect-susceptible variety Gui 1025 as the female parent and the insect-resistant line K41 as the male parent to cross, and the obtained F 1 and then self-intersection, thereby constructing the F 2 separate groups, each F 2 A single plant obtains the corresponding F by selfing 2:3 Family Li...

Embodiment 2

[0045] Example 2 : Verification of Molecular Markers

[0046] (1) Materials and methods

[0047] Negative varieties: 30 copies, the susceptible lines Gui 1025, Lemont, and TN1 are all conventional rice materials preserved in our laboratory, and 27 susceptible lines were among the offspring of the Gui 1025 / K41 hybrid combination.

[0048] Positive varieties: 30 copies, 29 copies of the insect-resistant lines in the offspring of the hybrid combination of insect-resistant lines K41 and Gui 1025 / K41.

[0049] The upstream primer of the primer pair of GM21 is the sequence shown in Seq ID No.3, and the downstream primer of the primer pair is the sequence shown in SeqID No.4;

[0050] Seq ID No.3: AAAGAGATTTATAATCCAAATTTTGGCCA;

[0051] Seq ID No. 4: GCCAAAGTAATTTAGGCCTGA.

[0052] The DNA extraction method and the molecular marker analysis method are the same as in Example 1.

[0053] (2) Results

[0054]Using the above method, PCR amplification was performed on the genomic D...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular marking method for tight interlocking of new gene Wbph 9 (t) for resisting rice sogatella furcifera, and application thereof. Through genetic linkage analysis, a variety F41 of the high resistant sogatella furcifera and a variety laurel 1025 of high sensitive sogatella furcifera to obtain F2 which consists of 3 family groups and recombinant inbred line groups; a rice resistant sogatella furcifera gene Wbph 9 (t) on the #6 chromosome of the rice is accurately positioned; the gene is positioned in a 120kb zone between the molecular marker MG11 and MG 32; the selecting efficiency of 1 molecular market MG21 of the zone for the antigen single plant is about 98%; the molecular market tightly interlocked by Wbph 9 (t) is applied to detect if the insect resisting variety K41 and its derivative variety (series) contains the gene; thus new material for resisting sogatella furcifera can be selected. The invention is applied to the molecular marking of the rice sogatella furcifera resistance so as to assist the seed breeding and pyramiding breeding, so as to perform the gene type selection on the low generation of breeding material in seedling period; thus the breeding efficiency is improved, and the breeding progress is accelerated.

Description

technical field [0001] The invention belongs to the field of plant molecular genetics, and relates to a new rice gene Wbph9(t) resistant to white-backed planthopper and its molecular marker and application. Background technique [0002] White-backed planthopper is an important pest in rice production. It not only directly harms rice, but also spreads other diseases and viruses during feeding, which seriously threatens the safe production of rice in my country. Discovering and identifying new insect-resistant genes and breeding insect-resistant varieties are the most economical and effective means of control. There are only a few reports on the mapping of rice resistance to white-backed planthopper genes. McCouch et al. (1991) detected RFLP markers RG146 and RG445 co-segregated with Wbph1, but RG146 and RG445 were multi-copy markers, and no other polymorphic markers were detected. It is still unclear which chromosome Wbph1 is on. Liu Zhiyan et al. (2001) located Wbph2 on ch...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/29C12N15/11A01H5/00
CPCC07K14/415C12N15/8286
Inventor郭嗣斌李孝琼韦宇刘开强陈颖高国庆
OwnerGUANGXI ZHUANG AUTONOMOUS REGION ACAD OF AGRI SCI