New gene Wbph 9 (t) for resisting rice sogatella furcifera, molecular marking method thereof and application
A white-backed planthopper and molecular marker technology, applied in the field of plant molecular genetics, can solve problems such as unclear Wbph1, and achieve the effects of facilitating timely hybridization and breeding, improving the resistance level, and speeding up the breeding process.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Example 1 : Acquisition of molecular markers
[0027] (1) Gui 1025 / K41 F 2 Construction and phenotyping of family groups and RILs
[0028] 1. In the previous research, we used O. sativa and cultivated rice IR24 hybridization and backcrossing, combined with embryo rescue and molecular marker-assisted selection techniques, to construct a set of O. sativa introductory lines, which were identified and screened for resistance to white-backed planthopper. A rice line K41 with high resistance to white-backed planthopper and stable agronomic characters was obtained. In order to excavate the resistance gene and its closely linked molecular markers in K41, the present invention uses the insect-susceptible variety Gui 1025 as the female parent and the insect-resistant line K41 as the male parent to cross, and the obtained F 1 and then self-intersection, thereby constructing the F 2 separate groups, each F 2 A single plant obtains the corresponding F by selfing 2:3 Family Li...
Embodiment 2
[0045] Example 2 : Verification of Molecular Markers
[0046] (1) Materials and methods
[0047] Negative varieties: 30 copies, the susceptible lines Gui 1025, Lemont, and TN1 are all conventional rice materials preserved in our laboratory, and 27 susceptible lines were among the offspring of the Gui 1025 / K41 hybrid combination.
[0048] Positive varieties: 30 copies, 29 copies of the insect-resistant lines in the offspring of the hybrid combination of insect-resistant lines K41 and Gui 1025 / K41.
[0049] The upstream primer of the primer pair of GM21 is the sequence shown in Seq ID No.3, and the downstream primer of the primer pair is the sequence shown in SeqID No.4;
[0050] Seq ID No.3: AAAGAGATTTATAATCCAAATTTTGGCCA;
[0051] Seq ID No. 4: GCCAAAGTAATTTAGGCCTGA.
[0052] The DNA extraction method and the molecular marker analysis method are the same as in Example 1.
[0053] (2) Results
[0054]Using the above method, PCR amplification was performed on the genomic D...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



