Unlock instant, AI-driven research and patent intelligence for your innovation.

QRBSDV6R resistance gene and application thereof

A resistance gene and resistance technology, applied in the field of qRBSDV6R resistance gene, can solve problems such as lack of information, insufficient understanding of functional genes and molecular mechanisms, and inability to propose molecular regulation strategies

Pending Publication Date: 2022-08-05
JIANGSU ACAD OF AGRI SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, such information is extremely scarce compared to other important rice diseases such as rice blast and bacterial blight
Due to insufficient understanding of the functional genes and molecular mechanisms underlying RBSDV resistance, effective molecular regulatory strategies have not yet been proposed

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • QRBSDV6R resistance gene and application thereof
  • QRBSDV6R resistance gene and application thereof
  • QRBSDV6R resistance gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] 1. Plant materials and their growth conditions, preservation and cultivation of test viruses

[0047] 1) From the rice RPD2 population in 72 countries or regions, 509 rice materials, including indica rice, japonica rice, Aus rice and aromatic rice, were selected for RBSDV resistance identification, and the resistance identification results were obtained, such as figure 1 .

[0048] 2) The transgenic lines were transformed by Agrobacterium tumefaciens-mediated transformation and hygromycin selection. The transgenic lines were transformed by Agrobacterium tumefaciens-mediated transformation and hygromycin selection. All rice lines were grown in a greenhouse at 25h, 70% relative humidity, and 12 / 12h day and night light. Under 25h, 12 / 12h day and night light conditions, Agrobacterium infiltration test was performed on tobacco.

[0049] 3) The rice tested are NPB (Nipponbare) and W44 (VANDANA). W44 can be purchased from the International Rice Research Institute (Internati...

Embodiment 2

[0179] Example 2 qRBSDV R Evaluation of the effect of the encoded protein on the infection of southern rice black-streaked dwarf virus

[0180] 1) qRBSDV R Construction of prokaryotic expression vector of protein and green fluorescent protein GFP

[0181] (1) With qRBSDV6 R CDS sequence (SEQ ID NO. 2) as template, qRBSDV R (DN24)-28a-F (this primer was derived from qRBSDV6 R The position of the 25th amino acid starts to be amplified, and does not contain the signal peptide sequence of the first 24 amino acids of the protein), qRBSDV R -28a-R is the upstream and downstream primers, and the PCR reaction is used to amplify qRBSDV6 R The coding sequence of the protein except the signal peptide; using the plant GFP expression vector as the template GFP-28a-F and GFP-28a-R as the upstream and downstream primers, the GFP coding sequence was amplified by PCR reaction. The primer sequences are:

[0182] qRBSDV R (DN24)-28a-F:

[0183] AGCAAATGGGTCGCCGGATCCCTCACTGAGCAGCATGCAGC;...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a qRBSDV6R resistance gene. The sequence of the qRBSDV6R resistance gene is as shown in SEQ ID NO. 1 or SEQ ID NO. 2, or the sequence of the qRBSDV6R resistance gene has more than 80-90% of homology with the sequence as shown in SEQ ID NO. 1 or SEQ ID NO. 2. The invention further discloses an obtaining method and application of the qRBSDV6R resistance gene. According to the present invention, the transgenic function verification is performed on the susceptible gene qRBSDV6S, the qRBSDV6S in the susceptible variety is knocked out, and the qRBSDV6S is overexpressed in the disease-resistant variety, such that the qRBSDV6S and the qRBSDV6R control the resistance to the RBSDV and the SRBSDV, the qRBSDV6R is proved to be the resistance gene, and the experimental research finds that the qRBSDV6R resistance gene can regulate and control the rice to obtain the resistance to the rice black-streaked dwarf virus and the southern rice black-streaked dwarf virus.

Description

technical field [0001] The invention belongs to the field of plant molecular biology and plant genetic engineering, in particular to a qRBSDV6 R Resistance genes and their applications. Background technique [0002] Rice (Oryza sativa L.) is one of the most important food crops in the world and one of the most important cultivated crops in my country. . [0003] Rice black-streaked dwarf virus (RBSDV) and southern rice black-streaked dwarf virus (SRBSDV) belong to the Fiji virus (Reoviridae), which are transmitted by the white planthopper (SBPH) and the white planthopper (WPH), respectively. Seriously hinder the development of rice and significantly reduce its seed setting rate. In severe cases, the two viruses can even lead to the failure of grain harvests in rice fields, which has become a long-standing problem in rice production. Since its discovery in Japan in 1952, RBSDV has continued to erupt around the world. For example, from 2007 to 2008, the affected area in Ch...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C12N15/10C12N15/84C07K14/415C12Q1/6895A01H5/00A01H6/46
CPCC07K14/415C12N15/8283C12Q1/6895C12Q2600/13
Inventor 周彤刘斌王招云赵均良范永坚周炼孙枫李晨羊周益军
Owner JIANGSU ACAD OF AGRI SCI