QRBSDV6R resistance gene and application thereof
A resistance gene and resistance technology, applied in the field of qRBSDV6R resistance gene, can solve problems such as lack of information, insufficient understanding of functional genes and molecular mechanisms, and inability to propose molecular regulation strategies
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0046] 1. Plant materials and their growth conditions, preservation and cultivation of test viruses
[0047] 1) From the rice RPD2 population in 72 countries or regions, 509 rice materials, including indica rice, japonica rice, Aus rice and aromatic rice, were selected for RBSDV resistance identification, and the resistance identification results were obtained, such as figure 1 .
[0048] 2) The transgenic lines were transformed by Agrobacterium tumefaciens-mediated transformation and hygromycin selection. The transgenic lines were transformed by Agrobacterium tumefaciens-mediated transformation and hygromycin selection. All rice lines were grown in a greenhouse at 25h, 70% relative humidity, and 12 / 12h day and night light. Under 25h, 12 / 12h day and night light conditions, Agrobacterium infiltration test was performed on tobacco.
[0049] 3) The rice tested are NPB (Nipponbare) and W44 (VANDANA). W44 can be purchased from the International Rice Research Institute (Internati...
Embodiment 2
[0179] Example 2 qRBSDV R Evaluation of the effect of the encoded protein on the infection of southern rice black-streaked dwarf virus
[0180] 1) qRBSDV R Construction of prokaryotic expression vector of protein and green fluorescent protein GFP
[0181] (1) With qRBSDV6 R CDS sequence (SEQ ID NO. 2) as template, qRBSDV R (DN24)-28a-F (this primer was derived from qRBSDV6 R The position of the 25th amino acid starts to be amplified, and does not contain the signal peptide sequence of the first 24 amino acids of the protein), qRBSDV R -28a-R is the upstream and downstream primers, and the PCR reaction is used to amplify qRBSDV6 R The coding sequence of the protein except the signal peptide; using the plant GFP expression vector as the template GFP-28a-F and GFP-28a-R as the upstream and downstream primers, the GFP coding sequence was amplified by PCR reaction. The primer sequences are:
[0182] qRBSDV R (DN24)-28a-F:
[0183] AGCAAATGGGTCGCCGGATCCCTCACTGAGCAGCATGCAGC;...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


