20 results about "Aromatic rice" patented technology

The invention discloses application of bacillus albordowii in cultivation for improving the flavor of fragrant rice, and relates to the field of fragrant rice cultivation and planting. According to the application, it is found for the first time that bacillus albordowii has the effect of improving flavor substances of fragrant rice, and when fragrant rice seedlings grow to the three-leaf and one-core stage, the roots of the seedlings are soaked with bacillus albordowii liquid; after the seedlings are transplanted to a field, the bacillus albopastoris bacterial liquid is sprayed to the soil at the roots of the seedlings, 24 main aroma components in the fragrant rice can be increased by 5.56%-12036.00%, the content of 2-ethyl-1-hexanol with rose fragrance is increased by 120 times or above, the content of 2-butyl-1-octanol with flower fragrance is increased by 235.71%, the content of 6, 10-dimethyl-(E)-5, 6-dimethyl-2, 6, 6-tetramethyl-1, 3-pentanedione with fruit fragrance is increased by 235.71%, and the content of 6, 10-dimethyl-(E)-5, 6-tetramethyl-1, 3-pentanedione with fruit fragrance is increased by 235.71%. The content of 2, 9-undecylene-2-ketone is increased by 132.50%, the content of limonene, the content of hexanal, the content of 2-heptanone, the content of 2-tridecanone and the content of 2-pentadecanone are increased by 50% or above, and the content of 2-acetyl-1-pyrroline (2-AP) is increased by 30% or above; the application method is more convenient to operate, and the overall flavor of the rice is improved more remarkably.

This invention belongs to the field of crop cultivation technology, specifically relating to a rice nano-flavor enhancer and its application in rice cultivation. The rice nano-flavor enhancer of this invention is prepared from raw materials such as sodium octenyl succinate starch, sodium ascorbate, and sodium selenite. The prepared octenyl succinate starch-nano-selenium has advantages such as small nanoparticle size and system stability. This flavor enhancer can not only significantly improve the overall aroma of fragrant rice, but also enhance the aroma of non-fragrant rice. Specifically, it can significantly increase the content of volatile aroma compounds such as 2-acetyl-1-pyrroline (2-AP) in fragrant rice grains, and significantly increase the content of volatile aroma compounds such as vanillin, benzaldehyde, and geranylacetone in non-fragrant rice grains. Unlike traditional rice flavor enhancers, the rice nano-flavor enhancer of this invention has better applicability and a wider range of applications, helping to meet the growing market demand for high-quality rice.

The invention discloses a mutant gene OsNRAMP5 capable of reducing cadmium content in rice grains and application of the mutant gene OsNRAMP5. The gene has a genome nucleotide sequence as shown in SEQ ID No.1, and the 8875149th nucleotide on the No.7 chromosome of the wild type of fragrant rice, namely the 10th exon splicing site of the LOCOs07g15370 (OsNRAMP5) gene, is mutated from A to T, so that the gene is subjected to variable splicing in the transcription process. The invention also discloses a protein coded by the nucleotide sequence and used for regulating and controlling low accumulation of cadmium in fragrant rice grains, and the protein has an amino acid sequence as shown in SEQ ID No.3. The OsNRAMP5 gene for regulating and controlling the accumulation of the harmful heavy metal element cadmium is cloned in the fragrant rice by utilizing a forward genetics technology, and the mutant gene not only can improve the content of fragrant substances in the fragrant rice, but also can greatly reduce the content of cadmium in the rice, so that the quality safety of the fragrant rice is ensured.

The invention belongs to the technical field of crop cultivation, and particularly relates to a rice aroma-enhancing and yield-increasing agent and application thereof, and the rice aroma-enhancing and yield-increasing agent comprises a primary aroma-enhancing and yield-increasing agent and a secondary aroma-enhancing and yield-increasing agent; the primary aroma and yield increasing agent is jasmonic acid methyl ester with the concentration of 50 [mu] mol / L-100 [mu] mol / L; the formula of the secondary aroma-enhancing and yield-increasing agent is as follows: each liter of the secondary aroma-enhancing and yield-increasing agent contains 0.8 to 1.2 g of ornithine, 25 to 35 mmol of trehalose, 1.0 to 1.4 g of vitamin B1, 1.8 to 2.2 g of vitamin B5, 1 to 3 mg of nano zinc oxide, 4 to 6 mg of sodium selenite, 1 to 3 g of KH2PO4 and the balance of water. The rice aroma-enhancing and yield-increasing agent disclosed by the invention has excellent performance when being applied to three aromatic rice varieties, the 2-AP content is remarkably increased, the yield is kept stable and even slightly increased, and the contradiction between aroma enhancement and yield reduction is successfully solved. The whole set of scheme is synergistic in component, simple and convenient to operate, environment-friendly, good in stability and universality and suitable for large-area production, popularization and application.

This invention discloses a method for improving the aroma of regenerated fragrant rice. Belonging to the field of crop cultivation technology, this method significantly increases the content of the aroma compound 2-acetyl-1-pyrroline (2AP) in regenerated fragrant rice by simultaneously applying paclobutrazol or uniconazole (two plant growth regulators) during the tillering fertilizer application for the first-season fragrant rice, applying urea as a bud-promoting fertilizer before harvesting the first-season fragrant rice, and controlling the harvesting timing and stubble height of the first-season fragrant rice. Simultaneously, it can stabilize or increase the yield of fragrant rice, achieving stable or increased yield while improving the aroma. This invention is beneficial for improving the rice quality of regenerated fragrant rice and promoting its production.

The invention discloses an intelligent management method for rice planting and fertilization. The intelligent management method is jointly constructed by a hereditary characteristic analysis module, a field data acquisition module, an intelligent decision-making module and a precise fertilization operation module. The method has the advantages that 1) genetic information identification of rice germplasm resources and variety breeding characteristics are brought into a fertilization decision core, so that genetic-environment-cultivation multi-dimensional coupling optimization is realized; the method has the advantages of being simple in operation, convenient to operate, capable of achieving fertilization precision, quality specialization and benefit maximization according to the quality forming rule of special varieties (such as rice flour rice, selenium-rich rice and morning and evening fragrant rice), improving the fertilizer utilization rate through real-time monitoring and dynamic feedback, and enabling the quality of the special rice to be more stable.

1. Name of the designed product: rice bag (soft aromatic rice). 2. Use of the designed product: bag for packing rice. 3. Design points of the designed product: combination of shape and pattern. 4. Picture or photo showing the design points: front view. 5. The designed product is a thin product, and the left view, right view, top view and bottom view are omitted. 6. Other circumstances needing explanation: the gray part in the rear view is made of transparent material.

The application discloses a rice stigma width regulation gene qSTB-8 and application of an encoded protein thereof, a nucleotide sequence of the rice stigma width regulation gene qSTB-8 is shown as SEQ ID NO. 1, and the application is selected from any one or two or more of the following: (1) application in regulation of rice stigma width; (2) application in improvement of rice stigma exposure rate breeding; (3) application in improvement of rice cross-pollination rate breeding. The application is configured by hybridization of a wide-stigma indica rice maintainer line Chuan 345B and a narrow-stigma high-quality indica rice maintainer line Chuan 106B into a BC4F5 positioning population, then a method of map-based cloning is used, SSR molecular markers are used for preliminary positioning, and finally qSTB-8 is finely positioned in a 11.2 kb segment between markers SG930 and SG950. Gene function analysis of qSTB-8 shows that a transgenic line Chuan 106B has a wide-stigma trait.

1. Name of the designed product: packaging bag (Gufu Fosangtangluan Original Aromatic Rice). 2. Use of the designed product: for food packaging. 3. Design points of the designed product: in the pattern. 4. Picture or photo that best indicates the design points: front view. 5. The designed product is a flat product, omitting left view, right view, top view, and bottom view.

The invention discloses a fragrant rice flavor enhancer as well as a preparation method and application thereof. The invention relates to a fragrant rice flavor enhancer, which takes water and ethanol as solvents, and comprises 50-80 g / L of glycosaminoglycan, 2-10 g / L of iodine and 2-8 g / L of sophora alopecuroide total alkaloids. According to the fragrant rice flavor enhancer based on the glycosaminoglycan chelated iodine and the sophora alopecuroide total alkaloids, all the components have a synergistic effect according to a certain proportion, and the yield of rice can be effectively increased through cooperation of the glycosaminoglycan and the sophora alopecuroide total alkaloids with proper concentrations. The exogenous iodine element has the effect of promoting synthesis of fragrant substances of the fragrant rice, the iodine element can be more effectively absorbed by rice leaves in an organic state through the process of chelating the amino polysaccharide with the iodine element, and the utilization rate of the iodine element is increased, so that the fragrance of the fragrant rice is improved. The components of the fragrant rice flavor enhancer provided by the invention are all biologically extracted, and the fragrant rice flavor enhancer is environment-friendly, safe and free of hidden dangers.

The invention relates to a breeding method of a fragrant temperature-sensitive two-line rice sterile line. The breeding method comprises the following steps: step 1, parent selection; step 2, hybridization; step 2, F1-generation planting and selfing; 3, molecular detection and selection of the F2 generation; and 4, subsequent generation breeding. The fragrant two-line rice sterile line bred by the invention not only has a stable sterility characteristic, can be used for hybrid rice seed production, but also has unique fragrance, enriches the types of rice varieties, and meets the requirements of the market on high-quality fragrant rice.

The invention relates to the technical field of wine brewing, and particularly discloses sparkling yellow wine and a preparation method thereof. The preparation method of the sparkling yellow wine comprises the following steps: soaking the proso millet and the dried flowers together, and carrying out solid-liquid separation on the mixture to obtain aromatic rice milk and a solid mixture; cooking the solid mixture, spraying part of aromatic rice milk during cooking, and collecting aromatic liquid; fermenting the steamed and aired material by using wheat koji prepared from red dates, longan and wheat to obtain primary fermented glutinous rice; taking upper-layer wine liquid of the primary fermented glutinous rice as yellow rice wine base liquor, and distilling lower-layer distillers' grains to obtain distillers' grain fragrance white spirit; reducing the alcohol content of the yellow wine base liquor by adopting aromatic liquid; fermenting the grape juice to obtain wine base liquor, mixing the wine base liquor, the wine base liquor and the vinasse-flavor white spirit after the alcohol content is reduced, and clarifying at low temperature to obtain foaming blended base liquor; fermenting the sparkling blending base liquor twice, and then standing and storing at 4-6 DEG C to obtain the sparkling yellow wine. The sparkling yellow wine has the characteristics of prominent flower fragrance and fruit fragrance, mellow taste and meticulous and elegant sparkling.

The application belongs to the technical field of rice planting, and discloses a mutant type OsBadh2 gene of aromatic rice and an identification method, application and primer thereof. A sequence of the 8th chromosome OsBadh2 gene of Nipponbare rice IRGSP-1.0 version is used as a basic sequence, 21 base pairs of CTTGGTATTTCACATTTTTCT are deleted from the basic sequence at the 20381692th base on the 8th chromosome of the rice, and the mutant type OsBadh2 gene of aromatic rice is obtained. The identification method of the gene, the application of the gene in breeding of a male sterile line of aromatic hybrid rice suitable for mechanized seed production, and corresponding primers are disclosed. Significant technical effects are achieved, and a modified line of aromatic rice suitable for mechanized seed production is finally obtained, which not only saves identification time and cost, but also facilitates crop improvement and germplasm innovation of aromatic varieties, and has significant progress significance.

Plants, seeds and tissue cultures of the long grain aromatic rice cultivar RT22J502, and methods for producing a rice plant by crossing a rice plant of rice cultivar RT22J502 with itself or with another rice plant, such as a plant of another rice variety or rice hybrid, are disclosed.

The invention belongs to the field of rice germplasm resource science, and particularly relates to an excellent local rice germplasm resource Sichuan Dechang fragrant rice fragrance gene as well as an identification method and application thereof. According to the Dexchang fragrant rice OsBADH2 gene, a genome of Nipponbare rice is taken as a reference genome, and a seventh exon of the Dexchang fragrant rice OsBADH2 gene is subjected to 5bp base insertion and 13bp base deletion. The method comprises the following steps: carrying out molecular marking on a Dhuchang fragrant rice OsBADH2 gene, amplifying a fragrant gene of the Dhuchang fragrant rice, and carrying out electrophoresis detection on a banding pattern and sequences of a second exon and a seventh exon of the fragrant gene. The method is beneficial for determining whether the rice is a genotype with fragrance or not, and important high-quality resources are provided for cultivation of fragrant rice varieties and development of high-end fragrant rice products.

The application belongs to the technical field of aromatic rice cultivation, and specifically discloses a method for improving the accumulation of aroma in aromatic rice, which comprises the following steps: adding low-concentration zinc sulfate modified biochar to the substrate for seedling raising to improve the photosynthetic rate and biomass of seedlings, and spraying a high-molecular foliar fertilizer composed of gamma-polyglutamic acid and chitosan at the booting stage to improve the glutamic acid absorption efficiency of the aromatic rice, increase the foliar absorption, increase the accumulation of nitrogen sources and polyamines, and thus improve the content of 2-acetyl-1-pyrroline in the grains, so as to improve the accumulation of aroma during the formation of the grains. The method is low in cost, and the yield and aroma quality of the treated aromatic rice both reach a double-effect level.

1. Name of the product in this design: Packaging bag (Daoshengmei Organic Crab Field Fragrant Rice). 2. Intended use of this design: for packaging bags. 3. The key design features of this product are the combination of shape and pattern. 4. The image or photograph that best illustrates the design's key points: the front view. 5. This design is for a thin product; other views are omitted. 6. Other situations requiring explanation: Other explanation: Gray areas in the view represent transparent materials.

The present invention relates to the field of rice breeding, and in particular to a poly-breeding method for a three-line sterile rice with low amylose content and soft fragrance. The method comprises the following steps: a hybrid of an excellent maintainer material Zhenshan 97B and Zaoxiang No. 1 with an early growth period and strong fragrance to obtain an F1 generation as parent A; a hybrid of the maintainer material Xieqingzao B and Bo B with rice blast resistance, good rice quality, fragrance and good stigma exposure to obtain an F1 generation as parent B; and a rice material with an amylose content of about 15%, a reduction value of more than 5.0 and strong fragrance to be bred as parent C through full-process tracking of independently developed functional molecular markers. The sterile rice variety finally bred has good rice quality and appearance, is soft and delicious, and does not go stale when cold, thereby meeting the market demand for fragrant and soft rice products.