1033 results about "Gene Mutant" patented technology

The identification of a novel mutation in the testis specific Y-like gene and association of the mutation with SIDDT syndrome are disclosed. Methods for diagnosing SIDDT syndrome are disclosed. Methods for identifying compounds for use in the diagnosis and treatment of disorders associated with mutation in the TSPYL gene are also disclosed. The invention therefore provides nucleic acid sequences, genes, polypeptides, antibodies, vectors containing the gene, host cells transformed with vectors containing the gene, animal models for the disease, methods for expressing the polypeptide, genetic screening methods and kits, diagnostic methods and kits.

The present invention relates to genetic mapping of complex quantitative and qualitative traits. This invention more particularly relates to methods to identify identical DNA fragments from two different DNA sources. The method allows the amplification of the DNAs, their, labelling, and the separation of perfectly matched DNAs from imperfectly matched DNAs or from DNAs formed through hybridisation from the same source (e.g., homohybrids). The invention can be used to identify genes or gene mutations, which are relevant to pathological conditions or particular traits.

The invention discloses a primer and probe for detecting a human epidermal growth factor receptor (EGFR) gene and / or a K-ras gene, a kit containing the primer and the probe and a device for detecting genetic mutation on the basis of a digital PCR platform.The method for detecting the genetic mutation by means of the primer and the probe comprises the steps that the prime and the probe are provided; DNA of a sample to be detected is extracted; a fluorescent PCR reaction system capable of amplifying a mutant gene sequence is prepared; a target probe and an internal reference probe are utilized to be hybridized with amplified products respectively, and fluorescent signals of corresponding fluorescent groups are detected; existence of the genetic mutation is judged and / or the mutation rate is calculated according to the strength and proportion of the fluorescent signals of the target probe and the internal reference probe.According to the method for detecting the genetic mutation, the needed primers and probes are small in number, the optimization procedure is simple, related mutation of EGFR and / or K-ras gene can be qualitatively or quantitatively detected, and the detection sensitivity is high; a DNA sample with low initial amount can also be detected stably.

The invention provides primers, probes, kit and method for detecting human EGFR (epidermal growth factor receptor) gene mutations. The method comprises the following steps of: (1) providing the primers and the probes; (2) processing detected samples and extracting DNA (deoxyribonucleic acid); (3) carrying out fluorescent quantitation on components of a PCR (polymerase chain reaction) system; (4) amplifying target sequences of an EGFR gene mutation to be detected; and (5) distinguishing wild type genes and mutant type genes by utilizing ARMS (amplification refractory mutation system) primers and judging results via the fluorescence intensity of an FAM and a JOE. The primers, probes and method provided by the invention have the beneficial effects that 29 kinds of mutations on the EGFR genes can be simultaneously detected, so that the sensitivity is high, the specificity is strong and the detection speed is high; and the whole detection process only takes 60 minutes.

The invention discloses a nucleic acid composition for detecting novel coronavirus COVID-19 and application. The nucleic acid composition is prepared by the following steps: firstly, carrying out nucleic acid sample amplification based on a transcription-mediated amplification technology (TMA); then, specifically detecting amplified virus target nucleic acid in combination with activity of 'associated cleavage' of CRISPR-Cas13a protease; adding sgRNA, Cas13a protein, an ssRNA signal report probe and a reaction buffer solution into a reaction system containing target nucleic acid to be detected; and reading and detecting signals when the reaction is carried out so as to detect a target gene. By using the method disclosed by the invention, whether a sample contains a target nucleic acid sequence or not can be rapidly detected; and the nucleic acid composition is combined with the transcription-mediated nucleic acid amplification technology, so that the sensitivity of the detection methodcan reach a nanomole level, and the nucleic acid composition for detecting the novel coronavirus COVID-19 is suitable for rapidly detecting pathogenic microorganisms, gene mutation, specific target RNA and the like.

The invention discloses an artificial fixed-point rice dense and erect panicle (DEP1) gene mutant body and application thereof. The rice DEP1 gene mutant body as well as a corresponding allele is obtained by modifying a 5th exon of a DEP1 gene by adopting a CRISPR / Cas9 gene targeting modification technology, so that a base of the 5th exon is replaced, lost and inserted. The artificial fixed-point rice DEP1 gene mutant body and the application thereof disclosed by the invention have the benefits that the artificial mutation is performed on the 5th exon of the rice DEP1 gene by adopting the CRISPR / Cas9, and the mutant body capable of obviously improving the rice yield and the allele are screened; the DEP1 gene mutant body disclosed by the invention as well as the corresponding allele can improve the yield of rice plants by 13-51 percent and is even superior to a natural mutation type.

The invention discloses a preparation method of a zebrafish notch2 gene mutant. The preparation method includes: determining positions of knock-out target spots of the notch2 gene; utilizing pUC19-gRNA scaffold plasmid as a template, and performing PCR (polymerase chain reaction) amplification with primers T7-notch2-sfd and tracr rev; subjecting a PCR product to purification and in-vitro transcription to obtain gRNA (guide ribose nucleic acid); introducing the gRNA and Cas9 protein into a cell-stage embryo of zebrafish through micro-injection, and screening to obtain the notch2 gene mutant stable in inheritance. The preparation method has the advantages that by the aid of the CRISPR / Cas9 (clustered regularly interspersed short palindromic repeats, CRISPR / CRISPR-associated genes, cas gene)technology, and by means of selecting a specific section of targeting domain, the notch2 gene in the zebrafish is knocked out, other genes are protected from being 'injured accidentally', the zebrafish without the Notch2 gene is formed, experimental materials are provided for in-depth study on follow-up gene functions, and great significance is achieved on study of Notch signal channels.

The present invention provides compositions and methods for the detection and characterization of mutations associated with cystic fibrosis. More particularly, the present invention provides compositions, methods and kits for using invasive cleavage structure assays (e.g. the INVADER assay) to screen nucleic acid samples, e.g., from patients, for the presence of any one of a collection of mutations in the CFTR gene associated with cystic fibrosis. The present invention also provides compositions, methods and kits for screening sets of CFTR alleles in a single reaction container.

The invention belongs to the field of biological medicines, and relates to a method for screening HRDs disease-causing mutation and a gene chip hybridization probe designing method involved in the same. The method for screening the HRDs disease-causing mutation comprises the steps of (1) establishing an HRDs genetic resource repository; (2) designing and synthesizing a gene chip hybridization probe of an HRDs disease-causing gene, and integrating the gene chip hybridization probe onto a gene chip; (3) capturing a target area by utilizing the prepared gene chip and executing the depth sequencing; (4) analyzing the sequencing data on the aspect of bioinformatics, and screening the candidate disease-causing gene; (5) functionally predicting a newly-discovered splicing gene mutation site. By establishing the high-efficient HRDs target gene capturing technology, adopting the depth sequencing as a means and confirming the efficiency of the HRDs capturing chip, a high-efficient credible biological information analysis model is established.

The present invention belongs to the field of biotechnology, and discloses one method of in vitro determining whether to have RET gene variation in the nucleic acid sample, one kit for determining RET gene variation and one process of obtaining RET gene amplifying product. The method of the present invention is accurate, simple, fast and stable.

The invention discloses a preparation method of a zebrafish notch1b gene mutant. The preparation method includes: determining positions of knock-out target spots of the notch1b gene; utilizing pUC19-gRNA scaffold plasmid as a template, and performing PCR (polymerase chain reaction) amplification with primers T7-notch1b-sfd and tracr rev; subjecting a PCR product to purification and in-vitro transcription to obtain gRNA (guide ribose nucleic acid); introducing the gRNA and Cas9mRNA into a cell-stage embryo of zebrafish, and culturing to obtain the notch1b gene mutant stable in inheritance. Thepreparation method has the advantages that by the aid of the CRISPR / Cas9 (clustered regularly interspersed short palindromic repeats, CRISPR / CRISPR-associated genes, cas gene) technology, and by meansof selecting a specific section of targeting domain, the notch1b gene in the zebrafish is knocked out, other genes are protected from being 'injured accidentally', the zebrafish without the Notch1b gene is formed, and great significance is achieved on study of Notch signal channels.

The present invention discloses primers, probes, a detection system and a kit for one time detection of lung cancer multiple genes, wherein the primers, the probes, and the distribution way for detecting 18 EGFR gene mutations, 7 KRAS gene mutations, BRAF V600E gene mutation, 5 fusion genes of ALK5, and 9 fusion genes of ROS1 are provided. According to the present invention, the detection kit adopts the 12 linking PCR reaction strip design, each 12 linking PCR strip detects multiple genes of a sample, the corresponding detection reagents and the internal control reagents are filled in the pipes 1-11 of the 12 linking PCR strip, the mutation is indicated by the FAM signal, and the internal control is indicated by the HEX (or VIC) signal; the pipe 12 is adopted as the DNA extraction quality external control detection pipe and is indicated by the FAM; and with the primers, the probes, the detection system and the kit, the one-time detection of the lung cancer EGFR / KRAS / BRAF / ALK / ROS1 gene can be achieved, such that the detection time is substantially shortened, the sensitivity is high, the specificity is strong, the operation is simple and rapid, and the reference for selection of tumor targeting drug therapy on lung cancer patients can be provided for clinician.

The invention relates to a gene, mutant plasmid and engineering bacteria which have improved synthesis performance to penicillin G acylase and are obtained by a gene site-directed mutagenesis method, and mutant enzyme can also be obtained with improved synthesis performance to penicillin G acylase by fermenting and purifying the engineering bacteria. Two enzymes Kpn I and Pst I are firstly used for cutting pUC18 by the invention, then T4 polymerase is adopted to make the ends blunt, and pZ01 is obtained through self-linkage; the enzyme of EcoR I is used for cutting pZ01, and then connected with pEES102 that is also cut by the enzyme of EcoR I, thereby obtaining the recombinant plasmid pY020; the pY020 is adopted as a template plasmid, and TaKaRa MuTanBEST Kit is utilized for conducting the site-directed mutagenesis to B.megaterium PGA, thereby obtaining the mutant plasmid with improved synthesis performance to the penicillin G acylase. The mutant plasmid is transformed to bacillus subtilis to obtain the required engineering bacteria. The engineering bacteria are amplified and fermented, and the mutant enzyme with improved maximum conversion rate of 7-ADCA and the ratio of synthetic product / hydrolysate can be obtained after the engineering bacteria are purified.

The invention discloses a primer, a probe, a locked nucleic acid probe, a kit and a detection method for detecting C-kit gene mutation, belonging to the technical field of biology. The primer and probe for detecting C-kit gene mutation comprise at least one of a primer and probe of a C-kit gene No.9 exon for detecting a No.9 exon of a C-kit gene, a primer and probe of a C-kit gene No.11 exon for detecting a No.11 exon of the C-kit gene, a primer and probe of a C-kit gene No.13 exon for detecting a No.13 exon of the C-kit gene, and a primer and probe of a C-kit gene No.17 exon for detecting a No.17 exon of the C-kit gene. The kit comprises the primer and the probe. The primer and probe can be used for highly-sensitively detecting whether the C-kit gene has mutation, meanwhile, the sensitivity of detecting the C-kit gene mutation can be greatly improved by adopting the locked nucleic acid probe, and whether the C-kit gene is mutated can be accurately detected by adopting the kit.

The present invention relates to a method for detecting PKD1 gene mutation. The method utilizes sequence information of the PKD1 gene, designs nine pairs of PCR tag primers, and uses a long-chain PCR technology for targeting amplification of PKD1 gene; while amplification products are labeled, PCR products are purified and mixed for direct construction of a single SMRTBell library; a PacBio RSII sequencer is employed for sequencing; and bioinformatic analysis is carried out to obtain PKD1 gene mutation information. The invention has the beneficial effects that a simplified pair of primers is designed and combined with tag primer technology to realize respective marking of PCR products of multiple DNA samples; the amplified PCR products do not need to perform knockout and can be directly used for the library construction, and the library construction does not need extra PCR, so that a plurality of samples are mixed into one library and processed simultaneously by a PacBio RSII sequencing library construction link, and the experimental operation is greatly simplified.

The invention provides a primer set, a kit and a detection reaction system for detecting PKD1 gene mutation through the long fragment PCR and high-throughput sequencing technology, a non-diagnosis-purpose method for external PKD1 gene mutation detection, a non-diagnosis-purpose method for external PKD1 gene analysis and a method for detecting new mutation sites on the PKD1 gene. According to the method, the primer set is used for carrying out long fragment PCR amplification on the PKD1 gene of a sample, and detecting or analyzing is carried out through high-throughput sequencing. The autosomal dominant genetic polycystic nephrosis (adult polycystic nephrosis) can be diagnosed through the assistance of a detection result, previous unknown new mutation on a plurality of PKD1 real genes can be obtained and supplied to doctors or researchers so that the relevance between the mutation and the adult polycystic nephrosis can be studied.

The invention discloses a method for detecting gene mutation genotyping based on a Taqman-ARMS (Amplification Refractory Mutation System) technology, relating to the field of molecular biology. According to the method, an ARMS mutation enrichment technology and a Taqman-MGB (Minor Groove Binder) specificity fluorescence detection technology are combined, a mutation target sequence is subjected to specificity PCR (Polymerase Chain Reaction) amplification by using an ARMS primer, a Taqman-MGB probe is used for carrying out specificity locus detection on an amplification product, and specific mutation is identified on the basis of Real-time PCR. Compared with mutation detection technologies such as direct sequencing, chip detection and the like, the method has the advantages of strong specificity, high sensitivity, simplicity and rapidness in operation, high flux and the like when used for detecting gene mutation.

The invention relates to the technical field of biology and particularly relates to a non-treatment-purpose method for screening mutation of pathogenic genes relevant with hypertrophic cardiac myopathy. The method comprises the following steps: (1) extracting genomes; (2) carrying out multiplex PCR amplification on target genes; (3) constructing a target gene library; and (4) sequencing the target gene library by virtue of a next-generation semiconductor sequencing platform, and screening gene mutation sites relevant with the hypertrophic cardiac myopathy. The method is simple, convenient, rapid and low in cost, multiple samples can be detected once, the foundation is laid for the screening of the hypertrophic cardiac myopathy, and the road is exploited for the clinic molecular diagnosis.

The invention discloses primers, a kit and a method for detection of human BRCA1 and BRCA2 gene mutation. The upstream primers are in a sequence shown as SEQ ID NO: 1,3,5,7,9-193, and meanwhile the universal primer Tag1 is added to the 5' end of the sequence; the downstream primers are in a sequence shown as SEQ ID NO: 2,4,6,8,10-194, and meanwhile the universal primer Tag2 is added to the 5' end of the sequence. The upstream primers with a P5 sequence and a sequence shown as SEQ ID NO: 221-236 and the downstream primers with a P7 sequence and a sequence shown as SEQ ID NO: 197-220 are also included. Through the primers, the kit and the method, mutation of all exons of BRCA1 and BRCA2 genes, a connection region between the exons and introns, an untranslated region and a promoter region can be detected rapidly, accurately, easily and conveniently.

The invention discloses a gene editing technique taking Argonaute nuclease as a core. In the presence of guide DNA (Deoxyribose Nucleic Acid), Argonaute endonuclease can cut any locus of a targeted DNA sequence, including a genome of a mammal to cause breakage of DNA double chains, thereby fulfilling an editing aim. Editing means include incision, deletion, mutagenesis induction, exogenous sequence insertion, fragment substitution and the like. Editing effects include gene inactivation, gene mutation, exogenous gene induction and the like. The protein can serve as an important tool for genome editing. A gene editing tool taking the protein as the core has the characteristics of easiness in operation, high efficiency, low target missing rate and high fidelity. Moreover, almost any genome locus can be effectively targeted and cut by the Argonaute nuclease. By using the technique, high-specificity and high-efficiency genome targeted editing is helpfully realized.

The invention provides a method and a kit for detecting a drug resistance gene mutant type of tuberculous bacillus (TB). Compared with the prior art, the invention has the following advantages: 1) reagents and consumables used in the invention are simple and stable, and expensive reagents like fluorescent dyes and special enzyme are not needed; 2) a reaction can be carried out in a microscale system, and usage of a sample and a variety of consumables is reduced; 3) since mass spectrometry is used for direct detection of molecular weight (a mass-to-charge ratio) of DNA and direct determination of types of bases (i.e., no need for signal conversion in any manner), it is theoretically practicable that identification can be realized as long as one copied amplified DNA fragment is amplified, so high sensitivity is obtained; and 4) since mass spectrometry also has the characteristics of automatic and high-flux detection and the like, combination of mass spectrometry and multi-primer extension enables a plurality of drug resistance sites to be simultaneously detected in one reaction system, thereby substantially reducing workload and increasing detection flux.

The invention discloses a method of detecting 26311 Mutation of COL7A1 gene and a usage thereof. The method adopts primers of p87F (TGGGCCTGAAATATGAGGAG) and P87R (TAGGCCACTGGAGAGACAGG) to PCR-amplify COL7A1 gene including the section of 26251-26350, implements the sequence after the purification of products, or uses BslI for the endonuclease detection after using p87Fa (TCCCACGGGGGCCCCTGGACAG) and P87Ra (TCCCCCGCCCCCACCCT GCCA) for the nest amplification of the PCR products. The usage is the application in preparations or gene chips for detecting the diagnosis of dominant dystrophic epidemolysis bullosa genealogy. The invention provides a novel way for the prenatal diagnosis of the bullosa and provides a basis for the gene therapy.

The invention discloses a combined primer for screening human deafness gene mutation. The combined primer comprises a combined forward primer and a combined reverse primer, wherein the combined forward primer consists of two parts namely a joint part P1 sequence and a forward primer sequence, and the combined reverse primer sequentially consists of a joint part P2 sequence, a label sequence and a reverse primer sequence. The invention also discloses a kit for screening the human deafness gene mutation. The invention also discloses applications of the combined primer and the kit in preparation of a reagent for screening the human deafness multi-gene mutation. A primer containing the label (Barcode) sequence is used for differentiating different samples, and at least 32 samples can be detected by performing a method provided by the invention once, so that combined primer can be widely applied to general investigation of deafness susceptible genes. The price of the combined primer disclosed by the invention is far lower than that of imported instruments or reagents, so that the sequencing cost is greatly reduced and then the detection cost is also greatly reduced.

The invention relates to a method and kit for detecting gene mutation, and specifically relates to a method and kit for detecting PIK3CA gene mutation. The invention is characterized in that the kit comprises two specific probes for performing genotyping on a 9 exon and a 20 exon of the PIK3CA gene, wherein the specific probe for the 9 exon contains a nucleotide sequence of E545K and E542K codons, and the specific probe for the 20 exon contains a nucleotide sequence of an H1047R codon. By using the conventional PCR (polymerase chain reaction) amplification in combination with the Cold-PCR amplification product enrichment technology and the high-resolution melting curve analysis technology, the kit provided by the invention can complete the judgment on the genotyping of a sample.

The invention relates to a silkworm fibroin heavy-chain gene mutation method, which specifically comprises the step of: acting mRNA (Messenger Ribonucleic Acid) of a coded zinc-finger nuclease sequence on loci 1325-1362 of a silkworm fibroin heavy-chain gene shown as SEQ ID NO:1 to form target positions for recognizing zinc-finger nuclease, thereby obtaining a series of silkworm fibroin heavy-chain mutated genes; and the mutated sequence can be applied to preparation of sericin and extrinsic proteins. Mutants provided by the invention have the following advantages that: (1) a posterior division of silkgland of a fibroin heavy-chain gene mutant provided by the invention serious degrades, a cocoon shell only contains the sericin synthesized and secreted by a middle division of silkgland, if the mutated strains are utilized to transgenically express the extrinsic proteins, the expressed amount and the purity of the extrinsic proteins can be greatly increased, and thus, a brand-new useful genetic material is provided for the development of a silkworm fibroin bioreactor; and (2) the cocoon shell of the mutated strain provided by the invention only contains the sericin, and thus, a new source is provided for the large-scale production of the sericin.

The invention relates to a fluorescent PCR detection kit for the IDH1 / IDH2 (isocitrate dehydrogenase 1 / isocitrate dehydrogenase 2) gene mutation and application thereof, and particularly provides a nucleotide sequence used for detecting the IDH1 / IDH2 gene mutation, a kit with the nucleotide sequence and the application of the kit to detection of the IDH1 / IDH2 gene mutation. The nucleotide sequence comprises a specific ARMS (Amplification Refractory Mutation System) primer, a general mutation detection TaqMan probe and a nucleic acid amplification retardation primer. The kit can be used for quickly detecting the IDH1 / IDH2 gene mutation with high throughput and at a low cost, is high in sensitivity, good in specificity, low in pollution and quick and safe to operate, can be suitable for high-sensitivity detection of trace mutation in general clinic samples such as fresh frozen tissues and paraffin tissues, especially non-traumatic serums or plasma samples in addition to pathological tissues.

The invention discloses primers for detecting ApoE gene polymorphism, a kit and a PCR (polymerase chain reaction) method for the primers or the kit. The primers include two sets of primers for detecting an rs429358 site and an rs7412 site respectively; the first set of primers include a mutant-type specific upstream primer of the rs429358 site, a wild-type specific upstream primer of the rs429358 site and a first downstream primer shared by the mutant-type specific upstream primer and the wild-type specific upstream primer of the rs429358 site; the second set of primers include a mutant-type specific upstream primer of the rs7412 site, a wild-type specific upstream primer of the rs7412 site and a second downstream primer shared by the mutant-type specific upstream primer and the wild-type specific upstream primer of the rs7412 site. The kit has the advantages of simplicity, quickness, accuracy and low price for detection and the like, and provides a powerful tool for scientific research and clinical analysis of ApoE gene typing and gene mutation.

The invention discloses a fusion protein of melittin and human mutant interleukin-2, which is characterized in that, a linker peptide gene is used to link the encoding genes of human mutant IL-2 and melittin. The invention can be used to screen cloning capable of improving CD8+T cell mediated CTL reactivity of the body after the tumor formation, the fusion protein can be used fine genetic medicament for the treatment of tumors.

The invention relates to a panicle size controlling gene SSP1 (Small and Sheathed Panicle 1) and a mutant gene ssp1 thereof, and action mechanism thereof in regulating plant height, leaf included angle and panicle size, and provides a gene sequence SEQ IDNO: 3 from the panicle size controlling gene mutant ssp1. The invention also relates to homologous genes of the panicle size controlling gene mutant ssp1 in barley, wheat, maize, corn, sorghum, soybean, cotton, rape, arabidopsis and other plants. The above mentioned genes are all referred to as panicle size controlling genes. The invention also relates to applications of the SSP1 gene and the mutant ssp1 gene in controlling plant height, improving lodging resistance, reducing leaf angle to improve photosynthetic efficiency, changing gibberellin response, suppressing panicle sprouting and breeding.