989 results about "Gene Mutant" patented technology

The present invention relates to genetic mapping of complex quantitative and qualitative traits. This invention more particularly relates to methods to identify identical DNA fragments from two different DNA sources. The method allows the amplification of the DNAs, their, labelling, and the separation of perfectly matched DNAs from imperfectly matched DNAs or from DNAs formed through hybridisation from the same source (e.g., homohybrids). The invention can be used to identify genes or gene mutations, which are relevant to pathological conditions or particular traits.

The invention discloses a primer and probe for detecting a human epidermal growth factor receptor (EGFR) gene and/or a K-ras gene, a kit containing the primer and the probe and a device for detecting genetic mutation on the basis of a digital PCR platform.The method for detecting the genetic mutation by means of the primer and the probe comprises the steps that the prime and the probe are provided; DNA of a sample to be detected is extracted; a fluorescent PCR reaction system capable of amplifying a mutant gene sequence is prepared; a target probe and an internal reference probe are utilized to be hybridized with amplified products respectively, and fluorescent signals of corresponding fluorescent groups are detected; existence of the genetic mutation is judged and/or the mutation rate is calculated according to the strength and proportion of the fluorescent signals of the target probe and the internal reference probe.According to the method for detecting the genetic mutation, the needed primers and probes are small in number, the optimization procedure is simple, related mutation of EGFR and/or K-ras gene can be qualitatively or quantitatively detected, and the detection sensitivity is high; a DNA sample with low initial amount can also be detected stably.

The invention provides primers, probes, kit and method for detecting human EGFR (epidermal growth factor receptor) gene mutations. The method comprises the following steps of: (1) providing the primers and the probes; (2) processing detected samples and extracting DNA (deoxyribonucleic acid); (3) carrying out fluorescent quantitation on components of a PCR (polymerase chain reaction) system; (4) amplifying target sequences of an EGFR gene mutation to be detected; and (5) distinguishing wild type genes and mutant type genes by utilizing ARMS (amplification refractory mutation system) primers and judging results via the fluorescence intensity of an FAM and a JOE. The primers, probes and method provided by the invention have the beneficial effects that 29 kinds of mutations on the EGFR genes can be simultaneously detected, so that the sensitivity is high, the specificity is strong and the detection speed is high; and the whole detection process only takes 60 minutes.

The invention discloses a nucleic acid composition for detecting novel coronavirus COVID-19 and application. The nucleic acid composition is prepared by the following steps: firstly, carrying out nucleic acid sample amplification based on a transcription-mediated amplification technology (TMA); then, specifically detecting amplified virus target nucleic acid in combination with activity of 'associated cleavage' of CRISPR-Cas13a protease; adding sgRNA, Cas13a protein, an ssRNA signal report probe and a reaction buffer solution into a reaction system containing target nucleic acid to be detected; and reading and detecting signals when the reaction is carried out so as to detect a target gene. By using the method disclosed by the invention, whether a sample contains a target nucleic acid sequence or not can be rapidly detected; and the nucleic acid composition is combined with the transcription-mediated nucleic acid amplification technology, so that the sensitivity of the detection methodcan reach a nanomole level, and the nucleic acid composition for detecting the novel coronavirus COVID-19 is suitable for rapidly detecting pathogenic microorganisms, gene mutation, specific target RNA and the like.

The invention provides an STAG2 gene mutant sequence and a detection method thereof as well as use of STAG2 gene mutation in detecting bladder cancer and belongs to the technical field of the molecular biology gene detection. The detection method comprises the following steps: (1) extracting a tumor tissue DNA and a peripheral blood DNA from a tumor tissue and the peripheral blood of a bladder cancer patient; (2) performing whole genome sequencing and whole exon sequencing on the two DNAs extracted in the step (1), respectively; (3) performing whole exome sequence alignment and somatic mutation detection on the sequencing results of the step (2), thereby obtaining a mutant gene; (4) verifying the somatic replacement, insertion and deletion of the mutant gene obtained in the step (3) by use of Sanger sequencing; and (5) identifying the mutant gene as the remarkable mutant gene. The detection method has the advantage that the mutation of the STAG2 is one of unfavorable indexes of the bladder cancer and also is capable of serving as a new acting target for treating the bladder cancer.

The invention discloses an artificial fixed-point rice dense and erect panicle (DEP1) gene mutant body and application thereof. The rice DEP1 gene mutant body as well as a corresponding allele is obtained by modifying a 5th exon of a DEP1 gene by adopting a CRISPR/Cas9 gene targeting modification technology, so that a base of the 5th exon is replaced, lost and inserted. The artificial fixed-point rice DEP1 gene mutant body and the application thereof disclosed by the invention have the benefits that the artificial mutation is performed on the 5th exon of the rice DEP1 gene by adopting the CRISPR/Cas9, and the mutant body capable of obviously improving the rice yield and the allele are screened; the DEP1 gene mutant body disclosed by the invention as well as the corresponding allele can improve the yield of rice plants by 13-51 percent and is even superior to a natural mutation type.

The invention belongs to the field of biological medicines, and relates to a method for screening HRDs disease-causing mutation and a gene chip hybridization probe designing method involved in the same. The method for screening the HRDs disease-causing mutation comprises the steps of (1) establishing an HRDs genetic resource repository; (2) designing and synthesizing a gene chip hybridization probe of an HRDs disease-causing gene, and integrating the gene chip hybridization probe onto a gene chip; (3) capturing a target area by utilizing the prepared gene chip and executing the depth sequencing; (4) analyzing the sequencing data on the aspect of bioinformatics, and screening the candidate disease-causing gene; (5) functionally predicting a newly-discovered splicing gene mutation site. By establishing the high-efficient HRDs target gene capturing technology, adopting the depth sequencing as a means and confirming the efficiency of the HRDs capturing chip, a high-efficient credible biological information analysis model is established.

The invention discloses a preparation method of a zebrafish notch1b gene mutant. The preparation method includes: determining positions of knock-out target spots of the notch1b gene; utilizing pUC19-gRNA scaffold plasmid as a template, and performing PCR (polymerase chain reaction) amplification with primers T7-notch1b-sfd and tracr rev; subjecting a PCR product to purification and in-vitro transcription to obtain gRNA (guide ribose nucleic acid); introducing the gRNA and Cas9mRNA into a cell-stage embryo of zebrafish, and culturing to obtain the notch1b gene mutant stable in inheritance. Thepreparation method has the advantages that by the aid of the CRISPR/Cas9 (clustered regularly interspersed short palindromic repeats, CRISPR/CRISPR-associated genes, cas gene) technology, and by meansof selecting a specific section of targeting domain, the notch1b gene in the zebrafish is knocked out, other genes are protected from being 'injured accidentally', the zebrafish without the Notch1b gene is formed, and great significance is achieved on study of Notch signal channels.

The present invention discloses primers, probes, a detection system and a kit for one time detection of lung cancer multiple genes, wherein the primers, the probes, and the distribution way for detecting 18 EGFR gene mutations, 7 KRAS gene mutations, BRAF V600E gene mutation, 5 fusion genes of ALK5, and 9 fusion genes of ROS1 are provided. According to the present invention, the detection kit adopts the 12 linking PCR reaction strip design, each 12 linking PCR strip detects multiple genes of a sample, the corresponding detection reagents and the internal control reagents are filled in the pipes 1-11 of the 12 linking PCR strip, the mutation is indicated by the FAM signal, and the internal control is indicated by the HEX (or VIC) signal; the pipe 12 is adopted as the DNA extraction quality external control detection pipe and is indicated by the FAM; and with the primers, the probes, the detection system and the kit, the one-time detection of the lung cancer EGFR/KRAS/BRAF/ALK/ROS1 gene can be achieved, such that the detection time is substantially shortened, the sensitivity is high, the specificity is strong, the operation is simple and rapid, and the reference for selection of tumor targeting drug therapy on lung cancer patients can be provided for clinician.

The invention provides a primer set, a kit and a detection reaction system for detecting PKD1 gene mutation through the long fragment PCR and high-throughput sequencing technology, a non-diagnosis-purpose method for external PKD1 gene mutation detection, a non-diagnosis-purpose method for external PKD1 gene analysis and a method for detecting new mutation sites on the PKD1 gene. According to the method, the primer set is used for carrying out long fragment PCR amplification on the PKD1 gene of a sample, and detecting or analyzing is carried out through high-throughput sequencing. The autosomal dominant genetic polycystic nephrosis (adult polycystic nephrosis) can be diagnosed through the assistance of a detection result, previous unknown new mutation on a plurality of PKD1 real genes can be obtained and supplied to doctors or researchers so that the relevance between the mutation and the adult polycystic nephrosis can be studied.

The invention discloses a method for detecting gene mutation genotyping based on a Taqman-ARMS (Amplification Refractory Mutation System) technology, relating to the field of molecular biology. According to the method, an ARMS mutation enrichment technology and a Taqman-MGB (Minor Groove Binder) specificity fluorescence detection technology are combined, a mutation target sequence is subjected to specificity PCR (Polymerase Chain Reaction) amplification by using an ARMS primer, a Taqman-MGB probe is used for carrying out specificity locus detection on an amplification product, and specific mutation is identified on the basis of Real-time PCR. Compared with mutation detection technologies such as direct sequencing, chip detection and the like, the method has the advantages of strong specificity, high sensitivity, simplicity and rapidness in operation, high flux and the like when used for detecting gene mutation.

The invention discloses a gene editing technique taking Argonaute nuclease as a core. In the presence of guide DNA (Deoxyribose Nucleic Acid), Argonaute endonuclease can cut any locus of a targeted DNA sequence, including a genome of a mammal to cause breakage of DNA double chains, thereby fulfilling an editing aim. Editing means include incision, deletion, mutagenesis induction, exogenous sequence insertion, fragment substitution and the like. Editing effects include gene inactivation, gene mutation, exogenous gene induction and the like. The protein can serve as an important tool for genome editing. A gene editing tool taking the protein as the core has the characteristics of easiness in operation, high efficiency, low target missing rate and high fidelity. Moreover, almost any genome locus can be effectively targeted and cut by the Argonaute nuclease. By using the technique, high-specificity and high-efficiency genome targeted editing is helpfully realized.

The invention provides a method and a kit for detecting a drug resistance gene mutant type of tuberculous bacillus (TB). Compared with the prior art, the invention has the following advantages: 1) reagents and consumables used in the invention are simple and stable, and expensive reagents like fluorescent dyes and special enzyme are not needed; 2) a reaction can be carried out in a microscale system, and usage of a sample and a variety of consumables is reduced; 3) since mass spectrometry is used for direct detection of molecular weight (a mass-to-charge ratio) of DNA and direct determination of types of bases (i.e., no need for signal conversion in any manner), it is theoretically practicable that identification can be realized as long as one copied amplified DNA fragment is amplified, so high sensitivity is obtained; and 4) since mass spectrometry also has the characteristics of automatic and high-flux detection and the like, combination of mass spectrometry and multi-primer extension enables a plurality of drug resistance sites to be simultaneously detected in one reaction system, thereby substantially reducing workload and increasing detection flux.

The invention discloses a method of detecting 26311 Mutation of COL7A1 gene and a usage thereof. The method adopts primers of p87F (TGGGCCTGAAATATGAGGAG) and P87R (TAGGCCACTGGAGAGACAGG) to PCR-amplify COL7A1 gene including the section of 26251-26350, implements the sequence after the purification of products, or uses BslI for the endonuclease detection after using p87Fa (TCCCACGGGGGCCCCTGGACAG) and P87Ra (TCCCCCGCCCCCACCCT GCCA) for the nest amplification of the PCR products. The usage is the application in preparations or gene chips for detecting the diagnosis of dominant dystrophic epidemolysis bullosa genealogy. The invention provides a novel way for the prenatal diagnosis of the bullosa and provides a basis for the gene therapy.

The invention discloses a combined primer for screening human deafness gene mutation. The combined primer comprises a combined forward primer and a combined reverse primer, wherein the combined forward primer consists of two parts namely a joint part P1 sequence and a forward primer sequence, and the combined reverse primer sequentially consists of a joint part P2 sequence, a label sequence and a reverse primer sequence. The invention also discloses a kit for screening the human deafness gene mutation. The invention also discloses applications of the combined primer and the kit in preparation of a reagent for screening the human deafness multi-gene mutation. A primer containing the label (Barcode) sequence is used for differentiating different samples, and at least 32 samples can be detected by performing a method provided by the invention once, so that combined primer can be widely applied to general investigation of deafness susceptible genes. The price of the combined primer disclosed by the invention is far lower than that of imported instruments or reagents, so that the sequencing cost is greatly reduced and then the detection cost is also greatly reduced.

The invention discloses primers for detecting ApoE gene polymorphism, a kit and a PCR (polymerase chain reaction) method for the primers or the kit. The primers include two sets of primers for detecting an rs429358 site and an rs7412 site respectively; the first set of primers include a mutant-type specific upstream primer of the rs429358 site, a wild-type specific upstream primer of the rs429358 site and a first downstream primer shared by the mutant-type specific upstream primer and the wild-type specific upstream primer of the rs429358 site; the second set of primers include a mutant-type specific upstream primer of the rs7412 site, a wild-type specific upstream primer of the rs7412 site and a second downstream primer shared by the mutant-type specific upstream primer and the wild-type specific upstream primer of the rs7412 site. The kit has the advantages of simplicity, quickness, accuracy and low price for detection and the like, and provides a powerful tool for scientific research and clinical analysis of ApoE gene typing and gene mutation.

The invention discloses a fusion protein of melittin and human mutant interleukin-2, which is characterized in that, a linker peptide gene is used to link the encoding genes of human mutant IL-2 and melittin. The invention can be used to screen cloning capable of improving CD8+T cell mediated CTL reactivity of the body after the tumor formation, the fusion protein can be used fine genetic medicament for the treatment of tumors.

The invention relates to the field of gene mutation detection, and specifically relates to primers and a probe used for detecting EGFR gene mutation, a kit thereof, and an application method of the kit. With the kit provided by the invention, a sample containing 0.1-1% of EGFR gene mutation DNA can be detected; and accurate genotyping can be carried out upon a sample containing 10% of EGFR No. 19 exon gene mutation DNA through sequencing. The sensitivity of the kit provided by the invention is high, wherein a minimum detection limit is 5-copy gene. With the kit, qualitative detection can be carried out upon EGFR gene mutation. Different sensitivity reference ranges can be provided for assisting clinical determinations of mutation amount volumes, such that final treatment programs can be provided according to different mutations.

The invention discloses an EGFR (epidermal growth factor receptor) gene mutation site detection kit which detects EGFR gene mutation sites by combining the ARMS (amplification refractory mutation system) specific mutant enrichment technology with the Taqman-MGB (minor groove binder) probe specific detection technology. The kit comprises ARMS primer pairs and corresponding Taqman-MGB probes, and the ARMS primer pairs and the corresponding Taqman-MGB probes are used for detecting the EGFR gene mutation sites. The EGFR gene mutation site detection kit is high in sensitivity, capable of detecting multiple samples simultaneously and low in cost, provides guidance for pharmacy of clinicians, realizes individualized treatment of patients suffering from tumors and is capable of reducing treatment risk and burden of the patients and wide in application prospect.

Methods are provided for determining whether a subject carries a CFTR gene mutation. In practicing the subject methods, an array comprising a plurality of CFTR gene mutation probes is contacted with a nucleic acid sample from the subject, and the presence of any resultant surface bound target nucleic acids is detected to determine whether the subject carries a CFTR gene mutation. In addition, reagents and kits thereof that find use in practicing the subject methods are provided.