374 results about "Bacterial blight" patented technology

The invention discloses a bacillus velezensis strain JN5 and an application thereof. The bacillus velezensis strain JN5 is registered in CGMCC on 13th, December, 2016, the preservation number being CGMCC No.13455. The bacillus velezensis strain JN5 provided by the invention can be prepared into an aqueous agent or a coating agent to be acted on crops such as corn and rice for preventing bacterial stripe of rice and bacterial blight of rice and promoting growth of corn and rice. The strain is safe to use and free of residues, the dosage and residual amount of a chemical agent in an agricultural product are favorably reduced, the production cost is lowered, and the strain is high in practicality and suitable for industrial production.

The invention discloses a thiazole zinc suspending agent and process for preparation, wherein, the suspending agent contains thiazole zinc 5-60%, wetting agent 3-8%, dispersing agent 1-5%, thickening agent 0-3%, anti-freeze agent 0-5%, antiseptic 0-1% and defoaming agent 0-0.5% and water allowance. The medicament is evenly dispersed and manufactured by adopting arts of combination of sandblast or high-shear homogeneity and sandblast, or combination of high-shear homogeneity and high pressure homogeneity. The medicament has high efficiency, which can effectively prevent and cure bacterial diseases such as rice bacterial blight, striped disease and citrus ulcer and the like, and uses water as dispersed medium, and has little environmental pollution and low toxicity. The preparation has excellent performance, which can be stored for two years without deposition and phenomenon of lamination. The invention has long life span of a goods shelf, and is not easily burnt and is safe to store and transport.

The invention relates to the technical field of plant genetic engineering, in particular relates to isolating clone and functional verification of a DAN fragment containing a gene OsWRKY45-2 related to rice disease resistance. The gene OsWRKY45-2 codes WRKY proteinoids and can endow rice with resistance to the diseases caused by bacterial pathogenic bacteria, namely the leaf blight bacteria (Xanthomonas oryzae pv.oryzae) and fungal pathogenic bacteria, namely the rice blast bacteria (Magnaporthe grisea). The fragment and the exogenous regulatory sequence thereof are directly transferred into rice, thus the resistance capability of transgenic rice with over-expression OsWRKY45-2 against bacterial blight in and rice blast is improved remarkably.

The invention discloses rice bacterial blight resistance related proteins OsBBR1 and coding genes and application thereof. The rice bacterial blight resistance related proteins OsBBR1 are following (A1), (A2) or (A3), wherein (A1) the proteins have the amino acid sequence of the 240-438 bits in the third sequence, (A2) the proteins are obtained in the process that the amino acid sequence shownin the 240-438 bits of the third sequence in a sequence table is subjected to substitution and / or deletion and / or addition of one or more amino acid residues, and have the same function, and (A3)the fusion proteins are obtained by connecting labels to the N ends or / and the C ends of the (A1) or the (A2). Experiments show that plants transfecting OsBBR1 genes can significantly improve diseaseresistance of plants, the disease resistance of the plants missing the OsBBR1 protein function after gene editing is lowered, which indicates that the OsBBR1 proteins and the coding genes thereof canbe used for improving the disease resistance of the plants and have great significance for cultivating the disease-resistant plants.

The invention discloses a paddy rice bacterial blight-resistant protein Xa23 and its coding gene. A nucleotide sequence of the coding gene is shown in the formula of SEQ ID NO: 1 and an amino acid sequence of the paddy rice bacterial blight-resistant protein Xa23 is shown in the formula of SEQ ID NO: 2. The invention also relates to a use of the coding gene in cultivation of disease-resistant crops and especially in cultivation of a paddy rice bacterial blight-resistant paddy rice variety.

The invention discloses a high-efficiency rice breeding method, pertaining to rice breeding field. Core idioplasms such as Fenghuazhan and Fengshizhan are selected by the invention as a main body parent , and crossed with those varieties with comparatively more genetic distance and complementary characters, and the agricultural characters, eating quality and content of medium linear starch of the hybrid descendents are sifted, and rice blast resistance and bacterial blight resistance are screened, to further cultivate a series of good quality, high yield and a new rice variety of rice with disease resistance. The invention has a high breeding efficiency, shortens the breeding period and saves the breeding expenses.

The invention relates to the technical field of plant genetic engineering, and more particularly relates to separated clone and functional verification of DNA segments of paddy disease-resistant related gene OsEDR1. By utilizing transgenic technology based on RNA interference (RNAi) principle, part of the DNA segments of the OsEDR1 gene are connected with a vector expressing double-strand RNA to be converted into rice varieties, and the expression of the OsEDR1 gene in the rice varieties can be inhibited. Genetic transformation rice with obviously reduced OsEDR1 gene expression quantity has the remarkably improved resistibility for bacterial blight and bacterial streak disease, so as to prove that the OsEDR1 gene is negative regulatory factor in the reaction of resisting bacterial blight and bacterial streak disease of rice, thus the disease resistance of the rice can be improved by inhibiting the expression of the OsEDR1 gene.

The invention discloses a chitosan / nano-TiO2 composite material and a preparation method and application thereof. The preparation method comprises the following steps that a chitosan solution is mixed with nano-TiO2 powder, the chitosan solution and the nano-TiO2 powder are dispersed by ultrasonic waves and reacted at a temperature of 160-180 DEG C for 1-2h to obtain the chitosan / nano-TiO2 composite material, wherein the concentration of the chitosan solution is 0.05 to 0.2 g / L, and the addition amount of the nano-TiO2 powder is 0.1 to 1.0g / L. The preparation method provided by the invention is simple to operate and good in safety, and nano-TiO2 can be uniformly dispersed in chitosan. The chitosan / nano-TiO2 composite material prepared by the method has a stable structure, better mechanical properties and processing properties, and can be used for preparing a fiber material; and the composite material can effectively decompose exopolysaccharides of rice bacterial blight pathogens, has antibacterial activity against the rice bacterial blight pathogens, and high photocatalytic efficiency, and is used for rice cultivation to effectively prevent and treat the rice bacterial blight.

The invention discloses 2-sulfydryl-5-substituent group-1,3,4-thiadiazole (oxadiazole) derivatives with the function of preventing and controlling bacterial and fungal diseases of crops. Due to excellent physiological activity, the derivatives get more attention in the medical field, but the agricultural activity of the derivatives is still not reported at present. The research shows that the derivatives can be used for effectively inhibiting pathogens of such bacterial diseases as rice bacterial blight, rice bacterial leaf streak, tobacco bacterial wilt and tomato bacterial wilt and pathogens of such fungal diseases as wheat scab, potato late blight, apple canker, capsicum wilt, cucumber gay mold and sclerotia sclerotium. Meanwhile, when applied to prevention and control of the bacterial and fungal diseases of crops, the 2-sulfydryl-5-substituent group-1, 3, 4-thiadiazole (oxadiazole) derivatives has the advantages of simple structure, simple the preparation process, low the production cost and wide application prospect. The 2-sulfydryl-5-substituent group-1, 3, 4-thiadiazole (oxadiazole) derivatives has a general formula shown in the specification.

The invention discloses a molecular marker closely linked with rice bacterial blight resistance gene and primers and an application thereof. The molecular marker is characterized in that the nucleotide sequence of the molecular marker is shown in SEQ ID NO: 4. The nucleotide sequence of a primer 1 of a primer pair is shown in SEQ ID NO: 1 and the nucleotide sequence of a primer 2 is shown in SEQ ID NO: 2. When the primers are used for rice bacterial blight detection, after PCR (polymerase chain reaction) amplification, if the PCR amplification product is a 98bp base fragment, the rice to be detected is a bacterial blight resistant variety; if the PCR amplification product is a 103bp base fragment, the rice to be detected is a bacterial blight susceptible variety. The method disclosed by the invention can be used for implementing early generational selection on the bacterial blight resistant rice to shorten the breeding cycle so that a bacterial blight resistant rice material can be screened out quickly; therefore, the method can be widely applied to assistant breeding of the rice.

The invention relates to the technical field of plant gene engineering, in particular to the isolation cloning and function verification of a DNA fragment containing a rice disease resistance related gene OsWRKY45-1. A nucleotide sequence of the OsWRKY45-1 gene and an amino acid sequence encoded by the gene are shown in SEQ ID NO: 1. Genetically transformed rice of which the expression level of the OsWRKY45-1 gene is remarkably reduced apparently strengthens the resistance on xanthomonas oryzae pv. oryzae and xanthomonas oryzae pv.oryzicola, which proves that the OsWRKY45-1 gene is a negative regulatory factor in reactions of resisting bacterial blight and bacterial stripe of rice, and the disease resistance of the rice can be improved by inhibiting the expression of the OsWRKY45-1 gene.

The invention discloses a separated paddy bacterial blight bacterial phage and an application thereof. The phage disclosed by the invention is preserved at China Center for Type Culture Collection with the preservation No. CCTCC NO: M2015727. The separated phage disclosed by the invention is a virulent phage separated from natural soil, the phage Xoo_sp15 is utilized to prevent and control plant diseases caused by xanthomonas and the preventing and control effect is excellent. The phage is expected to be highly purified and developed into a biopesticide for avoiding the propagation of plant xanthomonas and the growth and propagation of xanthomonas in plants and can be used for effectively preventing and treating the plant diseases caused by xanthomonas.

The invention discloses an STS molecular marker for identifying high rice bacterial blight resistant genes. A nucleotide sequence of the molecular marker is SEQ ID NO: 1. The STS molecular marker is the following primer pairs, wherein the nucleotide sequence is 5'--3', the forward primer is 5'GGGAGAAATTGGCCCCAGTTAGAGAA3', the reverse primer is 5' GCTTCACTTGATCACTGCTGTTTG3'. Use of the STS molecular marker for helping to selectively breeding rice bacterial blight resistant Xa7 genes or cloning Xa7 genes.

The invention discloses a method for breeding and seed production of superior multi-resistance high-yield two-line hybrid rice. According to the method, superior rice-blast-resistant high combining ability photo-thermo sensitive genic male sterile line-guangzhan 63S-4 is taken as a female parent to hybridize with a superior bacterial blight-resistant strong and excellent restorer line-zhenhui 832, thus obtaining the two-line hybrid rice-liangyou 832 with high quality, high rice blast and bacterial blight resistance and high yield. The rice cultivated by the method has the advantages of good comprehensive yielding ability, moderate maturation period, high quality, good commodification and strong stress resistance.

The invention relates to the technical field of plant gene engineering, more particularly to isolation and cloning as well as functional verification of DNA fragment containing Oryza minuta bacterial blight-resisting major gene Xa3 / Xa26-3. Xa3 / Xa26-3 codes leucine-rich protein kinase-type protein, which can enable paddy rice to resist the diseases caused by bacillary pathogenic bacteria-bacterial blight bacteria(Xanthomonas oryzae pv. Oryzae). The fragment and self-regulatory sequences thereof are directly transplanted into paddy rice, therefore, Xa3 / Xa26-3. Xa3 / Xa26-3-carrying transgenic rice is prominently strengthened in resisting bacterial blight.

This invention relates to the plant biological technology area, it concretely relates to the separated clone, function testing and application of the two DNA fragments of the bacterial blight of rice recessive gene xa13 and dominant allele gene xa13. The antiviral allele xa13 gene is the function flow mutant of the dominant gene xa13. The mutant of the dominant gene makes the paddy rice generated the resistance of the bacterial blight. Some DNA fragments of the allele and dominant gene are connected with the extraneous regulated sequence and transferred into the paddy rice by the gene transfer technology bases on the RNA interference, and this can resist the function of the dominant gene in the paddy rice and improve the resistance of the bacterial blight of rice. Otherwise, the allele gene xa13 in the paddy rice is suppressed by the RNA technology, and this can improve the resistance of bacterial blight of rice further.

The invention provides a method for preventing insects and diseases of organic rice, belonging to the technical field of rice planting. The method comprises soil improvement, loach breeding, seed soaking in bacteria liquid, seedling soaking in bacteria liquid, bacterial liquid spraying and insect killing through lamp trapping. The method has the following beneficial effects: the EM (effective microorganisms) biological bacterium compost can improve the soil microorganism activities, increase the distribution density of the microorganisms and increase the organic content of the soil; the eggs and larvae of pests in the paddy fields can be killed by breeding loaches; the disease resistance of rice seeds and seedlings can be improved and such bacterial diseases as rice blast, sheath blight and bacterial blight can be effectively controlled by soaking the seeds and seedlings in the bacteria liquid and spraying the bacteria liquid; the method of killing insects through lamp trapping is to effectively kill pests by utilizing the phototaxis and wave tendency characteristic of the pests and can help control such migratory pests as botyodes diniasalis walker, tryporyza incertulas, chilo suppressalis and rice planthoppers; and compared with the existing methods for killing insects and preventing diseases with pesticides, the method completely eradicates pesticide residues and harms of the pesticides to soil and food and is an effective method for producing organic rice.

The invention discloses breeding and seed production methods of quality multi-resistant high-yield hybrid rice indica Zhen you 184. The rice bred through the method has good comprehensive yielding ability, moderate mature period, fine quality, good commercial value and strong stress resistance. The breeding method includes the steps of taking quality rice-blast-resistant sterile line Zhenxian 1A with high combining ability as the female parent to hybridize with quality bacterial-blight-resistant high-heterosis restorer line Zhen hui 084 to obtain hybrid rice indica Zhen you 184 with fine quality, strong rice blast resistance and bacterial blight resistance and high yield. The seed production method is as follows: seeding the male parent Zhen hui 084 in two periods, seeding the male parent in the I period at the end of April and then seeding the male parent in the II period 8-12 days later. The female parent is seeded 14-18 days after the male parent in the I period, the leaf age difference is about 3.0-3.5, the ratio of the rows of the male parent and the female parent in the seed field is 2:12-14, the male parent of the I period and the II period are in alternate single-plant transplantation, the row pitch of the female parent plants is 12-15cmX 16-19cm, and fewer-seedling transplanting is adopted. The seeds are isolated strictly, care is paid to remove the impurities, appropriate amount of '920' is sprayed through artificial supplementary pollination measure, and disease and insect control work is paid attention to.

The invention discloses a bactericide composition containing thiediazole copper. The bactericide composition comprises the effective ingredients of thiediazole copper (A) and Zhongshengmycin (B) in the weight part ratio of 50:1 to 1:10. The bactericide composition has obvious synergism, and can be used in control of diseases of vegetables, fruit trees and cereal crops, particularly, of soft rot of Chinese cabbages, bacterial wilt of potatoes, canker of citrus, bacterial blight of rice and bacterial leaf streak of rice.

The invention discloses an application of a bacterial blight resistance related gene OsPRX30, belonging to the technical field of plant genetic engineering. The expression of OsPRX30 gene is increasedafter induction by Xanthomonas oryzae pv. Oryzae pv. Oryzae. The gene is up-regulated after induction by Xanthomonas oryzae pv. Oryzae and the resistance to Xanthomonas oryzae pv. Oryzae could be enhanced by knockout. OsPRX30 edit site sequence is ligated with U3 promoter and cloned into gene editing vector pYLCRISPR / Cas9Pubi-H, and that gene can negatively regulate the resistance of rice to bacterial blight. The gene editing vector constructed by the invention can be used in rice breeding for resistance to bacterial blight. The present invention is helpful to better understand the mechanismof action of OsPRX30, and the cloning of OsPRX30 is helpful to further understand rice. Bacterial blight pathogen interaction, disease resistance signal transduction pathway laid the foundation, has great application value in breeding.

The invention discloses an application of OsSAPK7 protein and coding genes thereof in improving resistance to bacterial blight of rice. The method for cultivating transgenic rice provided by the invention comprises a step of introducing the genes for coding the OsSAPK7 protein into initial rice so as to obtain transgenic rice which has improved resistance to the bacterial blight. The OsSAPK7 protein is constituted by an amino acid sequence shown as sequence 2 in a sequence list; and gene coding regions for coding the OsSAPK7 protein are shown as the 1st-1080th nucleotide from 5' terminal of sequence 1 in the sequence list. The invention also discloses the application of the OsSAPK7 protein and the coding gene thereof in improving resistance to the bacterial blight of rice. The OsSAPK7 protein and the coding genes thereof provided by the invention have important significance for cultivating a new rice variety of resisting the bacterial blight; and the OsSAPK7 protein and the coding genes thereof are suitable for popularization and application.

The invention discloses a fungicide. Specifically, it is a water-dispersible granule fungicide of eubazole, which can be used to prevent and control rice bacterial blight, rice bacterial streak, tomato bacterial wilt and soft rot of Chinese cabbage. Its component content is calculated by mass percentage: 200-800 parts of ecloazole, 20-40 parts of wetting agent, 20-40 parts of dispersing agent, 20-80 parts of disintegrating agent, 10-100 parts of binder, 15 parts of stabilizer -100 parts, fillers make up 1000 parts. The above ingredients are mixed in proportion, stirred uniformly, crushed to obtain mesh powder, and mesh powder and adhesive are mixed uniformly, then granulated, dried, and sieved to obtain ecumazole water-dispersible granules. The invention overcomes the disadvantages of the wettable powder of ebuazole and reduces the use cost of farmers and the pollution of the environment. Moreover, the present invention has the advantages of high content, fast disintegration, good dispersibility, good storage, transportation and stability during use, and has high activity, good efficacy and safety.

The invention discloses a plant-based bacteriostat, a preparation method and application thereof. The plant-based bacteriostat of the invention comprises active extracts of myoporum bontioides leaves. The plant-based bacteriostat of the invention has an inhibitory effect on a plurality of germs, particularly rice blast, sheath blight or bacterial blight. The plant-based bacteriostat of the invention has the advantages of high efficiency, low toxicity, environmental-friendliness, easy degradation, high germ resistance and the like and can be used as an ideal green pesticide.

The invention provides application of a gene which can improve the agricultural production traits of rice and improve the bacterial blight disease resistance and includes application of rice miR156 and a target gene of rice miR156 in improving rice resistance to the bacterial leaf blight. The invention also provides a method for cultivating anti-bacterial leaf blight transgenic rice, which comprises the following steps of: constructing an over-expression vector containing OsSPL7 or OsSPL14, transforming the constructed over-expression vector into rice, and up-regulating the expression of riceOsSPL7 or IPA1 / OsSPL14 to obtain the bacterial blight resistant transgenic rice; or down-regulating the expression of miR156 in rice crops so as to up-regulate miR156 target genes OsSPL7 and OsSPL14 (IPA1) to obtain the bacterial blight resistant transgenic rice. The method provided by the invention, on the condition of not affecting growth and development and improving the agronomic traits such as rice plant type and panicle type, takes microRNA as a starting point, provides a gene resource that affects rice plant type and panicle type, and also enhances resistance of rice to bacterial blight.

The invention relates to a method for cultivating broad-spectrum anti-bacterial-blight oryza sativa Indica by modifying OsSWEET gene promoters of oryza sativa Indica. Nucleotide sequences TACTGTACACCACCAAAAGT, ATATAAAAGCACCACAACTC and CCTCCAACCAGGTGCTAAGC are simultaneously constructed into a CRISPR / Cas9 system, with the assistance of an agrobacterium-mediated transgene system, genes OsSWEET11, OsSWEET13 and OsSWEET14 are subjected to site-directed mutagenesis in rice Huazhan, the oryza sativa material MS134HZ in which the OsSWEET11, OsSWEET13 and OsSWEET14 gene promoters are mutated simultaneously is obtained, and the oryza sativa material has a broad spectrum and is resistant to rice bacterial blight. The EBEs of the promoters of the susceptible genes OsSWEET11, OsSWEET13 and OsSWEET14 of MS134HZ are simultaneously modified, the capacity of resisting the bacterial blight is improved, and the spectrum is broader. In practical application, through the hybridization of mutant MS134HZ plants and other oryza sativa varieties, disease-resistant strains are bred.

The present invention provides plants, plant cells and methods of making transgenic plants or plant cells, wherein the plants or cells are resistant to bacterial blight. The invention provides isolated nucleic acid sequences comprising SEQ ID NO: 1 or fragments thereof which provide a plant with resistance to bacterial blight disease when transfected into the plant.

The invention discloses a breeding method for improving the hybrid rice quality. The method comprises the following steps of: (1) selection of resource materials: selecting X21 introduced from Vietnam as genetic resources of the amylase content, screening out a molecular marker controlling the Wx gene in the amylase content, wherein a maintainer line Q2B with excellent comprehensive agronomic characters bred by Chongqing Municipality Seeds Company is taken as maintainer line backbone parents, and Q2A is taken as a wild abortive type sterile cytoplasm donor, a restorer Shuhui 527 bred by a Rice Research Institute of Sichuan Agricultural University is taken as restorer backbone parents, a restorer R818 bred by Jiangsu Lixia River Agriculture Science Institute is taken as as a bacterial blight resistance donor, and a restorer Chenghui 047 bred by the Crop Research Institute of Sichuan Academy of Agricultural Sciences is taken as a rice blast resistance donor; (2) breeding of a restorer; (3) breeding of a sterile line; and (4) cross combination: taking the cross combination of a sterile line 1A and a restorer R78 to participate a regional trail of Chongqing Municipality in the tenth year, and a continuous trail and a production testing in the eleventh year, and passing the examination of Chongqing Municipality in the twelfth year to receive the name Qingyou 78.

The invention discloses a triazole Schiff base Myricetin derivative containing thioether, a preparation method and application thereof. The structural general formula of the derivative is shown as [A], wherein R is phenyl, substituted phenyl or aromatic heterocyclic base; and n is the number of carbon in a carbon chain, which is 3, 4 and 5 respectively. The triazole Schiff base Myricetin derivative has preferable control effect for tobacco mosaic virus, citrus canker bacteria and rice bacterial blight bacteria.

A method for dividing the bacterial blight strain of rice into microspecies by using the 6 subisopolar gene lines of known disease-resistant genes is disclosed. In the booting stage of rice, the bacterial suspension is inoculated to the leaf on the master stem of rice. The longth of disease spot and the length of whole leaf are respectively measured in 2 weeks and 3 weeks. If the length of disease spot is less than 0.25 times that of whole leaf, it is a disease-resistant plant (R). Otherwise, it is a disease-infectious plant(s). 6 varieties of rice are experimented in the interaction mode of 9 micropecies (R1-R9) to obtain the relative microspecies of bacterial blight strain.

The invention discloses an application of OsSAPK9 protein and a coding gene thereof in improving resistance to rice bacterial leaf blight. The invention provides a method for breeding transgenic rice, wherein the method comprises a step of introducing an OsSAPK9 protein coding gene into initial rice, so as to obtain the transgenic rice that resistance to the bacterial leaf blight is improved, wherein OsSAPK9 protein is constituted by an amino acid sequence shown as sequence 2 in a sequence list; and a gene coding region for coding the OsSAPK9 protein is shown as 1st-1086th amino acids from 5' terminal of sequence 1 in the sequence list. The invention also discloses the application of the OsSAPK9 protein and the coding gene thereof in improving the resistance to the rice bacterial leaf blight. The invention is of great significance for breeding a new rice variety capable of resisting the bacterial leaf blight; and the invention is suitable for popularization and application.