Application of ELSA gene in improving disease resistance of rice
By knocking out the promoter region or gene body region of the rice ELSA gene using CRISPR/Cas9 technology, the problems of environmental pollution and unstable yield in rice disease prevention and control were solved, achieving high disease resistance and stable yield.
Patent Information
- Application Number
- CN202510781406.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-12
- Publication Date
- 2025-09-05
AI Technical Summary
In the existing technology, the prevention and control of rice diseases such as bacterial leaf blight, bacterial leaf streak and rice blast mainly rely on chemical control, which leads to environmental pollution and increased production costs, while the breeding of disease-resistant varieties has the problem of unstable yield.
By using CRISPR/Cas9 technology to knock out the promoter region or gene body region of the ELSA gene in rice, and using the ELSA gene as a negative regulatory factor, the rice's resistance to bacterial leaf blight, bacterial leaf streak and rice blast is improved, while maintaining the stability of rice yield.
It achieves the effect of high disease resistance and stable yield of rice, significantly improves the resistance to bacterial leaf blight, bacterial leaf streak and rice blast, maintains the stability of rice yield, and does not affect the plant shape and panicle shape.
Smart Images

Figure CN120591328A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of plant disease resistance breeding, and more specifically, to ELSA Application of genes in improving disease resistance in rice. Background Art
[0002] Rice is one of my country's most important food crops and plays a crucial role in agricultural production. my country's total rice production ranks first in the world, accounting for over 40% of my country's total grain output. Therefore, high and stable rice yields are crucial for ensuring national food security. Currently, rice diseases remain a major cause of rice yield losses, with bacterial leaf blight, bacterial leaf streak, and blast being the most prominent. Outbreaks of these diseases can lead to varying degrees of yield reduction (generally 20%-30%, with severe cases reaching 50% or even complete crop failure) and damage rice quality. High temperatures, high humidity, and frequent typhoons and heavy rains in South China's rice-growing areas favor the outbreak and spread of bacterial leaf blight, bacterial leaf streak, and blast. Furthermore, the continuous double-cropping system in South China further enhances the occurrence of these diseases. Currently, the primary control method for bacterial leaf blight, bacterial leaf streak, and blast remains chemical control. However, the large-scale application of chemical agents not only results in pesticide residues, environmental pollution, harm to humans and animals, but also increases production costs. Exploiting host plant resistance is the preferred strategy for controlling bacterial leaf blight, bacterial leaf streak, and rice blast. Breeding and planting rice varieties resistant to these diseases is currently recognized worldwide as the safest, most economical, environmentally friendly, and effective means of controlling these diseases. Continuously identifying and discovering disease-resistant germplasm and genes that confer broad-spectrum resistance to these diseases are prerequisites for breeding for disease resistance. Furthermore, in current agricultural production, many high-yielding varieties are not disease-resistant, while disease-resistant varieties exhibit unstable yields. Summary of the Invention
[0003] The purpose of the present invention is to overcome the above-mentioned defects and deficiencies in the prior art and to provide ELSA Application of genes in improving rice disease resistance, knockout ELSA The gene can increase rice's resistance to bacterial leaf blight, bacterial leaf streak and rice blast, while also stabilizing rice yield, thereby achieving the goal of high disease resistance and stable yield of rice.
[0004] The above-mentioned object of the present invention is achieved through the following technical solutions: ELSA The gene sequence is publicly available at the Rice Genome Database (https: / / rapdb.dna.affrc.go.jp / ), ELSA Gene locus: chr05:5817556-5821394 (3839bp), ELSA The genome sequence is shown in SEQ ID No. 1, ELSA The gene promoter region is shown in SEQ ID No. 2, and the ELSA gene sequence is shown in SEQ ID No. 3. The present invention utilizes CRISPR / Cas9 technology to knock out the ELSA The rice mutant strain was constructed by knocking out the gene promoter region or gene body region. ELSA The gene promoter region or gene body region can improve the resistance of rice to bacterial leaf blight, bacterial leaf streak and rice blast without significantly affecting the rice plant type and panicle type, maintaining the stability of rice yield, that is, improving rice disease resistance without affecting rice yield. ELSA The gene is a negative regulatory gene for resistance to rice bacterial blight, bacterial leaf streak and blast. ELSA Gene promoter region or gene body region is used to cultivate high disease resistance and stable yield rice, which provides a simple and effective method for cultivating high resistance and stable yield rice.
[0005] Therefore, the present invention provides the ELSA The following new uses of genes: ELSA Use of the gene in any of the following: (1) regulating disease resistance in rice; (2) preparing a product for regulating disease resistance in rice.
[0006] Specifically, the regulation is negative regulation; by knocking out ELSA Gene promoter region or gene body region can improve the disease resistance of rice.
[0007] ELSA The use of a gene knockout agent or expression inhibitor in any of the following: (1) improving the disease resistance of rice; (2) cultivating rice varieties with high disease resistance and stable yield; (3) preparing products for cultivating rice varieties with high disease resistance and stable yield.
[0008] Furthermore, the knockout agent or expression inhibitor is ELSA CRISPR / Cas9 knockout agents for gene promoter or gene body regions, ELSA Gene knockdown preparations by RNAi interference or antisense strand overexpression.
[0009] The present invention also provides a method for cultivating rice with high disease resistance and stable yield, which is to use genetic engineering to cultivate rice. ELSA The gene or its promoter is modified so that ELSA The gene function is lost or weakened, or the expression level is reduced, thus obtaining rice plants with high disease resistance and stable yield.
[0010] Furthermore, the method comprises: ELSAThe gene or its promoter is targeted, an sgRNA sequence based on the CRISPR-Cas system is designed, a DNA fragment containing the encoding sgRNA sequence is connected to a vector carrying CRISPR / Cas, and rice is transformed to obtain ELSA Rice plants in which gene function is missing or weakened, or expression levels are reduced.
[0011] Preferably, the target is a dual target, and the corresponding sgRNA combinations are sgRNA-A and sgRNA-B or sgRNA-B and sgRNA-C; the sequences of sgRNA-A, sgRNA-B and sgRNA-C are shown in SEQ ID No. 4 to 6 respectively. The sgRNA-A action site is located at ELSA Gene promoter region, sgRNA-B action site is located in ELSA Gene promoter region and ELSA At the junction of the gene body region, the sgRNA-B action site is located ELSA Specifically, an expression cassette containing sgRNAs corresponding to the double knockout target sites was constructed, ligated into a CRISPR / Cas vector, and transformed into rice.
[0012] Preferably, the amplification primers of sgRNA-A, sgRNA-B and sgRNA-C are shown as SEQ ID No.7-8, SEQ ID No.9-10 and SEQ ID No.11-12, respectively.
[0013] Preferably, the CRISPR / Cas vector is a pRHCas9 vector with the binary vector pCAMBIA-1300 as the backbone.
[0014] Preferably, the transformation is mediated by Agrobacterium.
[0015] As an optional specific embodiment, the present invention provides a method for cultivating rice with high disease resistance and stable yield, using CRISPR / Cas9 technology to knock out the ELSA A method for constructing a rice mutant strain by using a gene promoter region or a gene body region comprises the following steps: The online software CRISPR-P (http: / / cbi.hzau.edu.cn / crispr / ) was used to ELSATarget sites were designed in the gene promoter region and gene body region. The sgRNA-A (SEQ ID No. 4) and sgRNA-B (SEQ ID No. 5) expression cassettes for knocking out the target site were constructed using primers A: 5'-tgttgTGGCCCAAACAAAAAGATC-3' (SEQ ID No. 7), 5'-aaacGATCTTTTTGTTTGGGCCAc-3' (SEQ ID No. 8) and primer B: 5'-gtgtgCTTGCTCGTTGCCCGATGT-3' (SEQ ID No. 9), 5'- aaacACATCGGGCAACGAGCAAGc-3' (SEQ ID No. 10). The two expression cassettes were ligated into the pRHCas9 vector with the binary vector pCAMBIA-1300 as the backbone and transformed into Escherichia coli to complete the knockout of the target site. ELSA The construction of promoter region knockout plasmid, the obtained plants were named Elsa - p ; Primer B 5'-gtgtgCTTGCTCGTTGCCCGATGT-3', (SEQ ID No.9), 5'-aaacACATCGGGCAACGAGCAAGc-3' (SEQID No.10) and primer C 5'-tgttgGCTACACCTGACCTGGAAA-3' (SEQ ID No.11), 5'-aaacTTTCCAGGTCAGGTGTAGCc-3' (SEQ ID No.12) were used to construct expression cassettes for sgRNA-B (SEQ ID No.5) and sgRNA-C (SEQ ID No.6) for knocking out the target site. The two expression cassettes were ligated into the pRHCas9 vector with the binary vector pCAMBIA-1300 as the backbone and transformed into Escherichia coli to complete the process. ELSA The gene body region knockout plasmid was constructed and the resulting plant was named Elsa -g.
[0016] Specifically, the disease resistance is resistance to bacterial blight, bacterial leaf streak and / or rice blast. ELSA There were no significant changes in tillering, grains, number of grains per panicle, 1000-grain weight, yield per plant, and number of panicle branches of the mutant strain compared with wild-type rice.
[0017] Compared with the prior art, the present invention has the following beneficial effects: The present invention provides ELSA The application of genes in improving rice disease resistance. ELSAThe gene promoter region or gene body region can improve the resistance of rice to bacterial blight, bacterial leaf streak and rice blast without significantly affecting the rice plant type and panicle type, maintaining the stability of rice yield, that is, not affecting rice yield. ELSA The gene is a negative regulatory gene for resistance to rice bacterial blight, bacterial leaf streak and blast. ELSA Gene promoter region or gene body region is used to cultivate high disease resistance and stable yield rice, which provides a simple and effective method for cultivating high resistance and stable yield rice. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figure 1 for ELSA Schematic diagram of gene structure and knockout effect detection of promoter region and gene body region. Figure 1 A in the middle ELSA Schematic diagram of gene structure, two groups of CRISPR / Cas9 knockout targets, and knockout effect detection; B is knockout ELSA Schematic diagram of PCR before and after the gene promoter region (left) and gene body region (right); C is knockout ELSA Promoter region and gene body region ELSA qPCR results of gene expression level detection.
[0019] Figure 2 Comparison of disease resistance, plant type, and panicle type between wild-type plants and CRISPR / Cas9 knockout plants. Figure 2 Figure A shows the results of the bacterial blight experiment on wild-type plants and CRISPR / Cas9 knockout plants. The CRISPR / Cas9 knockout plants are more resistant to bacterial blight than the wild type; Figure B and C show the statistical results of the bacterial blight resistance experiment on wild-type plants and CRISPR / Cas9 knockout plants; Figure D and E show the comparison of the whole plant and panicle type of wild-type plants and CRISPR / Cas9 knockout plants; Figure F shows the bacterial leaf streak experiment on wild-type plants and CRISPR / Cas9 knockout plants. The CRISPR / Cas9 knockout plants are more resistant to bacterial leaf streak than the wild type; Figure G shows the statistical results of the bacterial leaf streak resistance experiment on wild-type plants and CRISPR / Cas9 knockout plants; Figure H shows the rice blast experiment on wild-type plants and CRISPR / Cas9 knockout plants. The CRISPR / Cas9 knockout plants are more resistant to rice blast than the wild type; Figure I shows the statistical results of the rice blast resistance experiment on wild-type plants and CRISPR / Cas9 knockout plants. DETAILED DESCRIPTION
[0020] The present invention will be further described below with reference to the accompanying drawings and specific examples, but the examples do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.
[0021] Unless otherwise specified, the reagents and materials used in the following examples were commercially available.
[0022] Example 1 Construction using CRISPR / Cas9 gene editing technology ELSA gene mutants 1. Construction of knockout plasmid The vector used was pRHVCas9 (all provided by Professor Wang Guoliang of the Chinese Academy of Agricultural Sciences), gRNA was driven by the rice snRNAU6 promoter, and Cas9p was driven by P Ubi Driven, these promoters act as constitutive promoters to control the expression of sgRNA and Cas9p. The experimental operations here adopt routine techniques in the field.
[0023] (1) Use the online software CRISPR-P (http: / / cbi.hzau.edu.cn / crispr / ) ELSA The target site is designed to be knocked out. Figure 1As shown, the target nucleotide sequences are: PAM-A (sgRNA-A): TGGCCCAAACAAAAAGATCCGG (SEQ ID NO: 4), PAM-B (sgRNA-B): GCTTGCTCGTTGCCCGATGTGGG (SEQ ID NO: 5), PAM-C (sgRNA-C): GCTACACCTGACCTGGAAAGGG (SEQ ID NO: 6), and the last three bases are PAM sites. Target linker primers were synthesized, and five bases of TGTTG were added to the 5' end of the target PAM-A forward primer (shown in SEQ ID No. 7: 5'-tgttgTGGCCCAAACAAAAAGATC-3'), four bases of AAAC were added to the 5' end of the target PAM-A reverse primer, and one base of C was added to the 3' end (shown in SEQ ID No. 8: 5'-aaacGATCTTTTTGTTTGGGCCAc-3'); four bases of gtgtg were added to the 5' end of the target PAM-B forward primer (shown in SEQ ID No. 9: 5'-gtgtgCTTGCTCGTTGCCCGATGT-3'), four bases of AAAC were added to the 5' end of the target PAM-B reverse primer, and one base of C was added to the 3' end (shown in SEQ ID No. 10: 5'-aaacACATCGGGCAACGAGCAAGc-3'); four bases of tgttg were added to the 5' end of the target PAM-C forward primer (shown in SEQ ID The target site PAM-C reverse primer has four bases AAAC added to its 5' end and one base C added to its 3' end (SEQ ID No. 11: 5'-tgttgGCTACACCTGACCTGGAAA-3'). PAM-A (sgRNA-A) and PAM-B (sgRNA-B) were used as a pair to knock out the promoter region of the ELSA gene, while PAM-B (sgRNA-B) and PAM-C (sgRNA-C) were used as a pair to knock out the transcript region of the ELSA gene.
[0024] (2) The forward and reverse adapter primers for each target site were annealed to form double strands, and then ligated to the pRHVCas9 plasmid fragment after BsaI digestion to generate two sgRNA expression cassettes. The sgRNA expression cassettes were amplified by two rounds of nested PCR reactions. The PCR amplification reaction conditions were referred to the instructions of the PCR amplification reaction kit.
[0025] (3) After PCR, the amplified product was purified and digested with BsaI. The pRHVCas9 vector was also digested with BsaI. The two sgRNA expression cassettes were then mixed and connected to the pRHVCas9 vector using T4 ligase to construct a targeting ELSA ELSA-CRISPR knockout plasmids for two sets of gene loci.
[0026] The amplification product recovery, enzyme digestion reaction, T4 ligation and other reactions involved in the above-mentioned process were all performed using conventional procedures in the art, and the vectors, reagents and the like involved in the experiment were all commercially available.
[0027] 2. Transformation of Rice Callus with ELSA-CRISPR Knockout Plasmid (1) The ELSA-CRISPR knockout plasmid constructed above was transformed into Agrobacterium tumefaciens (commercially available). The transformation method is a routine operation in the art.
[0028] (2) The Agrobacterium tumefaciens transformed with the ELSA-CRISPR knockout plasmid was then streaked on YEP medium (10 g yeast extract, 10 g peptone, 5 g NaCl, 15 g agar) containing rifampicin and kanamycin. After culturing at 28°C in the dark for 2-3 days, a single colony was picked and spread on YEP medium containing the same antibiotics. The colony was then cultured at 28°C in the dark for 2 days. An appropriate amount of the bacterial cells was scraped and suspended in AAM liquid co-culture medium (AAM macro, AAM micro, AAM organic, iron salt, 30 g / L glucose, 68.5 g / L sucrose) containing 100 μM acetosyringone to dilute to OD 550 The concentration of the culture medium was about 0.3, and the culture was carried out in a shaking incubator (140 rpm) at 28°C for 40 minutes to prepare the Agrobacterium tumefaciens infection solution, which can be used for infection.
[0029] (3) Take mature rice seeds, peel off the husks, soak them in 75% alcohol for 1 minute, wash them several times with sterile water, and then soak them twice in 1% sodium hypochlorite for 20 minutes each time, shaking them several times during the process. Wash them several times with sterile water, and then dry them with sterile filter paper. Inoculate them on induction medium (N6 macro, B5 micro, B5 organic, iron salt, 2mg / L 2,4-D, 30g / L sucrose, 500mg / L glutamine, 500mg / L proline, 300mg / L hydrolyzed casein, 3.0g / L plant gel). Inoculate the induced embryonic callus tissue on fresh induction medium for continued culture. Pick out callus tissue with good growth status and inoculate it on fresh induction medium for subculture every 2 to 3 weeks.
[0030] (4) Select callus tissue that is light yellow, granular, densely structured, and in good growth condition and place it in a sterile triangular flask for appropriate drying. Then add the prepared Agrobacterium tumefaciens infection solution and infect for 20 minutes, shaking it several times during the process. After infection, place the callus tissue in a culture dish with sterile filter paper and air-dry it for 1-2 hours. Then, transfer the callus tissue to a co-culture medium with a layer of filter paper, air-dry it for about half an hour, and then culture it in the dark at 26°C for 2-3 days.
[0031] 3. Screening and differentiation of transgenic rice positive callus (1) Remove the co-cultured callus tissue and place it in a sterile culture dish with three layers of filter paper. Dry it for about 1 day, then transfer it to the screening medium and culture it in the dark at 26℃ for 14-21 days. Screen twice in total. Select the resistant callus tissue with good growth and transfer it to the pre-differentiation medium and culture it in the light at 26℃. After 21 days, transfer the resistant callus tissue with good growth and green spots to the differentiation medium to allow the callus tissue to regenerate.
[0032] (2) When the seedlings differentiated from the resistant callus grow to 4-6 cm, they are transferred to rooting medium and cultured at 26°C. When the seedlings grow to 10-12 cm, with broad, dark green leaves and healthy root growth, the medium and the callus attached to the base are washed off and potted outdoors to obtain ELSA knockout transgenic rice.
[0033] The formula of the above screening medium is: N6 medium (large amount) + MS medium (trace amount) + B5 medium (small amount) + 1g / L hydrolyzed casein + 1g / L proline + 2mg / L (2,4-D) + 30g / L sucrose + 50mg / L hygromycin + 500mg / L cephalosporin + 4g / L plant gel. The final pH of the screening medium is 5.8.
[0034] The formula of the above-mentioned pre-differentiation medium is: MS medium + 1g / L hydrolyzed casein + 20g / L sucrose + 1mg / L (2,4-D) + 500mg / L cephalexin + 50mg / L hygromycin + 4g / L phytogel, and the final pH of the pre-differentiation medium is 5.8.
[0035] The formula of the above differentiation medium is: MS medium + 2 mg / L (6-BA) + 0.5 mg / L naphthaleneacetic acid + 1 mg / L kinetin + 30 g / L sucrose + 3% sorbitol + 4 g / L phytogel, and the final pH of the differentiation medium is 5.8.
[0036] The above rooting medium formula is 1 / 2 MS medium.
[0037] The formulations of MS medium, 1 / 2MS medium, and N6 medium used in this example all adopt conventional formulations in the art. The reagents involved in the above-mentioned medium formulations are all commercially available.
[0038] 4. ELSA mutant identification primers are: ELSA-CheckAB-F (SEQ ID No. 13): 5'-GTGCATTGTCGTCGGTGTG-3'; ELSA-CheckAB-R (SEQ ID No. 14): 5'-ACCAGTAGTCCCCGTACCGT-3'.
[0039] ELSA-CheckBC-F (SEQ ID No. 15): 5'-ACGCAAAACGAAGCACGTAT-3'; ELSA-CheckBC-R (SEQ ID No. 16): 5'-TGCAGCCGTTGGGGAGCTCT-3'.
[0040] Get two Elsa mutant elsa-p and elsa-g , the mutation is as follows Figure 1 shown.
[0041] Example 2 Phenotypic Observation of Transgenic Rice after Inoculation with Pathogens 1. Wild-type Zhonghua 11 (ZH11) and knockout mutants elsa-p and elsa-g Phenotypic observation after inoculation with bacterial blight: Resistance identification was performed using the leaf clipping method.
[0042] ZH11 and knockout mutants elsa-p and elsa-g Inoculate the bacteria when the rice is grown to the heading stage. Streak the bacterial blight strain on a beef extract peptone solid culture medium plate for activation. Pick a single colony to beef extract peptone liquid culture medium, shake and culture at 28°C overnight, collect the bacteria, adjust the concentration of the activated bacterial solution to about OD600 0.8, dip scissors in the bacterial solution, select the tip of the flag leaf, cut off the tip leaves of the same length (about 0.5mm long) for inoculation, and pay attention to spraying water to keep the rice inoculated with bacteria moist. Inoculate at least 20 leaves for each strain, take pictures 14 days after inoculation to record the disease situation and measure the length of the lesions. At the same time, use real-time fluorescence quantitative PCR to detect the amount of bacteria on the diseased leaves, take equal amounts of Zhonghua 11 (ZH11) and knockout mutants elsa-p and elsa-g The genomic DNA was extracted from the leaves and the following primers were used for quantitative PCR to compare the expression of ZH11 and the mutant. elsa-pand elsa-g The amount of bacterial blight pathogen carried by the leaves is used to evaluate the resistance of the knockout mutant to bacterial blight.
[0043] Real-time fluorescence quantitative PCR primers are: EF1a-F (SEQ ID No. 17): 5'-CTGGACTGCCACACCTCACACAT-3'; EF1a-R (SEQ ID No. 18): 5'-CCAACAGCCACCGTTTGCCTC-3'; HrPc-F (SEQ ID No. 19): 5'-GGGGTGTCGTTGCGGGTATT-3'; HrPc-R (SEQ ID No. 20): 5'-ATCGGTCTCGTCGGCATCGTA-3'.
[0044] The results are as follows Figure 2 As shown, compared with the wild type, elsa-p and elsa-g The mutant showed significant resistance to bacterial blight, as shown by elsa-p and elsa-g The length of the lesions on the leaves of the mutant strains was significantly shorter than that of the wild-type plants, and elsa-p and elsa-g The amount of bacterial blight pathogen in the mutant leaves was significantly lower than that in the wild type ( Figure 2 AC).
[0045] 2. Wild-type ZH11 and knockout mutants elsa-p and elsa-g Phenotypic observation after inoculation with bacterial leaf streak pathogen: resistance identification was performed using the pressure infiltration method.
[0046] ZH11 and knockout mutants elsa-p and elsa-g Inoculate the rice until the heading stage. Activate the bacterial leaf streak strain by streaking onto beef extract peptone solid medium plates. Pick a single colony and transfer it to beef extract peptone liquid medium. After shaking and incubating overnight at 28°C, collect the bacteria and adjust the concentration of the activated bacterial solution to an OD600 of approximately 0.8. Use a micropipette to dip the solution into the flag leaf and press the middle of the leaf, avoiding the veins, to inoculate the rice. Be sure to spray the inoculated rice with water to keep it moist. Inoculate at least 20 leaves per strain. Take photos 14 days after inoculation to record the disease and measure the length of the lesions.
[0047] The results are as follows Figure 2 As shown, compared with the wild type, elsa-p and elsa-g The mutant was significantly resistant to bacterial leaf streak, as shown by elsa-p and elsa-g The length of the lesions on the leaves of the mutant strains was significantly shorter than that of the wild-type plants ( Figure 2 FG).
[0048] 3. Wild-type ZH11 and knockout mutants elsa-p and elsa-g Phenotypic observation after inoculation with rice blast fungus: resistance identification was performed using the spray inoculation method.
[0049] Zhonghua11 (ZH11) and knockout mutants elsa-p and elsa-g Plant in seedling trays and wait until they grow to the four-leaf stage before inoculating. Inoculate the rice blast fungus S5 strain stored on filter paper onto a tomato oatmeal solid medium plate for activation. Scrape the mycelium and transfer it to a new tomato oatmeal medium plate for expansion. Cut the mycelium and place it in a 26°C black light incubator to induce spore production. Wash the plate with 0.1% Tween, filter it, and adjust the spore concentration to 1×10 5 Use a spray bottle to evenly spray the rice seedlings on the leaves. After inoculation, keep the seedlings in the dark and moisturize for 24 hours. Then remove the shade cloth and continue to culture under normal light. Take photos and record the disease situation 7 days after inoculation. At the same time, use real-time fluorescence quantitative PCR to detect the amount of bacteria on the diseased leaves. Take equal amounts of Zhonghua 11 (ZH11) and knockout mutants. elsa-p and elsa-g The genomic DNA was extracted from the leaves and the following primers were used for quantitative PCR to compare the expression of ZH11 and the mutant. elsa-p and elsa-g The amount of rice blast fungi carried on the leaves is used to evaluate the blast resistance of the knockout mutant.
[0050] Real-time fluorescence quantitative PCR primers are: MoPot2-F (SEQ ID No. 21): ACGACCCGTCTTTACTTATTTGG; MoPot2-R (SEQ ID No. 22): AAGTAGCGTTGGTTTTGTTGGAT; OsUbi-F (SEQ ID No. 23):GCCCAAGAAGAAGATCAAGAAC; OsUbi-R (SEQ ID No. 24): AGATAACAACGGAAGCATAAAAGTC.
[0051] The results are as follows Figure 2 As shown, compared with the wild type, elsa-p and elsa-g The mutant's resistance to rice blast was significantly reduced, as shown by elsa-pand elsa-g The amount of rice blast fungus in the mutant leaves was significantly lower than that in the wild type ( Figure 2 HI).
[0052] At the same time, knockout mutants elsa-p and elsa-g There was no significant difference in plant type and panicle type between the wild type Zhonghua 11 (ZH11) ( Figure 2 DE), indicating ELSA Gene mutation does not affect rice yield, maintaining the stability of rice yield.
Claims
1. ELSA The application of the gene in any of the following: (1) application in regulating rice disease resistance; (2) application in preparing a product for regulating rice disease resistance; ELSA The nucleotide sequence of the gene is shown as SEQ ID No. 1 or SEQ ID No.
3.
2. ELSA The use of a gene knockout agent or expression inhibitor in any of the following: (1) improving the disease resistance of rice; (2) cultivating rice varieties with high disease resistance and stable yield; (3) preparing products for cultivating rice varieties with high disease resistance and stable yield; ELSA The nucleotide sequence of the gene is shown as SEQ ID No. 1 or SEQ ID No.
3.
3. The application according to claim 2, characterized in that: The knockout agent or expression inhibitor is ELSA CRISPR / Cas9 knockout agents for gene promoter or gene body regions, ELSA Gene knockdown preparations by RNAi interference or antisense strand overexpression.
4. A method for cultivating rice with high disease resistance and stable yield, characterized in that: Using genetic engineering methods, rice ELSA The gene or its promoter is modified so that ELSA The gene function is lost or weakened, or the expression level is reduced, thereby obtaining rice plants with high disease resistance and stable yield; ELSA The nucleotide sequence of the gene is shown as SEQ ID No. 1 or SEQ ID No.
3.
5. The method according to claim 4, characterized in that: The method comprises: ELSA The gene or its promoter is targeted, an sgRNA sequence based on the CRISPR-Cas system is designed, a DNA fragment containing the encoding sgRNA sequence is connected to a vector carrying CRISPR / Cas, and rice is transformed to obtain ELSA Rice plants in which gene function is missing or weakened, or expression levels are reduced.
6. The method according to claim 5, characterized in that The target is a dual target, and the corresponding sgRNA combinations are sgRNA-A and sgRNA-B or sgRNA-B and sgRNA-C; the sequences of sgRNA-A, sgRNA-B and sgRNA-C are shown in SEQ ID Nos. 4 to 6, respectively.
7. The method according to claim 6, characterized in that The amplification primers of the sgRNA-A, sgRNA-B and sgRNA-C are shown as SEQ ID No. 7-8, SEQ ID No. 9-10 and SEQ ID No. 11-12, respectively.
8. The method according to claim 5, characterized in that The CRISPR / Cas vector is a pRHCas9 vector with the binary vector pCAMBIA-1300 as the backbone.
9. The method according to claim 5, characterized in that: The transformation was carried out using Agrobacterium-mediated method.
10. The use according to any one of claims 1 to 3 or the method according to any one of claims 4 to 9, characterized in that: The disease resistance is resistance to bacterial blight, resistance to bacterial leaf streak and / or resistance to rice blast.