PgEGY3 gene for improving cold resistance of pennisetum alopecuroides and increasing fresh weight of leaves and application of PgEGY3 gene

By providing the PgEGY3 gene of Napier grass, its recombinant expression vector, and host cells, the problem of insufficient cold resistance of Napier grass was solved, and the effects of improving plant cold resistance and biomass were achieved.

CN121046409AActive Publication Date: 2025-12-02AGRI GENOMICS INST CHINESE ACADEMY OF AGRI SCI

Patent Information

Application Number
CN202511589904.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-03
Publication Date
2025-12-02
Estimated Expiration
2045-11-03

AI Technical Summary

Technical Problem

The cold resistance of Napier grass is relatively weak, which limits its production, application and efficient utilization. No research has been reported on the role of the EGY3 gene in plant cold resistance.

Method used

We provide the PgEGY3 gene of Napier grass, its recombinant expression vector, and host cells. Through gene editing technology, we aim to improve the cold resistance and biomass of plants. The specific steps include cloning the PgEGY3 gene, constructing the recombinant expression vector, and transforming plants such as Arabidopsis thaliana.

Benefits of technology

It significantly improved the plant's growth status and leaf fresh weight under cold stress, and enhanced the plant's cold resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121046409A_ABST
    Figure CN121046409A_ABST
Patent Text Reader

Abstract

The invention discloses a PgEGY3 gene for improving cold resistance of pennisetum alopecuroides and increasing fresh weight of leaves and application of the PgEGY3 gene, and relates to the technical field of genetic engineering, and the nucleotide sequence of the PgEGY3 gene of the pennisetum alopecuroides is shown as SEQ ID NO.1. The invention also discloses a protein coded by the Pennisetum alopecuroides PgEGY3 gene. The invention also discloses a recombinant expression vector and a recombinant host cell comprising the Pennisetum alopecuroides PgEGY3 gene. The invention also discloses application of the PgEGY3 gene, a recombinant expression vector and a recombinant host cell in improving cold resistance and biomass of pennisetum alopecuroides. It is verified that the Pennisetum alopecuroides PgEGY3 gene can improve the cold resistance of plants, and the growth state of the plants under cold stress is remarkably improved through overexpression of the PgEGY3 gene.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to a PgEGY3 gene that improves the cold resistance and increases the fresh weight of leaves in Napier grass and its application. Background Technology

[0002] Low temperature is a crucial environmental factor affecting plant growth and development, limiting the geographical distribution of many plant species and serving as a major limiting factor for plant productivity in arable land. Therefore, improving crop yield and stability under low-temperature conditions and enhancing their cold resistance have become key areas of focus in current crop genetic improvement and stress physiology research.

[0003] Plants activate a series of complex response mechanisms under low-temperature stress. Studies have shown that a large number of differentially expressed genes appear in plants after low-temperature stress treatment. These genes are usually enriched in pathways such as plant hormone signal transduction, redox processes, photosynthesis, membrane system protection, and transcription factor regulation. Key pathways and genes in these pathways are considered to be important candidate regulatory factors involved in plant cold resistance mechanisms.

[0004] *Pennisetum* is one of the most important genera in the Poaceae family. It contains approximately 140 species, widely distributed in various ecological environments worldwide. *Pennisetum* has a soft texture, good palatability, and a high dry matter content of up to 21.6%. At the jointing stage, its dry matter contains 14.25% crude protein, 3.51% crude fat, 28.35% crude fiber, 38.21% nitrogen-free extract, and 11.31% ash. The high crude protein, moderate crude fat, and nitrogen-free extract content make it suitable for feeding various animals such as cattle, sheep, pigs, rabbits, and fish. This grass can reach a height of 3–5 meters, grows rapidly, has a long vegetative growth period (330 days per year), and can be harvested 5–7 times annually, yielding over 205 tons of fresh grass per hectare.

[0005] Elephant grass, belonging to the genus *Pennisetum* of the Poaceae family, is a perennial, clump-forming, large herbaceous plant. It is one of the most important forage species and potential energy grasses in tropical and subtropical regions of Asia, Africa, and the Americas. As an excellent forage crop, it yields up to 150 tons per hectare annually and can be harvested at least four times a year. It is resistant to high temperatures, drought, low soil fertility, and biological stress.

[0006] The Guangxi-Fujian elephant grass (Agrostis spp.) possesses strong drought and disease resistance, and a high sugar content, making it not only an excellent forage resource but also an ecological forage grass for greening barren mountains and preventing soil erosion. Currently, this variety has been widely promoted and applied in many parts of southern my country, becoming an important species for returning farmland to grassland and developing the grass-livestock industry. However, its generally weak cold resistance is a major factor limiting its production, application, and efficient utilization. To date, research on the cold-resistant genes of this grass is limited, and its cold-resistance mechanism remains unclear.

[0007] Significant progress has been made in the study of the EGY3 metalloproteinase gene in recent years in the field of plant biology. EGY3, a metal-dependent endonuclease, belongs to the EGY (ethylene-dependent gravitropism-deficient and yellow-green) family and plays a key role in regulating plant growth, development, and stress responses.

[0008] Studies have shown that the EGY3 gene is closely related to plant responses to environmental stress. Real-time PCR results showed that EGY3 gene expression was sharply upregulated in the first few hours after plants were subjected to high light and high temperature stress, and the increase in transcript abundance was correlated with protein accumulation levels, indicating that EGY3 is involved in plant responses to high temperature and high light stress. EGY3 also plays an important role in salt stress, and its expression can be induced by salt and oxidative stress. Loss of EGY3 function makes plants more sensitive to stress, while EGY3 overexpression enhances plant tolerance to salt stress and chloroplast oxidative stress. EGY3 interacts with chloroplast copper / zinc superoxide dismutase 2 (CSD2) and promotes CSD2 stability under stress conditions. In egy3-1 mutant plants, stress-induced CSD2 degradation limited hydrogen peroxide production in chloroplasts and impaired hydrogen peroxide-mediated retrograde signaling, which was manifested by reduced expression of retrograde signaling response genes related to stress tolerance. Exogenous application of hydrogen peroxide (or ascorbate peroxidase inhibitor) and CSD2 overexpression rescued the hypersensitivity of the egy3-1 mutant to salt stress. This demonstrates that EGY3 enhances plant tolerance to salt stress by promoting CSD2 stability and hydrogen peroxide-mediated retrograde chloroplast signaling.

[0009] Studies in Arabidopsis thaliana have revealed that EGY3 influences thylakoid membrane formation by participating in the processing of proteins related to chloroplast development and photosynthesis. Its mutants exhibit a yellowing phenotype, suggesting its role in chlorophyll metabolism. Furthermore, EGY3 may regulate photosystem repair by cleaving specific membrane proteins (such as PSII components), which is crucial for adaptation to high light stress. Recent research also indicates that EGY3 participates in drought stress responses by mediating proteolysis in the abscisic acid (ABA) signaling pathway. Overexpression lines of the rice homolog OsEGY3 exhibit enhanced drought tolerance, suggesting its potential value in crop stress resistance breeding. Studies have also found that EGY3 and the mitochondrial protease FTSH4 share functional redox redox homeostasis. Proteomics analysis further reveals EGY3 substrate preference, showing a tendency to cleave target proteins with transmembrane domains. Gene editing technologies (such as CRISPR-Cas9) have been used to create wheat EGY3 mutants, demonstrating their impact on grain filling efficiency. In the field of synthetic biology, attempts have been made to couple the EGY3 promoter with reporter genes for biosensing of heavy metal pollution. However, no research has been reported on the role of EGY3 in plant cold resistance. Summary of the Invention

[0010] To address the aforementioned technical problems, the purpose of this invention is to provide a PgEGY3 gene that enhances the cold resistance and increases the fresh weight of leaves in Napier grass, and its application.

[0011] The technical solution of the present invention to solve the above-mentioned technical problems is as follows: a PgEGY3 gene of Napier grass is provided, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0012] The present invention also provides the protein encoded by the above-mentioned PgEGY3 gene of Pennisetum arvense.

[0013] The present invention also provides a recombinant expression vector comprising the above-mentioned PgEGY3 gene from *Pyracantha fortuneana*.

[0014] The present invention also provides a recombinant host cell comprising the above-mentioned PgEGY3 gene from *Pyrrosia lingua*.

[0015] This invention also provides the application of the above-mentioned PgEGY3 gene of *Pyracantha fortuneana*, recombinant expression vector, or recombinant host cell in improving plant cold resistance and biomass.

[0016] Furthermore, the above applications include using the PgEGY3 gene of *Phragmites australis*, recombinant expression vectors, or recombinant host cells in the preparation of products that improve plant cold resistance and biomass.

[0017] Furthermore, the above application is: using the PgEGY3 gene of Napier grass, recombinant expression vectors, or recombinant host cells to prepare new plant varieties with high cold resistance.

[0018] Furthermore, the aforementioned plants are either Napier grass or Arabidopsis thaliana.

[0019] The present invention also provides a reagent for improving the cold resistance and biomass of Napier grass, comprising the above-mentioned Napier grass PgEGY3 gene, recombinant expression vector or recombinant host cell.

[0020] The present invention has the following beneficial effects:

[0021] Through experimental verification, this invention has found that the PgEGY3 gene of Napier grass can increase the plant's cold resistance, and overexpression of the PgEGY3 gene significantly improves the plant's growth under cold stress. Attached Figure Description

[0022] Figure 1 A phylogenetic evolutionary tree diagram;

[0023] Figure 2 This is a graph showing the expression changes of PgEGY3 induced by cold stress.

[0024] Figure 3 Electrophoresis diagram of total RNA from Napier grass tissue;

[0025] Figure 4 A comparison of PgEGY3 expression levels in different tissues of Pennisetum arvense;

[0026] Figure 5 Electrophoresis diagram of PgEGY3 gene expression in transgenic Arabidopsis thaliana under cold stress;

[0027] Figure 6 Comparison of growth status of Arabidopsis thaliana under cold stress;

[0028] Figure 7 Comparative images of rosette leaves in Arabidopsis thaliana under cold stress;

[0029] Figure 8 A graph showing the statistical results of the number of rosette leaves in Arabidopsis thaliana under cold stress;

[0030] Figure 9 A graph showing the statistical results of fresh weight of Arabidopsis leaves under cold stress;

[0031] Figure 10 This is a diagram showing the subcellular localization results of the PgEGY3 gene. Detailed Implementation

[0032] The principles and features of this invention are described below. The examples given are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified in the examples, conventional conditions or conditions recommended by the manufacturer should be followed. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0033] Example 1

[0034] A PgEGY3 gene of *Phragmites australis*, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0035] Example 1: Evolutionary analysis. The full-length CDS sequence of the PgEGY3 homolog was extracted from the genome of the closely related giant Napier grass and used as a template to design specific primers:

[0036] PgEGY3-f:ACTCCCGCCTTCGCTCCAT (SEQ ID NO.2)

[0037] PgEGY3-r: TAGATGCCGCCCCTGAAGA (SEQ ID NO. 3).

[0038] Using cDNA from the leaves of the hybrid Napier grass ("Guiminyin") as a template, the full-length CDS sequence of PgEGY3 was cloned. The PCR product was recovered and purified by gel electrophoresis, and then ligated into a T vector for sequencing to obtain the full-length CDS sequence of PgEGY3 (SEQ ID NO.1).

[0039] Downloaded homologous gene sequences for analysis, constructed a phylogenetic tree, and the results are as follows: Figure 1 As shown, these genes are divided into three main groups: Class a, Class b, and Class c. PgEGY3 is located in Class b, clustering with ZmEGY3 and SbEGY3, indicating a close phylogenetic relationship among them. In Class b, PgEGY3 is closely related to monocotyledonous plants such as maize (ZmEGY3), rice (OsEGY3), and wheat (TaEGY3), but relatively distantly related to dicotyledonous plants such as Arabidopsis thaliana (AtEGY3) and tobacco (NaEGY3). Class a includes genes such as PtEGY1, AtEGY1, NaEGY1, OsEGY1, TaEGY1, and ZmEGY1, while Class c contains genes such as PtEGY2, NaEGY2, AtEGY2, TaEGY2, OsEGY2, and ZmEGY2. In conclusion, PgEGY3 is most closely related to the EGY3 gene in maize (ZmEGY3) and sorghum (SbEGY3) in the phylogenetic tree, which may reflect their common ancestral relationship in the process of plant evolution.

[0040] Experimental Example 2: Response of PgEGY3 to Cold Stress

[0041] (1) Analysis of expression patterns under cold stress: Stem segments of the hybrid Napier grass with lateral buds were isolated and immersed in 1 / 2 Hoagland nutrient solution for germination. After about 3-4 days, stem segments with uniform germination were selected and transplanted into flowerpots containing nutrient soil. Then, they were transferred to a greenhouse (25°C, 16-hour light / 8-hour dark cycle) for 20 days of growth. Seedlings with uniform growth were selected and treated in a 4°C incubator for 0, 6, 12, 24, and 48 hours, respectively. Leaf tissue of the hybrid Napier grass was collected at each time point and immediately frozen in liquid nitrogen. The samples were stored in a -80°C freezer for subsequent RNA extraction.

[0042] By subjecting Napier grass to cold stress at 4℃, the expression changes of PgEGY3 after induction for different time periods were detected by RT-qPCR. The results are as follows: Figure 2 As shown, initial induction under cold stress led to a decrease in expression levels, followed by a significant upregulation 24 h after induction. At 48 h after induction, the expression level was 11 times that under the uninduced condition (0 h), indicating that PgEGY3 responds to long-term cold stress.

[0043] (2) Analysis of tissue differences in PgEGY3

[0044] 1) RNA extraction from different tissues of Pennisetum alopecuroides

[0045] Total RNA was extracted from the roots, stems, leaves, and leaf sheaths of 4-week-old Napier grass using the TIANGEN plant total RNA extraction kit.

[0046] S1. Materials prepared before the experiment

[0047] Kit components: lysis buffer PRL, protein removal buffer PRW, wash buffer PRW1, RNase-Free DNase I, DNase Buffer, RNase-Free RNA adsorption column (FlaPure RNA Columns), collection tube (2 mL).

[0048] Self-prepared reagents: β-mercaptoethanol, anhydrous ethanol (DEPC treated), RNase-free ddH2O.

[0049] Consumables: RNase-free centrifuge tubes, mortar and pestle, liquid nitrogen, pipette tips (RNase-free), vortex mixer, centrifuge (4℃).

[0050] S2, Sample Processing

[0051] Materials: Fresh roots, stems, leaves and leaf sheaths of 4-week-old Napier grass were selected, each sample containing approximately 50-100 mg. The samples were immediately flash-frozen in liquid nitrogen and then transferred to -80°C for storage.

[0052] Grinding: Take fresh or frozen tissue and grind it into powder in liquid nitrogen (avoid repeated thawing; the entire operation must be carried out on ice or in a low-temperature environment).

[0053] S3, RNA extraction:

[0054] Sample lysis: Transfer the ground powder to a pre-cooled 1.5 mL centrifuge tube, add 600 μL of lysis buffer PRL (add β-mercaptoethanol to a final concentration of 1% before use); vortex for 30 seconds to mix, let stand at room temperature for 5 minutes to allow the nucleic acid-protein complex to fully dissociate; centrifuge at 12000 g for 2 minutes at 4℃, and transfer the supernatant to a new tube.

[0055] Filtration and protein removal: Transfer the supernatant to a shredder spin column, into a 2 mL collection tube, centrifuge at 12000 g for 2 minutes, and collect the filtrate. Add 0.5 times the volume of anhydrous ethanol (approximately 300 μL) to the filtrate, mix well, and transfer to an adsorption column (FlaPure RNA column). Centrifuge at 12000 g for 1 minute and discard the filtrate. Repeat this step to ensure all filtrate passes through the adsorption column.

[0056] Genomic DNA removal: Add 500 μL of protein removal buffer (PRW) to the adsorption column, centrifuge at 10000 g for 10 seconds, and discard the waste liquid; prepare DNase I working solution (10 μL DNase I + 60 μL DNase Buffer), mix well, add to the center of the adsorption column membrane, and incubate at room temperature for 15 minutes; add 500 μL of protein removal buffer (PRW), centrifuge at 10000 g for 1 minute, and discard the waste liquid.

[0057] Washing and purification: Add 500 μL of PRW1 wash buffer (pre-added with anhydrous ethanol) to the adsorption column, let stand for 2 minutes, centrifuge at 10000 g for 1 minute, and discard the waste liquid; repeat step 1 to ensure complete removal of residual wash buffer.

[0058] Drying: Centrifuge at 13000 g for 2 minutes, open the cap and let stand at room temperature for 5 minutes to remove residual ethanol in the column.

[0059] RNA elution: Transfer the adsorption column to a new centrifuge tube, add 50-100 μL of RNase-Free ddH2O to the center of the membrane, and let stand at room temperature for 5 minutes; then centrifuge at 12,000×g for 2 minutes and collect the RNA solution (approximately 50 μL); then determine the RNA concentration, and the results are shown in Table 1.

[0060] Table 1 RNA Concentration Table

[0061] organize RNA concentration ng / μL root 288 stem 1840 leaf 208 leaf sheath 336

[0062] RNA quality was assessed by agarose gel electrophoresis: Wearing gloves, a 1% agarose gel was prepared by microwave melting, followed by the addition of 0.5 μg / mL ethidium bromide. The mixture was then poured onto a plate, combed, and allowed to cool to room temperature (approximately 30 minutes). 1 μL of RNA sample was then run on a DL2000 nucleic acid ladder at 180 V for 15 minutes. Results are as follows: Figure 3 As shown, the marker is a molecular weight standard reference. The results show that no DNA bands were observed (high molecular weight bands showed obvious tailing), and the sample can be used for subsequent quantitative analysis.

[0063] 2) RNA is reverse transcribed into cDNA

[0064] Total RNA from different tissues was reverse transcribed into cDNA for subsequent quantitative analysis.

[0065] Experimental materials:

[0066] Kit components: 5× gDNA wiper Mix, 10× RT Mix, HiScript III Enzyme Mix, Oligo(dT)20VN primers, Random hexamers primers, RNase-Free ddH2O.

[0067] Self-provided reagents: RNase-free centrifuge tubes, ice box, micropipette (RNase-free pipette tips), instant centrifuge, PCR instrument.

[0068] Reverse transcription experimental steps:

[0069] S1, RNA template pretreatment

[0070] Add the following components (calculated per single sample) to RNase-free centrifuge tubes according to Table 2:

[0071] Table 2 RNA Usage Table

[0072] organize RNA concentration ng / μL Reverse transcription volume μL Water volume (μL) root 288 3.47 4.53 stem 1840 0.54 7.46 leaf 208 4.81 3.19 leaf sheath 336 2.98 5.02

[0073] Denaturation treatment: Heat at 65℃ for 5 minutes, then quickly place on ice for 2 minutes (to destroy the secondary structure of RNA and improve reverse transcription efficiency).

[0074] S2, Genomic DNA Removal

[0075] Add 2 μL of 5× gDNA wiper Mix to the pretreated RNA and gently tap to mix. Incubate at 42℃ for 2 minutes using a PCR instrument, then centrifuge briefly (10 seconds).

[0076] S3, Preparation of reverse transcription reaction system

[0077] Add the components in the following order (total volume 20 μL): 10 μL of the mixture from the previous step; 2 μL of 10× RT Mix; 2 μL of HiScript III Enzyme Mix; 1 μL of Oligo(dT)20VN primer (50 μM); 1 μL of Random hexamers primer (50 μM); and bring the RNase-Free ddH2O to 20 μL.

[0078] Mixing and dispensing: Gently tap the tube wall to mix, avoiding air bubbles, and dispense into pre-cooled centrifuge tubes on ice.

[0079] S4, reverse transcription reaction

[0080] First stage: Transfer the reaction system to a PCR instrument and incubate at 37°C for 10 minutes (primer annealing and enzyme activation).

[0081] Second stage: Adjust the temperature to 50℃ and incubate for 45 minutes (cDNA synthesis).

[0082] Terminate the reaction: Heat at 95°C for 5 minutes (to inactivate reverse transcriptase).

[0083] Dilute the cDNA 10-fold with deionized water and aliquot it at -20°C (for short-term use) or store the stock solution at -80°C (for long-term storage). Avoid repeated freeze-thaw cycles.

[0084] 3) Identification of RT-qPCR primers

[0085] S1, Primer design 188bp

[0086] qEGY3f:GTCGGTGCTGCTGGGTTTGG Tm 65.8 (SEQ ID NO.4)

[0087] qEGY3r:CGTTGGGGAAGAGCGTGAGG Tm 65.0 (SEQ ID NO.5)

[0088] S2, Primer identification

[0089] The PCR system is shown in Table 3.

[0090] Table 3 Primer Identification PCR System

[0091] reagents volume PCR mix 10 μL qEGY3f 1 μL qEGY3r 1 μL Leaf cDNA template 2 μL Deionized water 6 μL Total volume 20 μL

[0092] The PCR program was as follows: 95℃ for 5 min; 95℃ for 30 s, 60℃ for 30 s, 40 cycles; store at 4℃.

[0093] S3, agarose gel electrophoresis

[0094] 1% agarose gel electrophoresis (180V 20min) showed that the PCR amplification products of primers qEGY3f and qEGY3r using leaf cDNA as a template had a clear band at 200bp, with no extraneous bands, and the length was consistent with the primer design of 188bp. Furthermore, no obvious primer dimers were observed in the negative control, indicating that this primer pair can specifically amplify the PgEGY3 gene and can be used for quantitative analysis of this gene.

[0095] 4) Tissue-specific RT-qPCR

[0096] Reagent: Novizan RT-qPCR quantitative reagent (sybrgreen).

[0097] PCR system: Refer to the primers above to identify the PCR system (Table 3, with different templates).

[0098] PCR program: 95℃ for 3 min; 95℃ for 10 s, 60℃ for 30 s, 72℃ for 15 s, 40 cycles; 65-95℃, fluorescence collected every 0.5℃.

[0099] The expression of PgEGY3 in different tissues is as follows: Figure 4 As shown.

[0100] The results showed that the expression level of the PgEGY3 gene was significantly higher in leaves than in other tissues. This suggests that the gene has an important function in leaves and is speculated to play a key role in photosynthesis or other leaf-specific physiological processes.

[0101] Experimental Example 3: Genetic Transformation

[0102] 1) Promoter cloning

[0103] S1, Primer Design

[0104] Using the genome sequence of Giant Napier Pgi02B00009620 (SEQ ID NO.6) as a reference template, promoter amplification primers for the PgEGY3 gene were designed:

[0105] proEGY3f1:GTTCTTGGGTAAAAGTTGGTA (SEQ ID NO.7)

[0106] proEGY3r1: TGCAGCGATCGCCTAGCTACCG (SEQ ID NO.8)

[0107] S2, crude extraction of genomic DNA

[0108] Reagents and consumables:

[0109] Tris (tris(hydroxymethyl)aminomethane); (HOCH2)3CNH2 (molecular weight 121.14); LiCl (lithium chloride) (molecular weight 42.39); EDTA (ethylenediaminetetraacetic acid) C 10 H 16 N2O8, molecular weight 292.24; SDS (Sodium dodecyl sulfate), molecular weight 288.379; isopropanol; 1.5 mL centrifuge tube; grinding rod.

[0110] Preparation of the extract: as shown in Table 4.

[0111] Table 4. Preparation of Extract Solution

[0112] reagents volume 1 M Tris, pH 9.0 20 mL 2 M LiCl 20 mL 0.5 M EDTA, pH 8.0 5 mL 20% SDS 5 mL Deionized water 50 mL Total volume 100 mL

[0113] Genomic DNA extraction:

[0114] Grind the leaf tissue in an Eppendorf tube with 200 μL of DNA extraction buffer until a green sap appears; centrifuge at 12,000 rpm for 5 minutes in a microcentrifuge; carefully transfer 150 μL of supernatant to a new tube and add 150 μL of isopropanol to mix thoroughly; centrifuge at 12,000 rpm for 10 minutes; carefully discard the supernatant and invert the tube on absorbent paper in a fume hood to dry for 30 minutes; add 30 μL of ddH2O to resuspend the DNA precipitate.

[0115] S3, promoter PCR amplification

[0116] PCR amplification was performed using proEGY3f1+ proEGY3r1 primers with Napier grass genomic DNA as a template.

[0117] PCR system: as shown in Table 5.

[0118] Table 5 Promoter PCR Amplification System

[0119] reagents volume HiFi PCR mix 15 μL proEGY3f1 1 μL proEGY3r1 1 μL Genomic DNA template 1 μL Deionized water 12 μL Total volume 30 μL

[0120] Program: 95℃ for 5 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 2 min, 27 cycles; store at 4℃.

[0121] Electrophoresis: 1% agarose gel electrophoresis for 15 min.

[0122] 2) Connecting the T-carrier

[0123] A band at 2200 bp was cut into a 1.5 mL centrifuge tube; 200 μL of GSB sol (Full Gold) was added to the centrifuge tube; the centrifuge tube was placed in a 55℃ water bath for 15 min to dissolve the gel; after cooling to room temperature, the melted gel was added to the centrifuge column and allowed to stand for 2 min; centrifuged at 12000 rpm for 1 min and the liquid was discarded; 25 μL of deionized water was added to the centrifuge column, allowed to stand for 2 min, and centrifuged at 12000 rpm for 2 min to obtain the washing solution; the ligation system was prepared according to Table 6, and ligation was performed by incubating at 25℃ for 10 min using a PCR instrument.

[0124] Table 6 Connection System Table

[0125] reagents volume 2×T vector buffer 5 μL PCR reaction solution 2 μL T-carrier 1 μL Deionized water 2 μL Total volume 10 μL

[0126] 3) Transformation of E. coli competent cells

[0127] Thaw 50 μL of competent cells on an ice box; add all the ligation product to the competent cells and gently tap to mix; incubate the competent cells in an ice box for 30 min; then heat shock in a 42°C water bath for 30 s, followed by an ice bath for 2 min; add 500 μL of LB liquid medium and incubate at 37°C with shaking for 1 h; remove the competent cells and centrifuge at 12000 rpm for 1 min to collect the cells; discard the supernatant and excess LB medium, mix the bottom cells by pipetting and aspirating, and spread on LB solid medium (containing Amp, 100 mg / L); incubate the plates at 37°C overnight (approximately 15 h) until single colonies grow.

[0128] The bacterial culture was identified by PCR using primers proEGY3f1+ and proEGY3r1. The bacterial culture with the correct electrophoretic band was selected and amplified using universal primers M13F and M13R. The culture was then sent to Sangon Biotech for sequencing. The promoter sequence is shown in SEQ ID NO. 9.

[0129] 4) Promoter linking to pCAMBIA1381 expression vector

[0130] S1, Primer Design

[0131] Design primers with EcoRI restriction sites based on the promoter sequence:

[0132] 1381EGY-f (SEQ ID NO.10):

[0133] TTGGGCCCGGCGCGCCGAATTCGTTCTTGGGTAAAAGT

[0134] 1381EGY-r (SEQ ID NO.11):

[0135] ACGTAAACTAGTCAGATCTACCATTGGAGACGAGCTGTGAAG

[0136] S2. Plasmids were extracted using the Tiangen Rapid Plasmid Mini-Prep Kit:

[0137] Inoculate 100 μL of positive bacterial culture into 10 mL of LB liquid medium (containing 100 mg / L Amp); incubate at 37°C on a shaker at 200 rpm for 12 h; take 1-4 mL of overnight culture, centrifuge at 12,000 rpm for 1 min, and aspirate the supernatant; add 150 μL of solution P1 (containing RNase A and TIANRed indicator), and mix the cells by pipetting; add 150 μL of solution P2, gently invert 6-8 times until the solution becomes clear (TIANRed indicates the degree of lysis), and lyse at room temperature for 5 min; add 350 μL of solution P5, mix quickly, and centrifuge at 12,000 rpm for 10 min, collecting the supernatant; transfer the supernatant to the adsorption column CP3, centrifuge at 12,000 rpm for 2 min to remove impurities; add the eluent to the adsorption column CP2, centrifuge at 12,000 rpm for 2 min, and discard the eluent; use 500 Wash the CP2 adsorption column twice with μL of PWT (containing anhydrous ethanol), centrifuge at 12000 rpm for 2 min, and discard the eluent; add 30 μL of elution buffer EB (preheated at 65℃), let stand at room temperature for 3 minutes, and then centrifuge to collect the T-PgEGY3pro plasmid.

[0138] S2, PCR amplification and recovery of promoter

[0139] PCR system: as shown in Table 7.

[0140] Table 7. Amplification and Recovery of Promoter PCR System

[0141] reagents volume M5 PCR mix 15 μL 1381EGY-f 2 μL 1381EGY-r 2 μL T-PgEGY3 plasmid 1 μL Deionized water 3.5 μL Total volume 10 μL

[0142] PCR program: 95℃ for 5 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 2 min, 30 cycles; store at 4℃.

[0143] Electrophoresis was performed on 1% agarose gel, and the gel was then recovered.

[0144] S3, pCAMBIA1381 vector digestion

[0145] The enzyme digestion system is shown in Table 8.

[0146] Table 8 Enzyme digestion system

[0147] reagents volume Quick cut buffer 3 μL EcoR I 1 μL pCAMBIA1381 plasmid 1 μL (500 ng) Deionized water 25 μL total 30 μL

[0148] Enzyme digestion procedure: 37℃ for 30 min; 65℃ for 30 min; store at 4℃.

[0149] The amplified promoter was ligated to the linearized vector. The ligation system is shown in Table 9. The PCR instrument was used to control the temperature at 50℃ for 30 min, and then stored at 4℃.

[0150] Table 9. Promoter-linearized vector connection system

[0151] reagents volume Seamless cloning enzyme 3 μL promoter fragment 2 μL pCAMBIA1381 linearized plasmid 1 μL total 6 μL

[0152] S4. The ligation product is transformed into competent E. coli cells.

[0153] Thaw 50 μL of competent cells on an ice box, add all the ligation product to the competent cells, and gently tap to mix. Incubate the competent cells in an ice box for 30 min. Then heat shock in a 42°C water bath for 30 s, followed by an ice bath for 2 min. Add 500 μL of LB liquid medium and incubate at 37°C with shaking for 1 h. Remove the competent cells and centrifuge at 12000 rpm for 1 min to collect the cells. Pick a single colony and place it in a sterile centrifuge tube, add LB liquid medium (containing 50 mg / L kan). Place the centrifuge tube in a 37°C shaker and incubate at 200 rpm for 12 h. Discard the supernatant and excess LB medium, mix the bottom cells by pipetting and aspirating, and spread on LB solid medium (containing kan, 50 mg / L). Incubate the plate at 37°C overnight (approximately 15 h) until single colonies grow.

[0154] S5. PCR identification of positive clones using bacterial culture.

[0155] The bacterial culture was amplified using 1381EGY-f and gus-r primers, and the amplification system is shown in Table 10.

[0156] Table 10 PCR System for Escherichia coli Positive Identification

[0157] reagents volume M5 PCR mix 5 μL 1381EGY-f 0.25 μL gus-r 0.25 μL bacterial solution 1 μL Deionized water 3.5 μL Total volume 10 μL

[0158] Program: 95℃ for 5 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 2 min, 30 cycles; store at 4℃.

[0159] Plasmids were extracted from bacterial cultures with the correct bands, and sequencing was performed using the sequencing primers gus-r. The sequencing results showed that the ligation was successful.

[0160] 5) Expression vector construction and Arabidopsis genetic transformation

[0161] After culturing positive bacterial cultures from S5 in LB liquid medium, plasmids were extracted, and the vector was linearized by digesting the plasmid with the restriction enzyme NcoI. The full-length CDS sequence of the PgEGY3 gene was amplified using primers (Homo-f and Homo-r).

[0162] Homo-f: AGCTTCACAGCTCGTCTCCAATGGCGTCTGCTTCGCT (SEQ ID NO.12)

[0163] Homo-r:TAAACTAGTCAGATCTACCATGATGCCGCCCTGAAGAA(SEQ ID NO.13)

[0164] The PgEGY3 gene was ligated into an expression vector using a seamless cloning kit, and the correctly sequenced plasmid was transformed into Agrobacterium (GV3101) for subsequent Arabidopsis genetic transformation. The Arabidopsis genetic transformation was performed using the inflorescence staining method, with the following steps:

[0165] Two days before transformation, Agrobacterium containing the PgEGY3 gene binary vector was inoculated into 3 mL of LB broth containing antibiotics (rifampin 50 mg / L, kanamycin 50 mg / L) and cultured overnight (approximately 12 h) at 28°C with shaking. 2 mL of the cultured Agrobacterium was transferred to 100 mL of LB broth containing antibiotics and cultured at 28°C with shaking for approximately 8 hours. The Agrobacterium was then transferred to a 50 mL centrifuge tube and centrifuged at 6000 rpm / min at room temperature for 10 minutes, and the supernatant was discarded. The precipitate was resuspended in staining buffer (5% sucrose solution with 0.01% Silwet L-77) to form a homogeneous Agrobacterium suspension (OD600 = 0.8), and transferred to an open sterile petri dish. Healthy Arabidopsis plants were selected, open flowers and pods were removed, and the inflorescences were immersed in the Agrobacterium suspension for 3 min. After inoculation, Arabidopsis thaliana was placed in a dark chamber, sprinkled with water to maintain humidity, and cultured in the dark for 12 hours. The Arabidopsis thaliana plants were then transferred to a light condition of 22-25℃ and cultured normally until flowering and fruiting. Mature seeds were harvested and sown on 1 / 2 MS medium containing 30 mg / L hygromycin for positive transgenic Arabidopsis thaliana selection, obtaining transgenic Arabidopsis thaliana OE7, OE10, and OE11.

[0166] 6) Arabidopsis thaliana cultivation

[0167] S1. Disinfection of Arabidopsis thaliana seeds

[0168] Autoclave centrifuge tubes, pipette tips, petri dishes, and other consumables. Place an appropriate amount of seeds into a 1.5 mL centrifuge tube, add 1 mL of sterile water, and vernalize at 4°C for 3 days (to promote synchronous germination). Discard the sterile water, add 1 mL of 75% ethanol, shake for 1 minute, and immediately discard the ethanol (to avoid alcohol residue damaging the seeds). Add 1 mL of 10% sodium hypochlorite (containing 0.1% Triton X-100 to enhance permeability), shake for 10 minutes to sterilize, shaking once every 2 minutes during this period. Discard the sodium hypochlorite, rinse 8 times with sterile water, and absorb all water after each rinse.

[0169] S2, Sowing

[0170] Prepare and sterilize the culture medium (0.8% agar + 1 / 2 MS medium, pH 5.7); pour the melted culture medium into petri dishes (about 0.5 cm thick) and allow it to cool and solidify; use a sterile pipette tip to draw up the seed suspension and evenly sow it on the surface of the culture medium (about 40 seeds per dish); seal the petri dishes with sealing film and label them with experimental information.

[0171] S3, Germination and Transplanting

[0172] Transfer the petri dishes to a light incubator: 22±1℃, 16 h light / 8 h darkness, and observe germination after 7 days. When the seedlings have grown 2 true leaves, transplant them into soil, seal with plastic wrap to retain moisture, and transfer to a greenhouse for another week of cultivation.

[0173] One week later, Arabidopsis thaliana without the PgEGY3 gene (CK) and Arabidopsis thaliana overexpressing the PgEGY3 gene (OE7, OE10, and OE11) were cultured under 4°C cold stress. The expression of the PgEGY3 gene and phenotypic changes in Arabidopsis thaliana were compared. The results are as follows: Figure 5-8 As shown.

[0174] Figure 5 The expression of the PgEGY3 gene in transgenic Arabidopsis thaliana under low temperature conditions of 4℃ was shown, and the results showed that it was significantly expressed under cold treatment conditions.

[0175] Figure 6 The growth status of Arabidopsis thaliana under a low temperature of 4℃ is shown. The transgenic Arabidopsis thaliana showed stronger growth than the control group.

[0176] Figure 7 The image shows a comparison of rosette leaves of Arabidopsis thaliana under cold stress treatment.

[0177] Figure 8 The results show the number of rosette leaves in Arabidopsis thaliana after 20 days under 4℃ low-temperature treatment. The results show that the number of rosette leaves in transgenic Arabidopsis thaliana is greater than that in the control group.

[0178] Figure 9The results show that the fresh weight of Arabidopsis thaliana under 4℃ low-temperature treatment was significantly increased compared with the control group under cold stress.

[0179] Experimental Example 4: Subcellular Localization

[0180] Tobacco seeds were sown in flowerpots and grown until they had 5 leaves (approximately 4-5 weeks) under 14 h light / 10 h dark conditions, at 25 °C and 60%-70% relative humidity. The full-length CDS sequence of PgEGY3 was ligated into the pSmRY-YFP vector to obtain the 35S::PgEGY3-YFP fusion expression vector, which was then introduced into Agrobacterium (GV3101). Single colonies of Agrobacterium transformed with the expression plasmid were picked and cultured overnight at 28 °C and 200 rpm in 2 mL of LB broth containing the appropriate antibiotic. 1 mL of the overnight Agrobacterium culture was transferred to 20 mL of LB broth containing the appropriate antibiotic and cultured at 28 °C and 200 rpm until the logarithmic growth phase of Agrobacterium (OD600 = 0.6-0.8). Agrobacterium cells were collected by centrifugation at 5,000 rpm for 10 min at room temperature. The Agrobacterium cells were resuspended in a staining buffer (containing 10 mM MgCl2, 10 mM MES, 150 μM acetylsylcholine, pH = 5.6) until OD600 = 1.0. After standing at room temperature for 2 h, the cells were injected into tobacco leaves. Injected plants were placed in darkness for 12 h, followed by normal incubation in a greenhouse for 48 h. Yellow fluorescence signals in the Agrobacterium-injected areas of the tobacco leaves were captured using a laser confocal microscope. The subcellular localization test results of the PgEGY3 gene are shown below. Figure 10 As shown in the figure. The results indicate that the gene may be subcellularly located on the cell membrane and is discontinuous.

[0181] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions or improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A type of foxtail grass PgEGY3 Genes, characterized by, Its nucleotide sequence is shown in SEQ ID NO.

1.

2. The Napier grass as described in claim 1 PgEGY3 Proteins encoded by genes.

3. The grass including the pampas grass of claim 1 PgEGY3 Recombinant gene expression vectors.

4. The grass including the pampas grass of claim 1 PgEGY3 Gene recombination in host cells.

5. The Napier grass as described in claim 1 PgEGY3 The application of genes, the recombinant expression vector of claim 2, or the recombinant host cell of claim 3 in improving plant cold resistance and biomass.

6. The application as described in claim 5, wherein the foxtail grass is used... PgEGY3 Genes, recombinant expression vectors, or recombinant host cells are used in the preparation of products that improve plant cold resistance and biomass.

7. The application as described in any one of claims 5-6, wherein the plant is Arabidopsis thaliana or Pennisetum alopecuroides.

8. A reagent for improving the cold resistance and biomass of *Pennisetum affine*, characterized in that, Including the foxtail grass as described in claim 1 PgEGY3 Gene, the recombinant expression vector of claim 2, or the recombinant host cell of claim 3.

Citation Information

Patent Citations

  • Method for improving heat resistance of kiwi fruit plants

    CN115474501A

  • Hg49737 gene and salt resistance application thereof

    CN116515850A

  • Molecular marker for identifying cold resistance of pennisetum alopecuroides and application of molecular marker

    CN118147353A

  • Pennisetum americanum transcription factor gene PgC3H11 for improving plant cold resistance and application thereof

    CN120464639A

  • Application of cold response PaIBH1 protein and coding gene thereof in enhancing cold stress resistance of plants

    CN120842345A

Cited By

  • 74-core molecular marker set, primer group, detection reagent, kit and gene chip for identifying cold resistance of pennisetum alopecuroides and application of 74-core molecular marker set, primer group, detection reagent, kit and gene chip

    CN121249967A

  • A 74-core molecular marker set for identifying cold tolerance of pennisetum, primer group, detection reagent, kit, gene chip and application thereof

    CN121249967B

  • Pennisetum alopecuroides cold resistance identification method based on 65 core molecular marker sets, primer group and gene chip and application of pennisetum alopecuroides cold resistance identification method

    CN121472472A

  • A method for identifying cold tolerance of pennisetum using 65 core molecular marker set, primer set and gene chip and application thereof

    CN121472472B