Molecular marker related to oil content and protein content of soybean and application of molecular marker
By developing SNP sites and molecular markers related to soybean oil and protein content, and using KASP technology for seedling screening, the problem of negative correlation between oil and protein in soybean breeding was solved, achieving efficient and accurate variety selection and improving breeding efficiency and economic benefits.
Patent Information
- Application Number
- CN202610128336.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-29
- Publication Date
- 2026-05-12
AI Technical Summary
In existing soybean breeding, oil content and protein content show a negative correlation. Traditional breeding methods have long selection cycles, high costs, and are easily affected by environmental interference, resulting in delayed and uncertain identification results, making it difficult to achieve rapid and accurate screening of high-quality soybean varieties.
We developed SNP sites and molecular markers related to soybean oil and protein content, used KASP technology for genotyping, and designed specific primer combinations and kits to achieve efficient screening in the seedling stage.
It enables simultaneous screening of both oil and protein traits, significantly enhancing the economic value of varieties, shortening the screening cycle, reducing costs, adapting to high-throughput detection needs, and improving breeding efficiency.
Smart Images

Figure CN122012774A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant breeding technology, and in particular to a molecular marker related to the oil and protein content of soybeans and its application. Background Technology
[0002] Soybeans are an important oilseed crop and source of plant protein. Seed oil content (SOC) and seed protein content (SPC) are core agronomic traits that determine their economic value. In current breeding practices, soybean oil content and protein content often show a significant negative correlation. This antagonistic relationship between traits makes synergistically increasing both contents extremely technically challenging, limiting the overall economic benefits of high-quality soybean varieties.
[0003] Traditional breeding screening mainly relies on phenotypic identification after plant maturity. This method is not only time-consuming and labor-intensive, but also highly susceptible to interference from external environmental factors such as light, soil, and climate, resulting in lag and uncertainty in phenotypic identification results, which seriously restricts the improvement of breeding efficiency.
[0004] With the development of genomics technology, molecular marker-assisted breeding (MAS) has become an important means of achieving precise screening in early generations. Among them, competitive allele-specific PCR (KASP) technology has shown promising application prospects in the field of crop genetic improvement due to its advantages such as high throughput, low cost, closed-tube operation, and no need for electrophoresis detection. By developing molecular markers closely linked to oil content and protein content, and using KASP technology for genotyping at the seedling stage or even the seed stage, it is of great significance for achieving rapid and precise breeding of high-quality soybean varieties. Summary of the Invention
[0005] To address the technical problems existing in the prior art, this invention provides a molecular marker related to the oil and protein content of soybeans and its application.
[0006] In a first aspect, the present invention provides a SNP site based on the genome version number Wm82.a2.v1, wherein the SNP site is located at position 8605814 on chromosome 8 of soybean and has a polymorphism of A / G.
[0007] Secondly, the present invention provides a molecular marker comprising a nucleic acid with a nucleotide sequence as shown in SEQ ID NO.1, wherein the 27th position exhibits polymorphism of A / G.
[0008] The nucleotide sequence shown in SEQ ID NO.1 (this sequence is a reverse sequence, so it is T here, and its complementary nucleotide is A): GCAAAATGTTATTGAAGTTGTTAATG TTAATTTTTTGCTAGCGGAAAATTGAATTCACCACTTTTTTCTTCCTTTCTTCTCTTTTTATCACCAAAACAACCTTATAACTCCTAAAACCATTTTCGTGCCTAAAATTTGTATATTAATAATTTAATACAACATTTGAGTTCTCATCTTTTTTTCTTGTTTCCCTAGGATGGGCGCCATATGTACTTCA.
[0009] Furthermore, regarding the aforementioned SNP sites and molecular markers, G represents high oil content and protein content, while A represents low oil content and protein content.
[0010] Thirdly, the present invention provides a primer pair for amplifying the aforementioned molecular marker.
[0011] The primer pair design method described in this invention can be a conventional method of this invention. Technicians can design primer pairs (including primer pairs or KASP primer combinations) of different lengths based on existing primer design rules and primer design software (such as Primer) to amplify the aforementioned molecular markers.
[0012] Fourthly, the present invention provides a KASP primer pair comprising nucleotide sequences as shown in SEQ ID NO.2-SEQ ID NO.4.
[0013] (1) F1 (SEQ ID NO.2, A allele primer): 5'-GCAAAATGTTATTGAAGTTGTTAATGT-3' (2) F2 (SEQ ID NO.3, G allele primer): 5'-GCAAAATGTTATTGAAGTTGTTAATGC-3'.
[0014] (3) R (SEQ ID NO.4, universal downstream primer): 5'-TGAAGTACATATGGCGCCCATCCTAA-3'.
[0015] The primers of SEQ ID NO.2 and SEQ ID NO.3 above include a fluorescent tag sequence at the 5' or 3' end, which can be one or more of FAM, TET, HEX, ROX, Cy3, Cy5, Alexa Fluor, SYBR Green, DAPI, FITC or Texas Red.
[0016] For example, GAAGGTGACCAAGTTCATGCT (FAM fluorescent tag sequence), GAAGGTCGGAGTCAACGGATT (HEX fluorescent tag sequence).
[0017] Fifthly, the present invention provides a kit comprising the aforementioned molecular markers or the aforementioned KASP primer combination.
[0018] Furthermore, the kit also includes: KASP Master Mix, A allele homozygous positive control DNA, G allele homozygous positive control DNA, a negative control, and one or more of the ingredients specified in the instruction manual. This kit can be directly used for large-scale laboratory testing, with a simple and easy-to-understand operating procedure and accurate and reliable test results, meeting the high-throughput screening needs in soybean breeding.
[0019] Sixthly, the present invention provides the application of the aforementioned SNP sites, or the aforementioned molecular markers, as targets in any of the following: (1) Predict or detect the oil or protein content of soybeans; (2) Identify or breed soybean varieties with high oil or protein content; (3) Molecular marker-assisted breeding of soybeans; (4) Improvement of soybean varieties related to oil or protein content; (5) Improvement of soybean germplasm resources.
[0020] The targets described in this invention include existing conventional methods and reagents for detecting nucleotides, such as gene sequencing, primer design for amplification, and probe design for targeted detection.
[0021] In a seventh aspect, the present invention provides the use of the aforementioned primer pairs, or the aforementioned KASP primer combinations, or the aforementioned kit in any of the following: (1) To predict or detect the oil or protein content of soybeans, or to prepare reagents for predicting or detecting the oil or protein content of soybeans; (2) To identify or cultivate the oil or protein content of soybeans, or to prepare reagents for identifying or cultivating the oil or protein content of soybeans; (3) Molecular marker-assisted breeding of soybeans; (4) Improvement of soybean varieties related to oil or protein content; (5) Improvement of soybean germplasm resources.
[0022] Eighthly, the present invention provides a method for detecting the oil content or protein content of soybeans, comprising: The polymorphism of molecular markers was detected in the soybean sample to be tested, as described above, and the oil content or protein content of the soybean was determined based on the genotype detection results.
[0023] Furthermore, the detection method includes one or more of the following: gene sequencing, molecular probes, liquid phase capture, or mass spectrometry.
[0024] Furthermore, the determination of the oil content or protein content of the soybean to be tested based on the genotype detection results includes: peanuts with a genotype detection result of GG have a higher oil content and protein content than peanuts with a detection result of AA.
[0025] Preferably, in the aforementioned KASP primer combination, F1 is connected to FAM and F2 is connected to HEX. In this case, the primer with only FAM signal is AA, and the primer with only HEX signal is GG.
[0026] As a preferred embodiment, the present invention provides a method for detecting the oil content or protein content of soybeans, comprising: (1) Extract genomic DNA from the soybean sample to be tested; (2) PCR amplification was performed based on the aforementioned KASP primer combination; (3) Determine the genotype detection results based on the fluorescence signal.
[0027] Preferably, the OD260 / OD280 of the genomic DNA is between 1.8 and 2.0, and the concentration is 20 to 100 ng / μL.
[0028] Preferably, the PCR amplification procedure includes: Pre-denaturation at 92~98℃ for 8~20 min; Denaturation at 92~98℃ for 15~30 seconds + annealing at 61~55℃ for 30~60 seconds (decreasing by 0.6℃ per cycle, 10 cycles); Denaturation at 92~98℃ for 15~30 seconds + annealing at 52~58℃ for 30~60 seconds (25~40 cycles).
[0029] Preferably, the PCR amplification system comprises, in a total volume of 2 μL: Soybean sample DNA template, 4~6 ng / μl, 0.7~1.5 μL; 2x Master Mix for ASPCR V1 0.7~1.5μL; KASP Assay Mix, F1:F2:R=1:1:3, 0.02~0.05μL.
[0030] Ninthly, the present invention provides a method for breeding soybeans with high oil or protein content, comprising: during the soybean breeding process, selecting soybeans with the aforementioned molecular marker genotype GG in the offspring.
[0031] The present invention has the following beneficial effects: 1. This invention effectively overcomes the long-standing technical bottleneck of a negative correlation between oil and protein content in soybean breeding by mining specific SNP sites and developing KASP molecular markers. Validated in 340 natural soybean populations and 5 environmental studies, the G genotype exhibits a stable synergistic gain advantage in both oil and protein traits (a rare oil-protein synergistic genotype), achieving simultaneous screening of these dual superior traits and significantly enhancing the overall economic value of the variety.
[0032] 2. The molecular marker provided by this invention has high specificity, and the detection results are highly consistent with the phenotype. Using allele-specific fluorescent PCR technology, rapid and accurate genotyping can be achieved. This marker exhibits stable genetic expression under various environments, filling the application gap in efficient molecular markers for the dual superior traits of soybean oil and protein, and providing a reliable technical means for precision breeding.
[0033] 3. This invention enables early and efficient screening during the seedling stage, allowing testing to be completed without waiting for plant maturity. Compared to traditional methods for identifying grain components, this invention shortens the screening cycle by 6-8 months, significantly reducing the labor and land costs required for field phenotypic identification, and lowering overall breeding costs by more than 50%.
[0034] 4. This invention is suitable for high-throughput detection needs. The KASP technology used eliminates the need for gel electrophoresis, and the detection and judgment time for a single sample is within 2 hours, enabling automated large-scale screening of 96-well or 384-well plates. This method is simple to operate and has high throughput, greatly improving the efficiency of germplasm resource evaluation and molecular marker-assisted breeding, and has broad industrial application value. Attached Figure Description
[0035] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.
[0036] Figure 1 This is a Manhattan plot of genome-wide association analysis (GWAS) of soybean oil-protein traits provided in this embodiment of the invention; where the horizontal axis represents soybean chromosomes 1-20, and the vertical axis represents the significance of association (-log). 10 (P) value, with points of different colors and shapes representing different GWAS analysis models (GLM, MLM, CMLM, etc.).
[0037] Figure 2This is a QQ plot of GWAS analysis of soybean oil-protein traits provided in this embodiment of the invention; where the horizontal axis represents the expected -log 10 (P) value, the vertical axis represents the actual observed -log 10 (P) value, different colored curves correspond to different GWAS models.
[0038] Figure 3 This is a schematic diagram of the flanking sequences and primer design of the target SNP site provided in an embodiment of the present invention. Detailed Implementation
[0039] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.
[0040] Unless otherwise specified, the experimental methods involved in the following embodiments are conventional methods in the art. For example, you can refer to the experimental manual in the art or follow the conditions recommended in the manufacturer's instructions.
[0041] Unless otherwise specified, all experimental materials and reagents used in the following examples are commercially available.
[0042] Example 1: Screening and Validation of Soybean Oil-Protein Synergistic SNP Sites Three hundred and forty genetically diverse soybean varieties (covering major producing areas such as Northeast China and the Huang-Huai-Hai Plain) were selected and planted in five environments: Changchun, Harbin, Jinan, Zhengzhou, and Wuhan. A randomized complete block design with three replicates was used, and conventional agronomic management was implemented. After soybean maturity, seed oil content (SOC) was determined by Soxhlet extraction, and protein content (SPC) was determined by Kjeldahl method. The mean values of phenotypes in multiple environments were recorded. At the same time, genomic DNA was extracted from the leaves of each variety at the seedling stage, and SNP data of the entire region of chromosome 8 were obtained by resequencing. GWAS analysis was combined to screen loci associated with oil-protein traits. Figure 1 , Figure 2 Finally, the A / G polymorphic SNP site at 8605814 bp on chromosome 8 was identified. The association values of this site with the oil-protein biphenomenon were all <0.01. Moreover, the mean SOC (19.55%) and mean SPC (40%) of the G allele homozygous type were significantly higher than those of the A allele homozygous type (SOC 19.37%, SPC 39.3%), and it was identified as the core marker site.
[0043] Figure 1 Significantly high -log chromosomal density was observed in the region of chromosome 8. 10(P) peak value, corresponding to the 8605814bp target SNP site of the present invention, indicates that this site is strongly associated with the oil-protein trait.
[0044] Figure 2 The fact that most of the points are close to the diagonal indicates that the false positive interference in the analysis is low. At the same time, the observed values of some sites are significantly higher than the expected values (such as the deviation point in the upper right corner), which further verifies the true association between the 8605814bp site and the target trait.
[0045] Example 2: Design and Validation of Specific KASP Primer Combinations Based on the soybean reference genome Wm82.a2.v1 sequence, a set of KASP primers was designed targeting the A / G polymorphic site at 8605814 bp on soybean chromosome 8. Figure 3 Following the KASP technical specifications, the 3' ends of the two allele-specific primers correspond to different alleles at the corresponding SNP site, and different fluorescent tag sequences (FAM and HEX) are introduced at the 5' ends. The universal primer is complementary to the downstream sequence of the SNP site. The primer sequences are as follows: (1) Allele A specific primer K-8OP-FAM: 5'-GAAGGTGACCAAGTTCATGCTGCAAAATGTTATTGAAGTTGTTAATGT-3'.
[0046] (2) Allele G-specific primer K-8OP-HEX: 5'-GAAGGTCGGAGTCAACGGATTGCAAAATGTTATTGAAGTTGTTAATGC-3'.
[0047] (3) Universal primer K-8OP-Common: 5'-TGAAGTACATATGGCGCCCATCCTAA-3' (SEQ ID NO.4).
[0048] Among them, GAAGGTGACCAAGTTCATGCT is the FAM fluorescent tag sequence, and GAAGGTCGGAGTCAACGGATT is the HEX fluorescent tag sequence.
[0049] After purification by HPLC, the primers were verified by soybean genome BLAST comparison. No non-target regions with homology ≥85% were bound, ensuring amplification specificity.
[0050] Example 3: Validation of the breeding application of KASP molecular markers One hundred genetically diverse soybean varieties (covering major producing areas such as Northeast China, Huang-Huai-Hai Plain, and Yangtze River Basin) were selected. Genomic DNA was extracted from the leaves of each variety at the seedling stage and the concentration was adjusted to 50 ng / μL (OD260 / OD280=1.8-2.0). The DNA was then detected using a 2 μL KASP amplification system (containing 1 μL of DNA template (5 ng / μL), 1 μL of 2×KASP Master Mix, and 0.04 μL of primer mixture (F1:F2:R=1:1:3)).
[0051] The reaction conditions are: Pre-denaturation at 95℃ for 10 minutes.
[0052] Denaturation at 95℃ for 20 seconds + annealing at 61~55℃ for 40 seconds (decreasing by 0.6℃ per cycle, 10 cycles).
[0053] 95℃ denaturation for 20 seconds + 55℃ annealing for 40 seconds (30 cycles).
[0054] After amplification, genotypes were determined using a real-time PCR instrument, and a total of 38 homozygous G allele varieties and 62 homozygous A allele varieties were screened out. After soybeans matured, the oil content (SOC) and protein content (SPC) of all varieties were determined by Soxhlet extraction and Kjeldahl nitrogen determination.
[0055] The results showed that the mean SOC of the 38 G homozygous varieties was 20.33% and the mean SPC was 41.14%, both meeting the high oil and high protein criteria (SOC≥20%, SPC≥41%). The mean SOC of the 62 A homozygous varieties was 19.05% and the mean SPC was 39.28%, both exhibiting a low oil and low protein phenotype. The high degree of fit between the genotype and the dual superior traits demonstrates that the KASP molecular marker can be efficiently applied to the rapid screening of high oil and high protein germplasm resources in natural soybean varieties.
[0056] Table 1. Results of genotype-phenotype association analysis of 100 soybean natural varieties
[0057] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. A SNP site, characterized in that, Based on the genome version number Wm82.a2.v1, the SNP site is located at position 8605814 on chromosome 8 of soybean, and the polymorphism is A / G.
2. A molecular marker, characterized in that, The molecular marker comprises a nucleic acid with a nucleotide sequence as shown in SEQ ID NO.1, wherein position 27 is polymorphic, and the polymorphism is A / G.
3. A KASP primer combination, characterized in that, The primer pair includes: F1: 5'-GCAAATGTTATTGAAGTTGTTAATGT-3'; F2: 5'-GCAAATGTTATTGAAGTTGTTAATGC-3'; R: 5'-TGAAGTACATATGGCGCCCATCCTAA-3'.
4. A reagent kit, characterized in that, Includes the molecular markers as described in claim 1 or 2, or the KASP primer combinations as described in claim 3 or 4.
5. The application of the SNP site of claim 1, or the molecular marker of claim 2, as a target in any of the following: (1) Predict or detect the oil or protein content of soybeans; (2) Identify or breed soybean varieties with high oil or protein content; (3) Molecular marker-assisted breeding of soybeans; (4) Improvement of soybean varieties related to oil or protein content; (5) Improvement of soybean germplasm resources.
6. The use of the KASP primer combination of claim 3, or the kit of claim 4, in any of the following: (1) To predict or detect the oil or protein content of soybeans, or to prepare reagents for predicting or detecting the oil or protein content of soybeans; (2) To identify or cultivate the oil or protein content of soybeans, or to prepare reagents for identifying or cultivating the oil or protein content of soybeans; (3) Molecular marker-assisted breeding of soybeans; (4) Improvement of soybean varieties related to oil or protein content; (5) Improvement of soybean germplasm resources.
7. A method for detecting the oil content or protein content of soybeans, characterized in that, include: The polymorphism of the molecular markers described in claim 1 or 2 is detected in the soybean sample to be tested, and the oil content or protein content of the soybean to be tested is determined based on the genotype detection results.
8. The method according to claim 7, characterized in that, The detection method includes: One or more of the following methods: gene sequencing, molecular probes, liquid phase capture, or mass spectrometry.
9. The method according to claim 7 or 8, characterized in that, The determination of the oil content or protein content of the soybean to be tested based on the genotype detection results includes: Peanuts with a genotype of GG have higher oil and protein content than peanuts with a genotype of AA.
10. A method for breeding soybeans with high oil or protein content, characterized in that, include: During soybean breeding, the offspring are selected from soybeans with the genotype GG of the molecular marker described in claim 1 or 2.