Deleted mutant nucleic acid and application thereof in herbicide resistance
By deleting the nucleic acid sequence in the promoter of the rice OsHPPD gene and editing the gene using the CRISPR/Cas12i3 system, the sensitivity of rice to HPPD inhibitor herbicides was solved, enabling the creation of resistant rice and improving the safety of agricultural production and the efficiency of herbicide use.
Patent Information
- Application Number
- CN202511501752.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-21
- Publication Date
- 2025-11-21
- Estimated Expiration
- 2045-10-21
AI Technical Summary
Common rice is sensitive to HPPD inhibitor herbicides, which can cause seedlings to turn white or die. Current technology makes it difficult to create effective resistant rice varieties.
By deleting a specific length of nucleic acid sequence from the promoter of the rice OsHPPD gene and using the CRISPR/Cas12i3 system for gene editing, resistance to HPPD inhibitor herbicides in rice was achieved.
Rice varieties resistant to HPPD inhibitor herbicides have been obtained, ensuring agricultural production safety and improving the efficiency of herbicide use.
Smart Images

Figure CN120989147A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of nucleic acids, and in particular to a deletion mutant nucleic acid and its application in herbicide resistance. Background Technology
[0002] In agricultural production, the use of herbicides is crucial for increasing crop yields and reducing labor costs. However, with the long-term and extensive use of herbicides, weed resistance has become increasingly prominent, leading to decreased weed control effectiveness and even phytotoxicity. To address this issue, scientists are dedicated to developing new herbicides and corresponding herbicide-resistant crop varieties. Among these, 4-hydroxyphenylpyruvate dioxygenase (HPPD) inhibitors have attracted widespread attention due to their high efficiency, low toxicity, and environmental friendliness. These herbicides inhibit HPPD enzyme activity, blocking the carotenoid biosynthesis pathway, causing weed leaves to whiten and eventually die. HPPD inhibitor herbicides are mainly used in upland crops such as corn, wheat, and barley, but common rice is extremely sensitive to them; even small amounts can cause rice seedlings to show whitening symptoms or even die. Therefore, creating rice varieties resistant to HPPD inhibitor herbicides is of great application value for ensuring agricultural production safety and improving the efficiency of herbicide use. Summary of the Invention
[0003] One invention provides a deletion mutation nucleic acid, wherein the deletion mutation occurs in rice. OsHPPD In the promoter of a gene, the length of the deleted nucleic acid sequence must be at least 25 bp. OsHPPD The A in the gene start codon ATG is at position 0, and at least the bases located at positions 2299 to 2275 upstream of the start codon ATG are deleted.
[0004] In other words, rice can develop resistance to HPPD inhibitor herbicides simply by deleting 25 bp bases (TTTTGACTTCTGAGTACATAGTATA, the sequence of which is shown in SEQ ID No. 12) located 2299 to 2275 upstream of the start codon ATG.
[0005] In one specific implementation, the length of the deleted nucleic acid sequence is between 25 bp and 83 bp, and is... OsHPPDThe A in the gene start codon ATG is at position 0, and the deleted nucleic acid occurs at positions 2302 to 2220 upstream of the start codon ATG. That is, the longest deletion sequence can be any 83 bp AGGTTTTGACTTCTGAGTACATAGTATA sequence containing 25 bp TTTTGACTTCTGAGTACATAGTATACGAACACACCTTGTGCTCGCCATAAGCCCATAACCAACACCACACACCTATTCGA (as shown in SEQ ID No. 12); it can also be any segment of the 83 bp AGGTTTTGACTTCTGAGTACATAGTATACGAACACACCTTGTGCTCGCCATAAGCCCATAACCAACACCACACACCTATTCGA (as shown in SEQ ID No. 13) containing 25 bp TTTTGACTTCTGAGTACATAGTATA (as shown in SEQ ID No. 12); or it can be any 83 bp AGGTTTTGACTTCTGAGTACATAGTATACGAACACACCTTGTGCTCGCCATAAGCCCATAACCAACACCACACACCTATTCGA (as shown in SEQ ID No. 13). Any combination of a sequence containing 25 bp TTTTGACTTCTGAGTACATAGTATA (as shown in SEQ ID No. 12) and any other sequence of any length in 83 bp AGGTTTTGACTTCTGAGTACATAGTATACGAACACACCTTGTGCTCGCCATAAGCCCATAACCAACACCACACACCTATTCGA (as shown in SEQ ID No. 13).
[0006] In one specific implementation, the length of the deleted nucleic acid sequence is between 28 bp and 83 bp, and is... OsHPPDThe A in the gene start codon ATG is at position 0, and the deleted nucleic acid occurs at positions 2302 to 2220 upstream of the start codon ATG. That is, the longest deletion sequence can be any 83 bp AGGTTTTGACTTCTGAGTACATAGTATA sequence containing 28 bp AGGTTTTGACTTCTGAGTACATAGTATACGAACACACCTTGTGCTCGCCATAAGCCCATAACCAACACCACACACCTATTCGA sequence (as shown in SEQ ID No. 13); it can also be any segment of the 83 bp AGGTTTTGACTTCTGAGTACATAGTATACGAACACACCTTGTGCTCGCCATAAGCCCATAACCAACACCACACACCTATTCGA sequence containing 28 bp AGGTTTTGACTTCTGAGTACATAGTATA sequence (as shown in SEQ ID No. 14); or it can be any 83 bp AGGTTTTGACTTCTGAGTACATAGTATACGAACACACCTTGTGCTCGCCATAAGCCCATAACCAACACCACACACCTATTCGA sequence (as shown in SEQ ID No. 13). Any combination of a sequence containing 28 bp AGGTTTTGACTTCTGAGTACATAGTATA (as shown in SEQ ID No. 14) and any other sequence of any length in 83 bp AGGTTTTGACTTCTGAGTACATAGTATACGAACACACCTTGTGCTCGCCATAAGCCCATAACCAACACCACACACCTATTCGA (as shown in SEQ ID No. 13).
[0007] In one specific implementation, the length of the deleted nucleic acid sequence is 28 bp, and... OsHPPD The A in the gene start codon ATG is at position 0, and the deleted nucleic acid occurs at positions 2302 to 2275 upstream of the start codon ATG.
[0008] In one specific implementation, the length of the deleted nucleic acid sequence is 80 bp, and... OsHPPD The A in the gene start codon ATG is at position 0, and the deleted nucleic acid occurs at positions 2299 to 2220 upstream of the start codon ATG.
[0009] In one specific implementation, the sequence of the nucleic acid before deletion is shown in SEQ ID No. 5.
[0010] The second invention provides the application of the deleted mutant nucleic acid according to any one of the inventions in the use of anti-HPPD inhibitor herbicides.
[0011] In one specific embodiment, the herbicide is mesotrione.
[0012] In one specific embodiment, the rice variety is Nanjing 46.
[0013] The third invention provides a method for obtaining rice resistant to HPPD inhibitor herbicides, which involves deleting certain components from the rice genome through gene editing or homologous recombination. OsHPPD This is achieved by obtaining a deletion mutation nucleic acid as described in any one of the present invention, using a portion of the bases in the gene promoter.
[0014] In one specific embodiment, the gene editing system is a CRISPR / Cas12i3 system.
[0015] In one specific embodiment, the method includes the following steps: 1) Obtain the pHZLib-Cas12i3 vector, or the pHZ33 and pUbi-IEE-Cas12i3 vector; 2) Obtain a crRNA sequence or target sequence for gene editing, wherein the crRNA sequence is shown in SEQ ID No. 7; and the target sequence is located at positions 34 to 56 of the sequence shown in SEQ ID No. 7. 3) The crRNA sequence is cloned into the pHZLib-Cas12i3 vector to obtain pHZLib-Cas12i3-crRNA; or the target sequence is cloned into the pHZ33 vector to obtain the pHZ33-Spacer vector, and then the pHZ33-Spacer is integrated with the pUbi-IEE-Cas12i3 vector into a single vector to obtain pUbi-IEE-Cas12i3-HZ33-Spacer; 4) pHZLib-Cas12i3-crRNA or pUbi-IEE-Cas12i3-HZ33-Spacer were transformed into Agrobacterium and used to infect rice callus tissue to screen for rice lines resistant to HPPD inhibitor herbicides.
[0016] In one specific embodiment, the rice variety is Nanjing 46.
[0017] In one specific embodiment, the pHZLib-Cas12i3 vector is constructed by the following operations: 1) replacing the DR-crRNA-BsaI-BsaI-DR element in pHZ33 with the suicide gene ccdB to obtain the pHZ33-ccdB vector; 2) integrating pHZ33-ccdB with pUbi-IEE-Cas12i3 into a single vector to obtain the pHZLib-Cas12i3 vector.
[0018] Beneficial effects of the present invention: The present invention discovers that by deleting rice OsHPPD A portion of the promoter sequence of a gene can induce resistance in rice to HPPD inhibitor herbicides, which is of great application value for ensuring agricultural production safety and improving herbicide application efficiency. Deletion mutations can be achieved using the CRISPR / Cas12i3 system, or through other CRISPR / Cas systems, gene editing, or homologous recombination. Attached Figure Description
[0019] Figure 1 A schematic diagram of the CRISPR / Cas12i3 knockout vector, namely pHZLib-Cas12i3.
[0020] Figure 2 For rice OsHPPD A schematic diagram of the target sites for the non-coding region regulatory elements.
[0021] Figure 3 This is a schematic diagram of pHZLib-Cas12i3-crRNA (Pool01) to pHZLib-Cas12i3-crRNA (Pool06).
[0022] Figure 4 Sanger sequencing was used to identify allele variant types in the selected resistant plant H4-#34.
[0023] Figure 5 Sanger sequencing was used to identify allele variant types in the selected resistant plant H4-#67.
[0024] Figure 6 The resistance phenotypes of H4-#34-54, H4-#34-10, H4-#67-80 and H4-#67-28 T2 generation plants and wild-type control (CK) after spraying with mesotrione. Detailed Implementation
[0025] The present invention will be further described in detail below through preferred embodiments, but these embodiments do not constitute a limitation thereof.
[0026] Unless otherwise specified, the strains, plasmids, and reagents used in the embodiments of this invention can all be purchased commercially.
[0027] All synthesized nucleic acids were outsourced to Beijing Qingke Xinyue Biotechnology Co., Ltd. Construction of pHZLib-Cas12i3 recombinant plasmid.
[0028] With plasmid pHZLib2 (containing ccdB Using the gene (CN2017112944154) as a template, and ccdB-F1 (as shown in SEQ ID No. 1) and ccdB-R1 (as shown in SEQ ID No. 2) as primers, PCR amplification was performed using high-fidelity enzyme I-5™ 2×High-Fidelity Master Mix (purchased from Kronin (Beijing) Biotechnology Co., Ltd.). The PCR fragment was recovered and was 809 bp in size. ccdB Gene fragment. Using plasmid pHZ33 (CN2024117722206) as a template, and phz33-outer-F (as shown in SEQ ID No. 3) and phz33-outer-R (as shown in SEQ ID No. 4) as primers, PCR amplification was performed using high-fidelity enzyme I-5™ 2×High-Fidelity Master Mix (purchased from Kloning (Beijing) Biotechnology Co., Ltd.). The PCR fragment was recovered, which was a linearized vector backbone fragment of approximately 2.8 kb in size. The fragment was then processed using the ClonExpress® II One Step Cloning Kit (purchased from Nanjing Novizan Biotechnology Co., Ltd.). ccdB The gene fragment was infused with the linearized vector backbone fragment to obtain the vector pHZ33-ccdB. In pHZ33-ccdB, the DR-crRNA-BsaI-BsaI-DR element in pHZ33 was replaced with the suicide gene ccdB.
[0029] pHZ33-ccdB was linearized by digestion with Nhe I, and then cloned into pUbi-IEE-Cas12i3 (CN2024117722206) via Gateway's LR reaction to obtain pHZLib-Cas12i3. A schematic diagram of the main components of its plasmid is shown below. Figure 1 As shown.
[0030] OsHPPD Construction of gene plasmid libraries.
[0031] OsHPPDThe gene and its upstream and downstream nucleic acid sequences (as shown in SEQ ID No. 5) were obtained from the MSU / TIGR Rice Genome Database (https: / / rice.uga.edu / ). The bases from positions 1 to 2411 at the 5' to 3' end constitute the promoter region, positions 2412 to 2479 form the 5' UTR, and positions 2480 to 3630 are... OsHPPD The exon portion of the gene (where positions 2480 to 2482 are the start codon ATG), positions 3631 to 4388 are the intron portion, and positions 4389 to 4578 are... OsHPPD The exon portion of the gene, from position 4579 to 4920, is the 3'UTR portion.
[0032] Will OsHPPD Gene editing of the non-coding regions (promoter, 3'UTR, and introns) of genes was divided into six libraries (Pool04 covers bases 176 to 817 of the sequence shown in SEQ ID No. 5, Pool03 covers bases 818 to 1327, Pool02 covers bases 1328 to 1886, Pool01 covers bases 1887 to 2479, and Pool05 covers...). OsHPPD The 3'UTR region of the gene, covered by Pool06 OsHPPD Each library contains 22 to 39 crRNA oligonucleotide sequences (including the target sequence, conserved repetitive sequences in the CRISPR / Cas12i system guide RNA located at both ends of the target sequence, and sequences flanking the conserved repetitive sequences to facilitate PCR amplification). The location of the target sequence as shown in SEQ ID No. 5 and a schematic diagram of the screening and identification process for resistant lines are shown below. Figure 2 The sequence of oligonucleotide 9, OsHPPD-Pool04-crRNA9, in Pool04 is shown in SEQ ID No. 6; the sequence of oligonucleotide 24, OsHPPD-Pool04-crRNA24, in Pool04 is shown in SEQ ID No. 7 (the target sequence is the reverse complementary sequence in SEQ ID No. 5). A total of 162 crRNA oligonucleotide sequences were synthesized.
[0033] Using an equal volume and concentration of each crRNA oligonucleotide sequence from each library as a template, and Array-F1 (as shown in SEQ ID No. 8) and Array-R1 (as shown in SEQ ID No. 9) as primers, PCR amplification was performed using I-5™ 2×High-Fidelity Master Mix. The PCR products were recovered to obtain the crRNA of the OsHPPD gene in each library. The vector pHZLib-Cas12i3 was digested with Bsa I, and approximately 15.8 kb of the vector backbone was recovered (releasing the ccdB gene fragment). Using 2×MultiF Seamless Assembly Mix, the crRNA of the OsHPPD gene from each library was cloned into a 15.8 kb vector backbone (i.e., the ccdB gene in the pHZLib-Cas12i3 vector was replaced with the crRNA of the OsHPPD gene in each library), and named pHZLib-Cas12i3-crRNA(Pool01), pHZLib-Cas12i3-crRNA(Pool02), pHZLib-Cas12i3-crRNA(Pool03), pHZLib-Cas12i3-crRNA(Pool04), pHZLib-Cas12i3-crRNA(Pool05), and pHZLib-Cas12i3-crRNA(Pool06). A schematic diagram of the main elements in the plasmid is shown below. Figure 3 As shown. Twenty colonies were randomly selected from each library for sequencing, with a 100% accuracy rate.
[0034] Rice transformation and screening and identification of nicosulfuron-resistant rice using the pHZLib-Cas12i3-crRNA(Pool01) to pHZLib-Cas12i3-crRNA(Pool06) plasmid library.
[0035] 1) Rice callus induction: Hulled mature Nanjing 46 rice seeds were treated with 50% commercial disinfectant for 30 minutes, then washed 3 to 5 times with sterile water. The seeds were then transferred to sterile petri dishes, and excess water was absorbed with sterile absorbent paper. The seeds were placed on MSD solid medium (4.43 g / L MS powder (Murashige and Skoog medium); 30 g / L sucrose; 2 ml / L 2,4-dichlorophenoxyacetic acid; 8 g / L agar powder; pH 5.7) and cultured in a light-controlled environment for 10 days to induce callus formation. The embryo and bud of the seeds were removed, and the callus tissue was transferred to a new MSD plate and cultured for 5 days until it was ready for Agrobacterium transformation.
[0036] 2) Agrobacterium transformation: Six plasmid libraries, pHZLib-Cas12i3-crRNA (Pool01) to pHZLib-Cas12i3-crRNA (Pool06), were transformed into Agrobacterium strain EHA105 via electroporation, constructing six EHA105 libraries containing all the above crRNA plasmid libraries. The six Agrobacterium libraries were then washed with sterile water and subjected to OD240-245 ... 600 Between steps 1 and 2, Agrobacterium was collected from each bacterial bank by centrifugation and resuspended in MSD liquid medium to adjust its OD value. 600 =0.2, to obtain the bacterial suspension for each bacterial cell.
[0037] 3) Agrobacterium infection of rice callus: Place the callus tissue in the bacterial suspension of each of the above 6 bacterial banks for 30 minutes; then remove the bacterial suspension, transfer the callus tissue to sterile absorbent paper to remove excess bacterial suspension, and then transfer the callus tissue to a new MSD solid medium containing 100 μmol / L acetylsyl syringone, and incubate at room temperature in the dark for 2 to 3 days.
[0038] 4) Screening of resistant rice callus: After dark culture, the callus tissue was transferred to MSD solid medium (100 mg / L termethin; 50 mg / L hygromycin B) and cultured for 2 weeks to 2 months until resistant callus appeared on the surface of the callus tissue; the medium was changed every 2 weeks.
[0039] 5) Differentiation and rooting of resistant callus: Resistant callus tissue was transferred to regeneration medium (4.43 g / L MS powder; 30 g / L sucrose; 25 g / L sorbitol; 0.5 mg / L 1-naphthaleneacetic acid; 3 mg / L 6-benzylaminopurine; 100 mg / L termethin; 50 mg / L hygromycin B; 12 g / L agar powder; pH=5.7), and then transferred every 7 to 10 days until seedlings were formed. The seedlings were then transferred to 1 / 2 MS medium (2.21 g / L MS powder; 15 g / L sucrose; 8 g / L agar powder; pH5.7) to root, obtaining T0 generation rice plants. The obtained T0 generation rice plants were placed in a greenhouse for growth until self-pollination and T0 generation seeds were harvested.
[0040] 6) Identification of herbicide-resistant lines: All collected T0 generation seeds were sown on 1 / 2 MS medium containing 0.1 μmol / L nicosulfuron for nicosulfuron resistance screening. After rooting, T1 generation rice plants were obtained and placed in a greenhouse for growth until self-pollination and seed harvesting. The corresponding T0 generation lines of the obtained T1 generation nicosulfuron-resistant rice lines were identified. Results showed that the nicosulfuron-resistant rice lines originated from Pool04 and Pool05. The Pool04 lines were numbered H4-#34 and H4-#67. H4-#34 was obtained by editing OsHPPD-Pool04-crRNA9; H4-#67 was obtained by editing OsHPPD-Pool04-crRNA24.
[0041] 7) Genomic DNA Extraction: During the growth of T0 and T1 generation rice plants, approximately 0.1 g of leaves from each plant were harvested, flash-frozen in liquid nitrogen, and then ground using a grinder. 600 μL of 2× cetyltrimethylammonium bromide (CTAB) DNA extraction buffer (containing 1 / 1000 β-mercaptoethanol) was added, and the mixture was vortexed and lysed at 65°C for 45 min. 500 μL of chloroform was added, and the mixture was vigorously shaken to form an emulsion. The emulsion was centrifuged at 14000 rpm for 10 min at ambient temperature. After centrifugation, the supernatant was transferred to a 1.5 ml centrifuge tube, and an equal volume of isopropanol was added. The mixture was inverted and centrifuged at 14000 rpm for 10 min. The supernatant was discarded, and the white precipitate was washed with 700 μL of 70% ethanol aqueous solution. The tube was centrifuged at 14000 rpm for 5 min, the supernatant was discarded, and the tube was air-dried in a fume hood for 10 min. Dissolve the DNA in 30 μL of ultrapure water to obtain genomic DNA solutions for the T0 and T1 generations of each plant. Store the DNA solutions at -20°C.
[0042] 8) PCR amplification and sequencing detection of mutation sites: Primer pairs OsHPPD-F4 (as shown in SEQ ID No. 10) and OsHPPD-R4 (as shown in SEQ ID No. 11) were designed for identifying mutation sites in H4-#34 and H4-#67. Using genomic DNA solutions from H4-#34 and H4-#67 T0 and T1 generation plants as templates, and OsHPPD-F4 and OsHPPD-R4 as primer pairs, PCR amplification was performed using 2 × Rapid Taq Master Mix (purchased from Nanjing Novizan Biotechnology Co., Ltd.). The PCR products were then directly sequenced by Sanger sequencing.
[0043] Sanger sequencing results from generation T0 of H4-#34, compared with wild-type results, showed a deletion mutation. Specifically, it exhibited a -54 bp / -10 bp biallelic deletion mutation. OsHPPD The A in the gene start codon ATG is at position 0, with a 54 bp deletion at positions 2046 to 1993 upstream of A, and a 10 bp deletion at positions 2041 to 2032 upstream of A. (See results below.) Figure 4 Sanger sequencing results for H4-#34 T1 identified homozygous mutations: H4-#34-54, with a -54 bp / -54 bp deletion mutation at positions 2046-1993 upstream of the start codon, and H4-#34-10, with a -10 bp / -10 bp deletion mutation at positions 2041-2032 upstream of the start codon. See [see details]. Figure 4 .
[0044] Sanger sequencing results from generation T0 of H4-#67, compared with wild-type results, showed that H4-#67 also contains deletion mutations. Specifically, it exhibits a -80 bp / -28 bp biallelic deletion mutation, i.e., a deletion mutation of 80 bp / 28 bp. OsHPPD The A in the gene start codon ATG is at position 0, with an 80 bp deletion at positions 2299-2220 upstream of it, and a 28 bp deletion at positions 2302-2275 upstream of it. (See results below.) Figure 5 .
[0045] Sanger sequencing results for H4-#67 identified homozygous mutations: H4-#67-80, with a -80 bp / -80 bp deletion mutation occurring at positions 2299-2220 upstream of the start codon, and H4-#67-28, with a -28 bp / -28 bp deletion mutation occurring at positions 2302-2275 upstream of the start codon. See [see details]. Figure 5 .
[0046] 9) Verification of herbicide resistance in mutant lines: The commercial herbicide nicosulfuron suspension (purchased from Hangzhou Yingtai Biotechnology Co., Ltd.) was diluted with tap water to obtain a nicosulfuron diluted solution. The concentration of this diluted solution was 8 times the recommended field application dose. T1 generation seeds of H4-#34-54, H4-#34-10, H4-#67-80, and H4-#67-28 were sown in nutrient pots to obtain corresponding T2 generation plants. Wild-type rice was sown simultaneously as a negative control. When the rice plants grew to 2-3 leaves in the greenhouse, the nicosulfuron diluted solution was sprayed using a mobile sprayer. The plants were then continued to be cultivated in the greenhouse. The growth of the T2 generation plants was observed after 14 days. Figure 6The results showed that wild-type negative control rice seedlings exhibited bleaching and gradual death under the action of nicosulfuron, while the T2 generation plants of H4-#34-54, H4-#34-10, H4-#67-80, and H4-#67-28 all showed normal growth and green plant characteristics, indicating nicosulfuron resistance. Therefore, this demonstrates that editing (disruption) of these two regulatory region sequences induced herbicide resistance in rice.
Claims
1. A deletion mutant nucleic acid, said deletion mutation occurring in rice OsHPPD In the promoter of a gene, the length of the deleted nucleic acid sequence must be at least 25 bp. OsHPPD The A in the gene start codon ATG is at position 0, and at least the bases located at positions 2299 to 2275 upstream of the start codon ATG are deleted.
2. The deletion mutant nucleic acid according to claim 1, characterized in that, The length of the deleted nucleic acid sequence ranged from 25 bp to 83 bp, and was... OsHPPD The A in the gene start codon ATG is at position 0, and the deleted nucleic acid occurs at positions 2302 to 2220 upstream of the start codon ATG.
3. The deletion of the mutant nucleic acid according to claim 2, characterized in that, The deleted nucleic acid sequence is 28 bp in length, and... OsHPPD The A in the gene start codon ATG is at position 0, and the deleted nucleic acid occurs at positions 2302 to 2275 upstream of the start codon ATG; and / or The length of the deleted nucleic acid sequence is 80 bp, and it is... OsHPPD The A in the gene start codon ATG is at position 0, and the deleted nucleic acid occurs at positions 2299 to 2220 upstream of the start codon ATG.
4. The deletion mutant nucleic acid according to any one of claims 1 to 3, characterized in that, The sequence of the nucleic acid before deletion mutation is shown in SEQ ID No.
5.
5. The use of the deleted mutant nucleic acid according to any one of claims 1 to 4 in the use of anti-HPPD inhibitor herbicides.
6. The application according to claim 5, characterized in that, The herbicide is nicosulfuron.
7. The application according to claim 5, characterized in that, The rice variety mentioned is Nanjing 46.
8. A method for accumulating HPPD inhibitor-resistant herbicides in rice, which involves deleting HPPD inhibitors from the rice genome through gene editing or homologous recombination. OsHPPD This is achieved by obtaining a deletion mutant nucleic acid as described in any one of claims 1 to 4 from a portion of the bases in the gene promoter.
9. The method according to claim 8, characterized in that, The method includes the following steps: 1) Obtain the pHZLib-Cas12i3 vector, or the pHZ33 and pUbi-IEE-Cas12i3 vector; 2) Obtain a crRNA sequence or target sequence for gene editing, wherein the crRNA sequence is shown in SEQ ID No. 7; and the target sequence is located at positions 34 to 56 of the sequence shown in SEQ ID No.
7. 3) The crRNA sequence is cloned into the pHZLib-Cas12i3 vector to obtain pHZLib-Cas12i3-crRNA; or the target sequence is cloned into the pHZ33 vector to obtain the pHZ33-Spacer vector, and then the pHZ33-Spacer is integrated with the pUbi-IEE-Cas12i3 vector into a single vector to obtain pUbi-IEE-Cas12i3-HZ33-Spacer; 4) pHZLib-Cas12i3-crRNA or pUbi-IEE-Cas12i3-HZ33-Spacer were transformed into Agrobacterium and used to infect rice callus tissue to screen for rice lines resistant to HPPD inhibitor herbicides.
10. The method according to claim 8, characterized in that, The rice variety mentioned is Nanjing 46.
Citation Information
Patent Citations
Method for improving resistance of rice to HPPD inhibitor herbicides through gene editing, and special sgRNA used therein
CN113265401A
Mutant polynucleotide and application thereof
CN113493784A
HPPD mutant protein having herbicide resistance and application thereof
WO2022151352A1
Cited By
Rice OsACC gene promoter mutant for resisting ACCase inhibitor herbicides and application of rice OsACC gene promoter mutant
CN121950858A
Paddy rice OsACC gene promoter mutant resistant to fluazifop-p-butyl or clethodim and application of paddy rice OsACC gene promoter mutant
CN121950859A
A rice osacc gene promoter mutant resistant to fluazifop-butyl or clethodim and application thereof
CN121950859B
Herbicide-resistant rice OsACC gene mutant and application thereof
CN121975823A