Application of OsDOF3 protein or coding gene thereof in improving broad-spectrum disease resistance of rice and regulating agronomic traits

Abstract

The invention belongs to the field of molecular biology, and particularly relates to application of OsDOF3 protein or a coding gene thereof to improvement of rice broad-spectrum disease resistance and regulation of agronomic traits. According to the application, an OsDOF3 knockout mutant and an overexpression transgenic line are constructed under the background of susceptible rice, resistance phenotype analysis is performed by inoculating various pathogenic bacteria (including pyricularia oryzae, rhizoctonia solani and bacterial blight), and it is proved that OsDOF3 participates in regulation and control of an immunoreaction pathway of rice to fungal diseases (rice blast and sheath blight) and bacterial diseases (bacterial blight). Meanwhile, the application also finds that after a strong promoter ubi is adopted for driving, an overexpression material of the OsDOF3 is shorter than that of a wild plant, and the OsDOF3 influences normal growth and development of rice while stimulating plant immune response. The invention provides important gene resources and molecular theoretical basis for developing a new variety of broad-spectrum disease-resistant rice.

Description

Technical Field

[0001] The present application belongs to the field of molecular biology, and specifically relates to the application of OsDOF3 protein or its encoding gene in improving the broad-spectrum disease resistance of rice and regulating agronomic traits. Background Art

[0002] During the growth and development of rice (Oryza sativa L.), fungal diseases and bacterial pathogens caused by pathogenic microorganisms such as Magnaporthe oryzae, Xanthomonas oryzae pv. oryzae, and Rhizoctonia solani constitute major biotic stress factors, leading to physiological and metabolic disorders, reduced photosynthetic efficiency, and a significant decline in yield traits. To address this critical scientific issue, systematic discovery of core genetic loci conferring multipathogen resistance, in-depth analysis of the mechanisms mediating synergistic immune interactions, and elucidation of the molecular regulatory networks underlying transcriptional reprogramming and systemic acquired resistance within immune signaling networks will provide a theoretical framework for establishing a molecular module-based rice disease resistance breeding system and have important scientific value in improving the theory of immune regulation in model monocotyledonous crops.

[0003] Members of the DOF transcription factor family perform multiple biological functions throughout the plant's growth cycle, including, but not limited to, the dynamic balance of GA / ABA signaling during seed germination, the establishment of vascular tissue morphogenesis and leaf dorsoventral polarity, floral meristem activation and pollen fertility regulation, and photoperiod-regulated flowering timing. They also participate in the dynamic balance of carbon and nitrogen assimilation pathways, the regulation of phenylpropanoid and terpenoid secondary metabolite biosynthesis, and the response to abiotic and biotic stresses through cross-talk between ROS signaling and hormones. DOF transcription factors play a crucial role in seed filling in the grass crop rice, but their involvement in resistance to multiple diseases, i.e., broad-spectrum disease resistance mediated by DOF transcription factors, has not been reported.

[0004] To successfully infect rice, different pathogens (such as rice blast, sheath blight, and bacterial blight) have evolved highly specific pathogenic strategies to disrupt the rice immune system. Therefore, identifying genes with broad-spectrum disease resistance is crucial for rice to withstand complex and diverse pathogens. Summary of the Invention

[0005] To address these issues, the present applicants constructed OsDOF3 knockout mutants and overexpressing transgenic lines in a susceptible rice background. Phenotypic analysis of resistance to various pathogens (including rice blast, sheath blight, and bacterial blight) revealed that OsDOF3 significantly affects rice resistance to these three major diseases. Furthermore, OsDOF3 was found to stimulate plant immune responses while also affecting normal rice growth and development.

[0006] In one aspect, the present application provides the use of OsDOF3 protein or its encoding gene as a target, wherein the use is any of the following: a) Use in regulating plant resistance to rice blast, sheath blight and bacterial blight; b) use in screening for substances capable of regulating plant resistance to rice blast, sheath blight and bacterial blight; c) Application in regulating plant basal defense response capabilities; d) Application in screening substances capable of regulating plant basal defense responses; e) Application in regulating agronomic traits of plants.

[0007] In certain embodiments, in the application a), the activity of the OsDOF3 protein or the expression level of its encoding gene is up-regulated, thereby increasing the plant's resistance to rice blast, sheath blight, and bacterial blight; and the activity of the OsDOF3 protein or the expression level of its encoding gene is down-regulated, thereby down-regulating the plant's resistance to rice blast, sheath blight, and bacterial blight.

[0008] In this application, rice blast resistance specifically refers to the ability of rice to defend against infection by the pathogenic fungus (Magnaporthe oryzae). The disease has the characteristics of infecting the entire growth period and can harm organs and tissues such as leaves, stems and ears. Typical symptoms are: spindle-shaped lesions with grayish-white centers and brown edges appear on leaves; infection of the ears leads to stunted grain development and, in severe cases, total crop failure. The disease usually causes a yield loss of 10%-30%, and in extreme cases it can reach 40%-50%. Some rice varieties carry susceptibility genes such as ROD1, which can suppress the immune response; while resistant varieties are not easily infected because they lack the corresponding susceptibility genes.

[0009] In this application, sheath blight resistance refers to the ability of rice to resist the pathogenic effects of Rhizoctonia solani. The disease begins to appear in the tillering stage of rice, and the typical symptoms are: small dark green water-soaked spots are formed on the leaf sheath near the water surface in the early stage, which expand into oval cloud-shaped spots as the disease progresses, with characteristic brown edges and light brown to grayish white in the center. In severe cases, large irregular spots are formed, which can extend to leaves and stems, causing premature aging of leaves and lodging of plants, and ultimately resulting in yield losses such as reduced fruit set rate and decreased grain fullness.

[0010] In this application, bacterial blight resistance specifically refers to the defense mechanism of rice against the pathogenicity of Xanthomonas oryzae (Xoo). Rice bacterial blight caused by this Gram-negative bacterium is an extremely destructive bacterial disease. Its resistance genetic characteristics are characterized by being controlled by a single gene or a few major effect genes, such as the rice Xa23 gene, which is a typical major effect gene for bacterial blight resistance. Bacterial blight can occur at various stages of rice growth, and the main sites of occurrence are on rice leaves and leaf sheaths. Initially, small translucent yellow spots will appear on the edges of rice leaves, and then expand along one or both sides of the leaf margin, or along the midrib to form wavy yellow-green or gray-green spots. After a few days, the spots will turn grayish white and curl inward, and can be quickly spread in the air by wind, rain, insects or other means, and then infect the entire rice field, appearing a withered color from a distance, hence the name bacterial blight.

[0011] In certain embodiments, in the application c), the activity of the OsDOF3 protein or the expression level of its encoding gene is up-regulated, thereby enhancing the basic defense response ability of the plant; and the activity of the OsDOF3 protein or the expression level of its encoding gene is down-regulated, thereby weakening the basic defense response ability of the plant.

[0012] In certain embodiments, in the application e), the activity of the OsDOF3 protein or the expression of its encoding gene is upregulated, and the plant height is significantly reduced.

[0013] In certain embodiments, the amino acid sequence of the OsDOF3 protein is any one of the following (1)-(3): (1) A protein consisting of the amino acids shown in SEQ ID NO. 1; (2) a protein derived from (1) having the same function as the amino acid represented by SEQ ID NO. 1, wherein one or more amino acid residues are substituted and / or deleted and / or added; (3) a protein or its derivative derived from another rice variety or other species having at least 95% sequence identity and having the same function as (1); The nucleotide sequence of the gene encoding the OsDOF3 protein is shown in any one of the following (4)-(6): (4) a DNA molecule whose coding region is the sequence shown in SEQ ID NO. 2; (5) A DNA molecule that hybridizes under stringent conditions with the DNA sequence defined in (4) and encodes a protein with the same function; (6) A DNA molecule that has at least 95% sequence identity with the DNA sequence defined in (4) and encodes a protein with the same function.

[0014] On the other hand, the present application also provides the use of a substance capable of up-regulating or down-regulating the activity of the OsDOF3 protein or the expression level of its encoding gene in regulating the resistance of plants to rice blast, sheath blight and bacterial blight, in regulating the basic defense response ability of plants, and / or in regulating the agronomic traits of plants.

[0015] In certain embodiments, the substance capable of upregulating the activity of the OsDOF3 protein or the expression of its encoding gene comprises a nucleic acid construct containing the OsDOF3 encoding gene.

[0016] In certain embodiments, the substance capable of downregulating the activity of the OsDOF3 protein or the expression of its encoding gene comprises a nucleic acid that specifically interferes with the transcription and expression of the OsDOF3 gene, preferably dsRNA, antisense nucleic acid, small interfering RNA, microRNA, shRNA, reRNA, sgRNA, and more preferably sgRNA.

[0017] In certain embodiments, the sequence of the sgRNA is shown as SEQ ID NO.3 and SEQ ID NO.4.

[0018] In certain embodiments, the amino acid sequence of the OsDOF3 protein is as described above, and the nucleotide sequence of the gene encoding the OsDOF3 protein is as described above.

[0019] On the other hand, the present application also provides a method for improving the resistance of plants to rice blast, sheath blight and bacterial blight, improving the basic defense response ability of plants, and improving the agronomic traits of plants, by introducing the substance into the plant cells or tissues.

[0020] In the present application, the plant may be a grass plant, such as rice.

[0021] Compared to the existing technology, this application constructed OsDOF3 knockout mutants and overexpression transgenic lines in a susceptible rice background. The experiment used a field inoculation method to systematically compare the differences in disease resistance of transgenic materials, confirming that OsDOF3 is involved in regulating the immune response pathway of rice to fungal diseases (rice blast, sheath blight) and bacterial diseases (bacterial leaf blight). At the same time, this application also found that after using the strong promoter ubi to drive, the OsDOF3 overexpression material was significantly lower than the wild type plant height, indicating that OsDOF3 stimulates plant immune responses while affecting the normal growth and development of rice. This application provides important genetic resources and molecular theoretical basis for the development of new broad-spectrum disease-resistant rice varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1The diagrams are structural maps of the recombinant plasmids that overexpress the gene OsDOF3; A is the map of the plasmid pUN1301-OsDOF3-Flag; and B is the map of the plasmid pUN1301-OsDOF3-GFP.

[0023] Figure 2 These are the genotype identification results of the OsDOF3 knockout materials and the protein level identification results of the OsDOF3 overexpression materials.

[0024] Figure 3 This is a fluorescence image of OsDOF3 localized in the nucleus of rice cells; A is a transient infection of tobacco cells revealing that OsDOF3 has nuclear localization, and the reported nuclear marker gene OsNLS is connected to the red fluorescent label Mcherry as an indicator, scale bar 10um; B is a root cell of the stable transgenic material pUN1301-OsDOF3-GFP, revealing that OsDOF3 has nuclear localization.

[0025] Figure 4 Figure 1 shows the results of OsDOF3's positive regulation of rice resistance to the rice blast fungus. Figure A shows OsDOF3's positive regulation of rice resistance to the rice blast fungus. OsDOF3 knockout and overexpression lines, as well as wild-type TP309, were inoculated with rice blast fungus in vitro, and disease incidence was measured 7-10 days after inoculation. Figure B shows disease incidence measured by measuring lesion extension length. Each measurement is presented in a scatter plot. Data were analyzed using a two-tailed t-test. Asterisks indicate significant differences (**P < 0.01, *P < 0.05).

[0026] Figure 5 Figure 1 shows the results of OsDOF3's positive regulation of rice resistance to sheath blight. Figure A shows OsDOF3's positive regulation of rice resistance to sheath blight. The OsDOF3 knockout strain and wild-type TP309 were inoculated with sheath blight, and disease incidence was measured seven days after inoculation. Figure B shows disease incidence measured by measuring lesion extension. Each measurement is presented in a scatter plot. Two-tailed t-tests were used for data analysis. Asterisks indicate significant differences (**P < 0.01, *P < 0.05).

[0027] Figure 6Figure 1 shows the results of OsDOF3 positively regulating rice resistance to bacterial leaf blight. Figure A shows OsDOF3 positively regulating rice resistance to the bacterial disease bacterial blight. OsDOF3 knockout and overexpression lines, as well as wild-type TP309, were inoculated with bacterial leaf blight race PXO99A. Fourteen days later, disease incidence was statistically analyzed, and representative photos were taken of diseased leaves with an average length. Figure B shows the statistical analysis of bacterial leaf blight incidence. Lesion length extending downward from the incision was measured as an indicator of disease severity. Each measurement is represented by a point. Two-tailed t-tests were used for data analysis. Asterisks indicate significant differences (**P < 0.01, *P < 0.05).

[0028] Figure 7 OsDOF3 negatively regulates agronomic traits such as plant height and plant architecture in rice. Morphological photographs of wild-type TP309, OsDOF3 knockout plants, and OsDOF3 overexpressing plants grown in the field. Overexpression of OsDOF3 results in dwarfing of rice plants. DETAILED DESCRIPTION

[0029] The present application is further described in detail below with reference to the accompanying drawings and examples. It is particularly noted that if no specific conditions are specified in the following examples, the experiments were carried out according to conventional conditions or the conditions recommended by the manufacturer. Unless otherwise specified, the raw materials used in the following examples can be obtained from common commercial sources.

[0030] Experimental Materials Oryza sativa Japonica Group variety TP309 wild type (TP309), rice blast fungus (M.oryzae): TH12, Rhizoctonia solani Kühn: highly pathogenic strain RH-9, bacterial blight fungus (Xanthomonas oryzae pv.Oryzae, Xoo): PXO99A.

[0031] Example 1 Construction of OsDOF3 gene knockout plasmid / overexpression plasmid 1. OsDOF3 gene and protein structure The rice OsDOF3 gene has an NCBI accession number of LOC4328903, a 1122-bp transcript sequence, and a 1122-bp CDS coding region. The CDS sequence is shown in SEQ ID NO. 2. This gene encodes 373 amino acids. The OsDOF3 protein sequence has an NCBI accession number of XP_015623741.1, and its amino acid sequence is shown in SEQ ID NO. 1.

[0032] 2. Construction of Rice OsDOF3 Gene Knockout Plasmid The knockout target of the gene was designed based on the genomic DNA sequence of OsDOF3, and the conserved regions cggcgcattatccccggtgg (SEQ ID NO.3) and gtgccgccgctactggaccc (SEQ ID NO.4) were selected as the target sites. The primers OsDOF3-KO-1T-F: 5'-GCCGcggcgcattatccccggtgg-3' (SEQ ID NO.5), OsDOF3-KO-1T-R: 5'-AAACccaccggggataatgcgccg-3' (SEQ ID NO.6), OsDOF3-KO-2T-F: 5'-GGCAgtgccgccgctactggaccc-3' (SEQ ID NO.7), OsDOF3-KO-2T-R: 5'-AAACgggtccagtagcggcggcac-3' (SEQ ID NO.8). NO.8) chemically synthesized the double-stranded DNA sequence, which was then assembled into the U3 and U6a promoters via enzyme digestion, ligation, and PCR. Subsequently, it was assembled into the binary vector pYLCRISPR / Cas9 via Golden Gate and Gibson Assembly cloning methods to obtain the rice OsDOF3 gene knockout recombinant plasmid pYLCRISPR / Cas9-OsDOF3, which was used to transform TP309 plants to obtain OsDOF3 knockout material.

[0033] 3. Construction of Rice OsDOF3 Gene Expression Vector 3.1 Amplification of target sequence Using genomic cDNA as template, high-fidelity DNA polymerase KOD FX (TOYOBO, Cat#KFX-101) to amplify the target fragment OsDOF3. The PCR system is shown in Table 1.

[0034] Table 1 PCR system for amplifying target fragment OsDOF3 Reagents volume Template cDNA 1μL (about 200ng) 2×KOD FX buffer 25 μL dNTP Mix (2mM) 5μL Primer F (10 μM) 2μL Primer R (10μM) 2μL KOD-FX 1 μL <![CDATA[ddH2O]]> Make up the system to 50 μL The PCR reaction procedure was as follows: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, extension at 68°C at 1 kb / min for approximately 35 cycles; extension at 68°C for 10 minutes; and 16°C for 1 minute. The primers used in the PCR reaction are listed in Table 2. The PCR product was purified on agarose gel and used for subsequent expression vector preparation.

[0035] Table 2 Primer sequences used to amplify target fragments 3.2 Enzyme digestion and ligation The restriction enzyme digestion systems for pUN1301-GFP and pUN1301-Flag plasmids are shown in Table 3.

[0036] Table 3 Plasmid enzyme digestion system After gentle mixing and brief centrifugation, incubate in a 37°C water bath for 30-60 min.

[0037] Then, the enzyme-cleaved fragments were recovered and the concentration was determined according to The recombination reaction was performed according to the instructions of the II One Step Cloning Kit (Vazyme, Cat# C112-02) (20 μL system as shown in Table 4, constant temperature at 37°C water bath for 30 min).

[0038] Table 4 Plasmid recombination reaction system Reagents volume 5×CE II Buffer 4μL Exnase II 2μL gene fragments 20~200ng Linearized vector 50~200ng <![CDATA[ddH2O]]> Make up the system to 20 μL The map of the recombinant plasmid pUN1301-OsDOF3-Flag was obtained as follows Figure 1 As shown in A, the map of the recombinant plasmid pUN1301-OsDOF3-GFP is as follows Figure 1 As shown in B.

[0039] Example 2 Obtaining gene-edited / overexpressed rice lines 1. Induction of Rice Mature Embryo Callus 1) The rice seeds were hulled using a thresher and the moldy and deformed seeds were manually screened and discarded.

[0040] 2) Add a small amount of 75% ethanol, shake by hand for about 30 seconds, and rinse with sterile water.

[0041] 3) Add 25-30% (v / v) antiformin solution and shake at 200 rpm for 30 minutes.

[0042] 4) Rinse with sterile water 5-6 times, 5-10 minutes each time.

[0043] 5) Place the seeds on sterilized filter paper to absorb the moisture on the seed surface, and use sterilized tweezers to sow the seeds on NBD medium to induce callus; NBD rice screening medium (1 L): 4.1 g NB Basal Medium (PhytoTech), 30 g sucrose, 0.5 g glutamine, 0.5 g proline, 0.5 g hydrolyzed casein, 1 mL 2,4-D solution (1 mg / mL), pH 5.8, and 4.5 g / L phytagel for solids.

[0044] 6) After culturing in the dark for about 14 days, the endosperm, plumule, and radicle are removed. The resulting callus can be used for genetic modification and subculture. Subculture is performed every two weeks, and the number of subcultures depends on the state of the callus.

[0045] 2. Preparation of Agrobacterium Transformation Solution 1) The constructed plasmids (recombinant plasmid pYLCRISPR / Cas9-OsDOF3, recombinant plasmid pUN1301-OsDOF3-Flag, and recombinant plasmid pUN1301-OsDOF3-GFP) were chemically transformed into EHA105 competent cells and cultured at 28°C for two days.

[0046] 2) Pick a single clone and culture it in 5 mL of LB liquid medium containing the corresponding antibiotics, and culture it with shaking at 28°C for 48 hours.

[0047] 3) Transfer 1 mL of overnight culture into 15 mL of AB liquid medium (20 mg / L Rif + 50 mg / L Kan + 100 mg / LAS). Cultivate at 28°C until OD600 = 0.5 (approximately 4 h). AB liquid medium (1 L): KH2PO4 3 g, NaH2PO4 1 g, NH4Cl 1 g, MgSO4·7H2O 300 mg, KCl 150 mg, CaCl2 10 mg, FeSO4·7H2O 2.5 mg, glucose 5 g.

[0048] 3. Co-culture of Rice Callus with Agrobacterium 1) Centrifuge the bacterial solution at 4000 rpm for 10 min and discard the supernatant.

[0049] 2) Resuspend the bacterial pellet in AAM containing 100 mg / L AS until the OD600 of the bacterial solution reaches 0.4-0.6.

[0050] 3) Co-culture the bacterial solution with rice callus for 20 minutes, shaking occasionally.

[0051] 4. Screening Blot the callus dry with sterile filter paper and transfer to a selection medium containing hygromycin and carbenicillin to screen for resistant callus. Change the medium every two weeks.

[0052] Screening medium: S1: 100 mg / L carbenicillin + 30 mg / L hygromycin, S2: 100 mg / L carbenicillin + 40 mg / L hygromycin, S3: 100 mg / L carbenicillin + 50 mg / L hygromycin.

[0053] 5. Differentiation The selected rice callus is transferred to a rice differentiation medium and cultured under light, with the medium replaced every two weeks until it differentiates into seedlings.

[0054] MS rice differentiation medium (1 L): M&S BASAL MEDIUM with vitamins (PhytoTech) 4.43 g, sucrose 30 g, 6-BA 3 mg / L, NAA 0.5 mg / L, pH 6.3. For solids, add 4.5 g / L phytagel.

[0055] 6. Rooting Transfer the seedlings on the differentiation medium to the rooting medium. After growing for about 2 weeks, take out the seedlings, wash off the agar medium, and culture in water for 7 days before transplanting them into the soil.

[0056] 1 / 2MS rice rooting medium (1 L): M&S BASAL MEDIUM with VITAMINS (PhytoTech) 2.165 g, sucrose 20 g, pH 6.3, solids need to add 4.5 g / L plant gel.

[0057] 1.PCR Identification The leaves of the obtained regenerated plants were taken to extract genomic DNA, and PCR amplification was performed on the regenerated plants using the primers listed in Table 5, and the amplified products were sequenced.

[0058] Table 5 Primers for identification of regenerated rice plants Through the above identification, two mutant plants were screened from the regenerated plants and named plant CR-Osdof3#1 and plant CR-Osdof3#2. Figure 2 As shown in Figure A, plant CR-Osdof3#1 has a deletion of a nucleic acid sequence in the gene encoding the OsDOF3 protein, and plant CR-Osdof3#2 has a base A inserted in the gene encoding the OsDOF3 protein. At the same time, the overexpression materials of OsDOF3 driven by the strong promoter Ubiquitin were obtained, Ubi::OsDOF3-FLAG#1-#6, as shown in Figure 1. Figure 2 As shown in Figure B, Ubi::OsDOF3-FLAG#1-#6 were highly expressed as identified by Western blotting.

[0059] Example 3 OsDOF3 is localized in the rice cell nucleus 1) The CDS sequence of the OsDOF3 protein was amplified and constructed into the 1301-GFP vector. After successful sequencing, the plasmid was transformed into Agrobacterium GV3101, shaken, and maintained.

[0060] 2) After collecting the bacteria by centrifugation, resuspend them in a transformation solution containing 10 mmol / L MgCl2, 10 mmol / L MES (pH 5.6), and 150 μmol / L acetosyringone and incubate in the dark for 3 h.

[0061] 3) Select tobacco material with a growth cycle of 3 to 4 weeks, choose healthy young leaves, and use a syringe without the needle to inject the mixed Agrobacterium transformation solution into the mesophyll tissue from the back of the tobacco leaves. After growing in the dark for several hours, culture under normal light conditions.

[0062] 4) After 32 hours of incubation, take the leaves and observe the fluorescence using Confocal.

[0063] like Figure 3 As shown, OsDOF3 is localized in the rice nucleus. Figure A shows transient transformation of tobacco plants, revealing nuclear localization of OsDOF3. A GFP tag was fused to the end of the gene and transiently transformed into tobacco leaves. Fluorescence distribution was observed 32 hours later. The reported nuclear marker gene OsNLS, linked to the red fluorescent tag mcherry, was used as an indicator. Scale bar: 10 μm. Figure B shows observation of the root tip of a stable transgenic rice line, revealing the nuclear localization of OsDOF3.

[0064] Example 4 OsDOF3 positively regulates rice resistance to rice blast fungus 1) Field-harvested seeds are oven-dried at 42°C for 4-7 days and exposed to sunlight for one week. Then, they are soaked in water at room temperature for 24 hours. The soaking water is then discarded and the seeds are rinsed three times with clean water. The seeds are then spread on a damp paper towel to retain moisture. After two days at room temperature, the seeds are ready for germination. When the seed buds are approximately 0.5 cm tall, they can be planted in greenhouse soil or hydroponic boxes. The rice incubator is maintained at 28°C with 12 hours of light and 12 hours of darkness.

[0065] 2) Activate rice blast fungus race TH12 using CM medium. Place the filter paper containing the rice blast fungus in the center of the CM solid medium. Incubate at 28°C for 7-10 days for sporulation (12 days light / 12 days dark). Once the surface of the CM medium is covered with hyphae, wash the spores with purified water containing 0.02% Tween 20, filter through a double layer of gauze, and prepare a spore suspension. The spore concentration for inoculation is 5×10 5 / ml, under a 10×10 microscope, there are an average of 30-50 spores per field of view.

[0066] 3) OsDOF3 knockout and overexpression lines, as well as wild-type TP309, were inoculated with rice blast fungus in vitro. Disease development was investigated 7-10 days after inoculation. The disease development and lesion size of each rice plant were recorded by counting lesion length and calculating fungal growth on leaves.

[0067] The results are as follows Figure 4 As shown, the length of rice blast lesions on leaves of the knockout lines CR-Osdof3#1 and CR-Osdof3#2 was significantly increased compared to wild-type TP309, while the length of rice blast lesions on leaves of the overexpression line Ubi::OsDOF3-FLAG#1-#2 was significantly reduced compared to wild-type TP309. This demonstrates that OsDOF3 positively regulates rice resistance to the fungal disease Magnaporthe grisea.

[0068] Example 5 OsDOF3 positively regulates rice resistance to sheath blight 1) Take laboratory-stored sclerotia of Rhizoctonia solani and grow them on PDA solid medium at 28°C. 1 L of PDA medium: 200 g of potatoes (cut into small pieces, boiled until soft, and filtered through four layers of cheesecloth), 20 g of glucose, and 15 g / L agar powder added to the solid medium.

[0069] 2) After new hyphae grow from the sclerotia, cut off the well-grown and uncontaminated hyphae at the front end with a sterilized blade and place them on new PDA medium for culture.

[0070] 3) Repeat step 2 until the culture medium is free of contamination from other bacteria and continue culturing for 2 to 3 days until sclerotia form.

[0071] 4) Cut the toothpicks into small pieces of about 2 cm and sterilize them.

[0072] 5) Remove the sclerotia and place them on PDA medium. After 1-2 days of culture, cover them with sterilized toothpicks and continue growing for 2-3 days. When the mycelium covers the toothpicks, they can be used for inoculation of sheath blight pathogens.

[0073] 6) Rice can be inoculated with sheath blight from about two months into its growth until heading. To inoculate, remove a toothpick with tweezers and insert it into the second and third leaf sheaths of the rice plant.

[0074] 7) The incidence of sheath blight can be observed 7 days after inoculation.

[0075] The results are as follows Figure 5 As shown, the lesion length on the leaf sheath of the knockout lines CR-Osdof3#1 and CR-Osdof3#2 was significantly increased compared with the wild type TP309, while the lesion length on the leaf sheath of the overexpression line Ubi::OsDOF3-FLAG#1-#2 was significantly decreased compared with the wild type TP309, demonstrating that OsDOF3 positively regulates rice resistance to the fungal disease Rhizoctonia solani.

[0076] Example 6 OsDOF3 positively regulates rice resistance to bacterial blight 1) Take the Xoo strain stored in the laboratory, activate it on PSA plates 2-3 times, and incubate it at 28°C for 48-72 hours.

[0077] 2) After a single colony has grown, pick a single colony and transfer it to PSA liquid culture medium and shake for 1-2 days.

[0078] 3) Pipette 100 μl of bacterial solution onto a PSA plate, spread it evenly with a clean spreader stick, and incubate it upside down at 28°C for 48-72 hours. The grown bacterial blight bacteria can be used for rice inoculation.

[0079] 4) Scrape the Bacillus subtilis grown on the PSA medium with sterile water and dilute to an OD value of 1.0.

[0080] 5) Dip a pair of scissors in the bacterial solution and cut the rice leaf 1-2 cm from the tip diagonally downward.

[0081] 6) Measure the length of the leaf spots 12-14 days after inoculation.

[0082] The results are as follows Figure 6 As shown in the results, the lesion lengths on leaves of the knockout lines CR-Osdof3#1 and CR-Osdof3#2 were significantly increased compared with those of the wild-type TP309, while the lesion lengths on leaves of the overexpression line Ubi::OsDOF3-FLAG#1-#2 were significantly decreased compared with those of the wild-type TP309, demonstrating that OsDOF3 positively regulates rice resistance to the bacterial disease Bacterial blight.

[0083] Example 7 OsDOF3 negatively regulates rice agronomic traits. The effects of OsDOF3 on rice agronomic traits were observed and found to be Figure 7 As shown, the plant height of the OsDOF3 overexpression line Ubi::OsDOF3-FLAG#1-#2 was significantly lower than that of the wild type, indicating that OsDOF3 stimulates plant immune response while affecting the normal growth and development of rice.

[0084] This specific embodiment is merely an explanation of the present application and is not a limitation of the present application. After reading this specification, those skilled in the art may make non-creative modifications to the present embodiment as needed, but as long as they are within the scope of the claims of the present application, they are protected by the patent law.

Claims

1. The use of OsDOF3 protein or its encoding gene as a target, characterized in that: The application is any of the following, a) Use in regulating plant resistance to rice blast, sheath blight and bacterial blight; b) Use in screening for substances capable of regulating plant resistance to rice blast, sheath blight and bacterial blight; c) Application in regulating plant basal defense response capabilities; d) Application in screening substances that can regulate plant basal defense responses; e) Application in regulating plant agronomic traits.

2. The use according to claim 1, characterized in that In the application a), the activity of the OsDOF3 protein or the expression level of its encoding gene is upregulated, thereby increasing the plant's resistance to rice blast, sheath blight, and bacterial blight; the activity of the OsDOF3 protein or the expression level of its encoding gene is downregulated, thereby downregulating the plant's resistance to rice blast, sheath blight, and bacterial blight.

3. The use according to claim 1, characterized in that In the application c), the activity of the OsDOF3 protein or the expression level of its encoding gene is up-regulated, thereby enhancing the basic defense response ability of the plant; and the activity of the OsDOF3 protein or the expression level of its encoding gene is down-regulated, thereby weakening the basic defense response ability of the plant.

4. The use according to claim 1, characterized in that In the application e), the activity of the OsDOF3 protein or the expression level of its encoding gene is upregulated, and the plant height is significantly reduced.

5. The use according to claim 1, characterized in that The amino acid sequence of the OsDOF3 protein is shown in any one of (1) to (3) below: (1) A protein consisting of the amino acids shown in SEQ ID NO. 1; (2) A protein derived from (1) having the same function as the amino acid represented by SEQ ID NO. 1, wherein one or more amino acid residues are substituted and / or deleted and / or added; (3) Proteins or their derivatives derived from other varieties of rice or other species that have at least 95% sequence identity and have the same function as (1); The nucleotide sequence of the gene encoding the OsDOF3 protein is shown in any one of (4) to (6) below: (4) A DNA molecule whose coding region is the sequence shown in SEQ ID NO. 2; (5) A DNA molecule that hybridizes with the DNA sequence defined in (4) under stringent conditions and encodes a protein with the same function; (6) A DNA molecule that has at least 95% sequence identity with the DNA sequence defined in (4) and encodes a protein with the same function.

6. Use of a substance capable of up-regulating or down-regulating the activity of the OsDOF3 protein or the expression of its encoding gene in regulating plant resistance to rice blast, sheath blight, and bacterial blight, in regulating plant basal defense response capabilities, and / or in regulating plant agronomic traits.

7. The use according to claim 6, characterized in that The substance capable of upregulating the activity of the OsDOF3 protein or the expression of its encoding gene includes a nucleic acid construct containing the OsDOF3 encoding gene; the substance capable of downregulating the activity of the OsDOF3 protein or the expression of its encoding gene includes a nucleic acid that specifically interferes with the transcription and expression of the OsDOF3 gene, preferably dsRNA, antisense nucleic acid, small interfering RNA, microRNA, shRNA, reRNA, or sgRNA.

8. The use according to claim 7, characterized in that The amino acid sequence of the OsDOF3 protein is as described in claim 5, and the nucleotide sequence of the gene encoding the OsDOF3 protein is as described in claim 5.

9. A method for increasing plant resistance to rice blast, sheath blight, and bacterial blight, improving plant basal defense response, and improving plant agronomic traits, characterized in that: The substance according to claim 8 is introduced into the plant cells or tissues.

Images