Genetically engineered bacterium for producing melanin as well as construction method and application of genetically engineered bacterium

Abstract

The invention relates to the technical field of genetic engineering, and particularly discloses a genetic engineering bacterium for producing melanin as well as a construction method and application of the genetic engineering bacterium. According to the application, the yield of the melanin can be effectively increased by modifying a metabolic pathway of the genetically engineered bacterium, and the yield of the melanin reaches 6.2 g / L and 18.5 g / L respectively through shake-flask culture and 5L fermentation tank culture. Compared with the prior art, the yield of melanin produced by the genetically engineered bacterium is improved by 30% at the shake flask fermentation level, the fermentation yield of a fermentation tank is improved by 4.3 times, in addition, expensive tyrosine is changed into glucose as a fermentation precursor substance, the production cost is greatly reduced, and an efficient and feasible solution is provided for large-scale production of melanin.

Description

Technical Field

[0001] This application relates to the field of genetic engineering technology, and in particular to a melanin-producing genetically engineered bacterium, its construction method, and its application. Background Technology

[0002] Melanin is a class of biopigment polymers widely found in nature (including animals, plants, and microorganisms). In the animal kingdom, especially in mammals (including humans), melanin is mainly synthesized by melanocytes located in the basal layer of the epidermis and transported to keratinocytes. Its main functions are to give skin, hair, and eyes color, and to act as a crucial physiological barrier to absorb harmful ultraviolet radiation, protecting DNA and deep tissues from photodamage. Melanin possesses antioxidant activity, free radical scavenging ability, metal ion chelating ability, good biocompatibility, semiconductor properties, and potential thermoregulatory functions, showing great potential in fields such as biomedicine, cosmetics, and functional materials.

[0003] Melanin synthesis requires the precursor L-DOPA, which is then converted into melanin through the action of tyrosinase or laccase. Currently, melanin can be produced in *Escherichia coli*, *Streptomyces*, *Pseudomonas*, *Bacillus*, and some fungi, but large-scale production is not feasible. Patent CN 118909899 A utilizes an enzyme-catalyzed synthesis method from *E. coli*, using tyrosine as a substrate, achieving a yield of 4.3 g / L in 48 hours. Patent CN 118325802 A, by knocking out the pheA, trpR, and pykA genes and expressing tyrA, tyrB, and tyrosinase at the plasmid terminus, achieves a melanin yield of approximately 580 mg / L. The earlier patent application CN 118909899A also utilizes an enzyme-catalyzed synthesis method from *E. coli*, using tyrosine as a substrate, achieving a yield of 4.3 g / L in 48 hours. Enzyme catalysis is not conducive to large-scale production and requires tyrosine as a substrate, resulting in higher costs. From a metabolic engineering perspective, this patent further knocks out lactate dehydrogenase ldhA, pyruvate kinase pykA, anthranilate synthase subunit trpE, and DNA-binding transcription dual regulator tyrR, based on previous research. It also overexpresses genes related to levodopa synthesis, such as shikimate dehydrogenase aroE, tyrosine transaminase tyrB, glucose transporter galP, transketolase tktA, phosphoenolpyruvate synthase ppsA, and 4-hydroxyphenylacetate 3-hydroxylase complex hpaBC, enabling it to directly synthesize melanin using inexpensive glucose. Simultaneously, by utilizing the need for whole-cell metabolism to relieve feedback inhibition of key genes in tyrosine synthesis, tyrA and aroF are subject to feedback inhibition by intracellular tyrosine. Mutation can effectively relieve this feedback inhibition and increase tyrosine production (Metabolic engineering of Escherichia coli for the enhanced production of l-tyrosine, Production of tyrosine from sucrose orglucose achieved by rapid genetic changes to phenylalanine-producing Escherichia coli strains.).

[0004] Genetic engineering (bacteria, yeast, fungi) is used to express key enzymes in the melanin synthesis pathway (mainly tyrosinase). While this method theoretically has sustainability advantages, it faces challenges such as low yield, high purification costs, easy enzyme inactivation, and high in vitro catalysis costs. There is a need to develop a new, efficient, controllable, and environmentally friendly method for melanin synthesis or production that can overcome the shortcomings of existing technologies to meet the growing market demand. Summary of the Invention

[0005] The purpose of this application is to overcome the shortcomings of the prior art and provide a melanin-producing genetically engineered bacterium, its construction method, and its application. The genetically engineered bacterium provided by this application has the advantages of strong precursor L-DOPA supply capacity, low cost, and high melanin production.

[0006] To achieve the above objectives, the technical solution adopted in this application is as follows:

[0007] This application provides a genetically engineered bacterium that produces melanin, wherein the genetically engineered bacterium is:

[0008] Using *Escherichia coli* as the starting strain, the following genes were knocked out: ptsG (phosphoenolpyruvate-dependent glucose transporter), ldhA (lactate dehydrogenase), pheA (branching acid mutase and prebenzoic acid dehydratase bifunctional enzyme), pykA (pyruvate kinase), trpE (o-aminobenzoic acid synthase subunit), tyrR (DNA-binding transcription dual regulator), and poxB (pyruvate dehydrogenase). Meanwhile, the following genes were overexpressed: aroE (shikimate dehydrogenase), tyrB (tyrosine transaminase), galP (glucose transporter), tktA (transketolase), ppsA (phosphoenolpyruvate synthase), and hpaBC (4-hydroxyphenylacetate 3-hydroxylase complex).

[0009] This application modifies the metabolic pathway by knocking out the lactate dehydrogenase ldhA gene, branched acid mutase / prebenzoic acid dehydratase pheA gene, pyruvate kinase pykA gene, and anthranilate synthase subunit trpE gene in Escherichia coli to block competitive pathways, and by truncating the DNA-binding transcription dual regulator tyrR gene to cut off competitive metabolic pathways. Furthermore, it overexpresses genes related to L-DOPA synthesis, such as shikimate dehydrogenase aroE gene, tyrosine transaminase tyrB gene, glucose transporter galP gene, transketolase tktA gene, phosphoenolpyruvate synthase ppsA gene, and 4-hydroxyphenylacetate 3-hydroxylase complex hpaBC gene, to promote the synthesis of L-DOPA from glucose. This modification effectively increases melanin production, ultimately achieving a melanin yield of 18.5 g / L.

[0010] As a preferred embodiment of the melanin-producing genetically engineered bacteria described in this application, the pheA gene, a bifunctional enzyme of cladoid acid mutase and prephenyl acid dehydratase, is knocked out in the genetically engineered bacteria, and the aroE gene of shikimate dehydrogenase is knocked into this site.

[0011] And / or, in the genetically engineered bacteria, the phosphoenolpyruvate-dependent glucose transporter ptsG gene is knocked out, and the glucose transporter galP gene is knocked in at this site.

[0012] And / or, in the genetically engineered bacteria, the lactate dehydrogenase ldhA gene is knocked out, and the tyrosine transaminase tyrB gene is knocked in at this site;

[0013] And / or, in the genetically engineered bacteria, the pyruvate kinase pykA gene is knocked out, and the phosphoenolpyruvate synthase ppsA gene is knocked into this site;

[0014] And / or, in the genetically engineered bacteria, the trpE gene of the anthranilate synthase subunit is knocked out, and the tktA gene of the transketolase is knocked in at this site;

[0015] And / or, in the genetically engineered bacteria, the pyruvate dehydrogenase poxB gene is knocked out, and the 4-hydroxyphenylacetate 3-hydroxylase complex hpaBC gene is knocked into this site.

[0016] In the technical solution of this application, the pheA gene is knocked out and the aroE gene is knocked into this site. The pheA-encoded bifunctional enzyme, branched acid mutase and prephenyl acid dehydratase, can reduce the metabolism of branched amino acids to phenylalanine and enhance the synthesis of tyrosine. The aroE-encoded shikimate dehydrogenase is overexpressed to catalyze the synthesis of branched amino acids from shikimate, and further synthesize tyrosine and levodopa.

[0017] Knocking out the ptsG gene and knocking in the galP gene at this site, knocking out the phosphoenolpyruvate-dependent glucose transporter encoded by ptsG and overexpressing the phosphoenolpyruvate-independent glucose transporter galP, can increase glucose uptake and reduce phosphoenolpyruvate consumption, thus diverting more glucose to carbon metabolism.

[0018] Knocking out the ldhA gene and knocking in the tyrB gene at this site reduces lactate production by knocking out the alcohol dehydrogenase encoded by ldhA; and overexpressing the tyrosine transaminase tyrB.

[0019] Knock out the pykA gene and knock in the ppsA gene at this site to knock out pykA-encoded pyruvate kinase I, thereby accumulating the key precursor phosphoenolpyruvate; overexpress phosphoenolpyruvate synthase ppsA.

[0020] Knock out the trpE gene and knock in the tktA gene at this site. Knock out the trpE-encoded anthranilate synthase component I gene to reduce competitive pathways; overexpress the transketolase tktA gene to increase the accumulation of erythrose-4-phosphate.

[0021] The poxB gene was knocked out and the hpaBC gene was knocked in at this site. The pyruvate oxidase gene encoded by poxB was knocked out to reduce acetic acid accumulation, and the 4-hydroxyphenylacetate 3-hydroxylase complex hpaBC gene was knocked in at this site.

[0022] As a preferred embodiment of the melanin-producing genetically engineered bacterium described in this application, the genetically engineered bacterium contains the mutant tyrA. fbr ;

[0023] mutant tyrA fbr The mutations are: methionine at position 53 of the tyrA gene for branching acid mutase and prephenylalanine dehydrogenase is replaced by isoleucine, and alanine at position 354 is replaced by valine.

[0024] Encoding mutant tyrA fbr The sequence is shown in SEQ ID NO: 2.

[0025] The branched acid mutase and prephenylalanine dehydrogenase tyrA genes of this application relieve tyrosine feedback inhibition by mutating methionine at position 53 to isoleucine and alanine at position 354 to valine.

[0026] This application involves mutating tyrA and aroF to relieve feedback inhibition of intracellular tyrosine in engineered bacteria and enhance their ability to synthesize levodopa.

[0027] As a preferred embodiment of the melanin-producing genetically engineered bacterium described in this application, the genetically engineered bacterium contains the mutant aroF. fbr ;

[0028] mutant aroF fbr The mutation is: the cytosine at the 443rd base of the 3-deoxy-d-arabinohepenoyl-7-phosphate synthase aroF gene is changed to guanine;

[0029] Encoding mutant aroF fbr The sequence is shown in SEQ ID NO: 3.

[0030] The 3-deoxy-d-arabinohepenosyl-7-phosphate synthase aroF of this application relieves tyrosine feedback inhibition by mutating cytosine at the 443rd base to guanine.

[0031] As a preferred embodiment of the melanin-producing genetically engineered bacteria described in this application, the genetically engineered bacteria further includes the knock-in melC2-melC1 or melA gene;

[0032] The nucleotide sequences of melC2-melC1 are shown in SEQ ID NO: 1.

[0033] When testing the melanin production of genetically engineered bacteria, it is necessary to introduce the melC2-melC1 or melA gene.

[0034] Preferably, melC2-melC1 are derived from Streptomyces lincolnensis, and the melA gene is derived from Rhizobium meliloti.

[0035] Tyrosinases expressed by the melC2-melC1 genes from Streptomyces lincolnensis and the melA gene from Rhizobium meliloti showed relatively high efficiency in catalyzing the synthesis of melanin from L-DOPA, and the resulting genetically engineered bacteria produced significantly higher melanin yields in shake flasks than tyrosinases from other sources.

[0036] This application also provides a method for constructing the above-mentioned genetically engineered bacteria, which uses CRISPR-Cas9 gene editing to knock out or knock in genes in Escherichia coli, and all knock-in genes have a non-inducible promoter introduced at the 5' end;

[0037] The knocked-out genes include: ptsG gene (phosphoenolpyruvate-dependent glucose transporter), ldhA gene (lactate dehydrogenase), pheA gene (a bifunctional enzyme of branched acid mutase and prebenzoic acid dehydratase), pykA gene (pyruvate kinase), trpE gene (an anthranilate synthase subunit), tyrR gene (a DNA-binding transcription dual regulator), and poxB gene (pyruvate dehydrogenase).

[0038] The knock-in genes include: shikimate dehydrogenase aroE gene, tyrosine transaminase tyrB gene, glucose transporter galP gene, transketolase tktA gene, phosphoenolpyruvate synthase ppsA gene, and 4-hydroxyphenylacetate 3-hydroxylase complex hpaBC gene.

[0039] In a preferred embodiment of the method for constructing the genetically engineered bacteria described in this application, the non-inducible promoter includes promoter J23119.

[0040] All knock-in genes in this application have a non-inducible promoter J23119 introduced at the 5' end to improve the expression level of the knock-in genes.

[0041] In a preferred embodiment of the method for constructing the genetically engineered bacteria described in this application, the method includes the following steps:

[0042] S1. Knock out the bifunctional enzyme pheA of branching acid mutase and prephenyl acid dehydratase in the E. coli originating strain and knock in the gene expressing shikimate dehydrogenase aroE at that site.

[0043] S2. Knock out the phosphoenolpyruvate-dependent glucose transporter ptsG gene in the engineered bacteria obtained in step S1, and knock in the glucose transporter galP gene at that site.

[0044] S3. Knock out the lactate dehydrogenase ldhA gene in the engineered bacteria obtained in step S2, and knock in the tyrB gene expressing tyrosine transaminase at that site.

[0045] S4. Knock out the tyrR gene, a dual regulator of transcription, from the DNA of the engineered bacteria obtained in step S3.

[0046] S5. Replace the tyrA genes for branching acid mutase and prephenylalanine dehydrogenase in the engineered bacteria obtained in step S4 with the mutant tyrA. fbr And its overexpression is driven by the J23119 promoter;

[0047] S6. Replace the 3-deoxy-d-arabinohepenosyl-7-phosphate synthase aroF gene in the engineered bacteria obtained in step S5 with the mutant aroF. fbr And its overexpression is driven by the J23119 promoter;

[0048] S7. Knock out the pykA gene of pyruvate kinase in the engineered bacteria obtained in step S6, and knock in the ppsA gene expressing phosphoenolpyruvate synthase at that site.

[0049] S8. Knock out the trpE gene, the subunit of anthranilate synthase, in the engineered bacteria obtained in step S7, and knock in the tktA gene, which expresses transketase, at that site.

[0050] S9. Knock out the pyruvate dehydrogenase poxB gene in the engineered bacteria obtained in step S8, and knock in the hpaBC gene expressing the 4-hydroxyphenylacetate 3-hydroxylase complex at that site.

[0051] S10. Knock out the trpR gene in the engineered bacteria obtained in step S9 to obtain genetically engineered bacteria.

[0052] All of the above genes that are knocked in at the knockout site (aroE, galP, tyrB, tyrAfbr, aroF) fbr ,tktA,ppsA,hpaBC,) all have a non-inducible strong promoter J23119 attached to their 5' end to enhance the transcription level and expression intensity of the target gene.

[0053] The J23119 promoter is a non-inducible promoter, which can achieve stable and efficient gene expression without the addition of an inducer, and is beneficial for the scale-up control of the production process.

[0054] This application also provides the application of the above-mentioned genetically engineered bacteria in melanin production.

[0055] This application uses glucose as a carbon source to efficiently synthesize the precursor levodopa, and further synthesizes melanin.

[0056] This application also provides a shake-flask culture method for enhancing melanin production, comprising the following steps:

[0057] 1) Inoculate single colonies of the above-mentioned genetically engineered bacteria into a culture medium and culture them to obtain primary seed culture;

[0058] 2) Inoculate the primary seed culture into the culture medium and culture until OD reaches [value missing]. 600 The concentration was set to 0.6-0.8, and an inducer was added for further culture to obtain the melanin fermentation broth.

[0059] Preferably, the cultivation conditions in step 1) include:

[0060] The temperature was 25℃~30℃, the stirring speed was 220rpm, and the incubation time was 12h~16h;

[0061] And / or,

[0062] The cultivation conditions in step 2) include:

[0063] The temperature is 25℃~30℃, the stirring speed is 220rpm, and the incubation time is 8h~9h.

[0064] In some specific embodiments, the shake flask culture method includes the following steps:

[0065] 1) Pick a single colony of the above-mentioned genetically engineered bacteria and inoculate it into 5 mL of LB medium. Incubate at 30℃ and 220 rpm for 12-16 h to obtain the primary seed culture.

[0066] 2) Inoculate the primary seed culture at a rate of 2% into 25 mL of NBS medium and incubate at 25°C and 220 rpm until OD (Organic Degrees Percentage). 600 Add 0.1 mM IPTG to induce enzyme expression at a temperature of approximately 0.6–0.8 h (approximately 8–9 h), and then continue culturing at 30 °C for 48 h to obtain the melanin fermentation broth.

[0067] During the shake-flask test, the pH was controlled at 6.5–6.8, and 5 g / L of glucose was added every 24 hours.

[0068] During fermentation, the pH was controlled at 6.5-6.8 using ammonia water; the fermentation temperature was 25-30℃; and fed-batch culture medium was started when the glucose concentration was below 15g / L. The glucose concentration was controlled to be below 7g / L throughout the fermentation process.

[0069] The genetically engineered bacteria provided in this application can efficiently utilize glucose as a carbon source to generate a large amount of levodopa precursors through modified and optimized glycolysis pathways, shikimic acid pathways, and levodopa synthesis pathways, and synthesize melanin under the catalysis of highly active tyrosinases melicin C2-melC1.

[0070] Through shake-flask culture and 5L fermenter culture, melanin yields reached 6.2 g / L and 18.5 g / L, respectively. Compared with traditional methods (such as Streptomyces fermentation or enzyme catalysis), the genetically engineered bacteria of this application increased the melanin yield by 30% at the shake-flask fermentation level and by 4.3 times at the fermenter fermentation level. In addition, by replacing expensive tyrosine with glucose as the fermentation precursor, production costs were significantly reduced, providing an efficient and feasible solution for the large-scale production of melanin.

[0071] Compared with the prior art, this application has the following beneficial effects:

[0072] This application provides a melanin-producing genetically engineered bacterium, its construction method, and its application. This application modifies the metabolic pathway of the genetically engineered bacterium by knocking out the following genes: ptsG (phosphoenolpyruvate-dependent glucose transporter), ldhA (lactate dehydrogenase), pheA (branching acid mutase and prebenzoic acid dehydratase bifunctional enzyme), pykA (pyruvate kinase), trpE (o-aminobenzoic acid synthase subunit), tyrR (DNA-binding transcription dual regulator), and poxB (pyruvate dehydrogenase). It also overexpresses the aroE (shikimate dehydrogenase), tyrosine transaminase, galP (glucose transporter), tktA (transketolase), ppsA (phosphoenolpyruvate synthase), and hpaBC (4-hydroxyphenylacetate 3-hydroxylase complex). This effectively increases melanin production, ultimately achieving a melanin yield of 18.5 g / L. Attached Figure Description

[0073] Figure 1 This is the metabolic pathway for melanin synthesis;

[0074] Figure 2 This is a graph showing the fermentation process of a genetically engineered bacterium that produces melanin. Detailed Implementation

[0075] To better illustrate the purpose, technical solution, and advantages of this application, the following description will be provided in conjunction with the accompanying drawings and specific embodiments.

[0076] In the following examples and comparative examples, unless otherwise specified, the experimental methods used are conventional methods, and the materials and reagents used are commercially available unless otherwise specified. Furthermore, the raw materials used in each parallel experiment are the same.

[0077] In the following examples, the culture medium components involved are as follows:

[0078] LB (Luria Bertani) liquid medium: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, sterilized at 121℃ for 20 min.

[0079] LB (Luria Bertani) solid medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, 15 g / L agar powder. Sterilize at 121°C for 20 min. Cool the solid medium to about 50°C, add the required antibiotics, pour the plate, and let it solidify. Then, place it at 4°C for later use.

[0080] Shake flask test medium NBS: glucose 20 g / L, KH2PO4 3.5 g / L, K2HPO4·3H2O 6.5 g / L, (NH4)2HPO4 3.5 g / L, MgSO4 0.12 g / L, CaCl2 11 mg / L, thiamine hydrochloride 5 mg / L, FeCl3·6H2O 0.16 mg / L, CoCl2·6H2O 0.2 mg / L, CuSO4·5H2O 0.015 mg / L, Na2MoO4·2H2O 0.02 mg / L, ZnCl2 0.02 mg / L, H3BO3 0.005 mg / L.

[0081] Fermentation medium: glucose 20g / L, yeast powder 4g / L, K2HPO4·3H2O 7.5g / L, MgSO4·7H2O 2g / L, citric acid 2g / L, ammonium sulfate 5g / L, FeSO4·7H2O, phenylalanine 0.5g / L, serine 0.5g / L.

[0082] Trace elements (1000×): CoCl2·6H2O 0.4g / L, MnSO4·H2O 0.45g / L, CuSO4·5H2O 0.06g / L, ZnSO4·7H2O 0.64g / L, Na2SO4 2g / L.

[0083] Feeding medium: glucose 750g / L, MgSO4·7H2O 3g / L, phenylalanine 0.8g / L, tryptophan 0.5g / L.

[0084] In the following examples, unless otherwise specified, the plasmid transformation into Escherichia coli DH5α was carried out using chemical transformation. The chemical transformation included the following steps: the transformation system was added to DH5α competent cells that had been thawed on ice, incubated on ice for 30 min, then heat-shocked at 42°C for 1 min, incubated on ice again for 2 min, and then 900 μL of pre-cooled LB medium was added and incubated at 37°C and 220 rpm for 60 min; 100 μL of the incubated bacterial solution was added to LB medium containing streptomycin resistance and cultured overnight at 30°C / 37°C.

[0085] Unless otherwise specified, in the following examples and comparative examples, the method for transforming plasmids into a series of engineered Escherichia coli bacteria is electroporation. Electroporation includes the following steps: take the target fragment and add it to the corresponding engineered bacteria's electroporation competent cells, gently mix it evenly, add it to an electroporation cuvette, incubate on ice for 5-10 min, electroporate at 2.5 kV, quickly add pre-cooled LB liquid medium, incubate at 30°C on a shaker for 2 h, take 100 μL of bacterial solution and spread it on LB solid medium, and incubate at 30°C for 24 h;

[0086] The method for preparing electrocompetent cells is as follows:

[0087] 1. Pick a single colony with a pipette tip and put it into a 50mL centrifuge tube containing 10mL of LB liquid medium (simultaneously prepare a blank control for the medium and pipette tip);

[0088] 2. Incubate at 37℃ and 220rpm for 14–16 hours. Then, inoculate the bacterial culture into 50mL of LB liquid medium at a ratio of 1:100. Incubate at 37℃ and 220rpm for 2–3 hours. Measure the OD every half hour. Stop incubation when the OD value reaches 0.6–0.8.

[0089] 3. Pre-cool the bacterial culture on ice for 30 min, then aliquot the culture into 50 mL pre-cooled centrifuge cups. Centrifuge at 4500 rpm for 10 min at 4 °C, discard the supernatant, resuspend the precipitate in sterile water, centrifuge at 4500 rpm for 10 min at 4 °C, discard the supernatant, resuspend the precipitate in 10% sterile glycerol, centrifuge at 4500 rpm for 10 min at 4 °C, discard the supernatant, add 300 μL of 10% glycerol to each centrifuge cup to resuspend the precipitate, then aliquot the bacterial culture into 1.5 mL centrifuge tubes at 100 μL / tube and store at -80 °C.

[0090] Unless otherwise specified, the methods for screening and eliminating pCas plasmids in the following examples and comparative examples include the following steps: electroporated competent cells are spread on LB solid medium containing kanamycin and spectinomycin, cultured at 30°C for 24 h, and transformants are picked and colony PCR is performed using the corresponding primers for verification.

[0091] After verifying positive transformants, colonies were picked and induced in LB liquid medium containing IPTG. The culture was then diluted and spread onto LB solid medium containing kanamycin. The cultures were incubated at 30°C for 12–16 h. Single colonies were picked and inoculated into LB solid medium containing kanamycin and spectinomycin. Single colonies that grew only on kanamycin monoclonal antibody medium and did not grow on kanamycin-spectinomycin dual antibody medium were considered as strains that eliminated the sg-pTarget plasmid.

[0092] The strains that eliminated the sg-pTarget plasmid were inoculated into antibiotic-free LB solid medium and cultured at 42°C until single colonies grew. Antibiotic validation was performed according to the above method. Strains that grew only on antibiotic-free LB solid medium and did not grow on kanamycin monoclonal antibody LB solid medium were considered strains that eliminated the pCas plasmid. These strains were antibiotic-free stable engineered bacteria.

[0093] The final concentrations of kanamycin and spectinomycin in the above-mentioned LB solid medium were 50 μg / mL and 50 μg / mL, respectively; the final concentration of IPTG in the above-mentioned LB liquid medium was 0.1 mM.

[0094] The nucleotide sequences of melC2-melC1 are shown in SEQ ID NO: 1:

[0095] SEQ ID NO: 1 is:

[0096] ATGACCGTTCGTAAGAACCAGGCTTCTCTGACTGCGGACGAAAAACGTCGTTTCGTTGCAGCTGTGTTGGAACTGAAACGTAGCGGTCGTTACGATGCATTCGTGACCACTCACAACGGTTTCATCATGTCCGATATGGACAACAGCGAACGTACCGGTCATCGTTCTCCGTCTTTCTTGCCGTGGCATCGTCGTTTCTTGCTGGACTTCGAACGTGCTCTTCAGTCTGTTGACGCAAGCGTTGCTCTGCCGTACTGGGACTGGACCGCAGATCGTACTGTTCGTGCTTCTCTGTGGGCACCAGACTTTCTGGGTGGTACTGGCCGTTCTTCTGATGGTCGTGTTATGGATGGTCCGTTTGCTGCTGGTGCTGGCAACTGGCCGCTGAACGTGCGTGTAGACGGTCGTACCTACCTGCGTCGTTCTTTGGCGGCTGGTGTTCGTGAACCGCCGACTCGTGCTGAAGTAGACTCCGTACTGGCACTGACCACCTACGATATGGCGCCGTGGAACTCTGCTTCTGACGGTTTCCGTAACCACCTGGAAGGTTGGCGTGGTGTGAACCTGCACAACCGTGTTCACGTGTGGGTTGGTGGTCAGATGGGCACCGGTGTATCTCCAAACGATCCGGTGTTCTGGCTGCACCATGCGTTCATCGACAAACTGTGGGCAGACTGGCAGCGTCGTCATCCGGGTGCAGGTTACGCGCCGACCGGTGGTACTCCAGATGTTGTTGATCTGAA CGACACCATGAAACCGTGGAACGATGTTCGTCCGGCAGACCTGCTGGACCACACCAAATTCTACACCTTCGATGTTTAA。

[0097] The nucleotide sequence encoding mutant tyrA fbr is shown in SEQ ID NO: 2;

[0098] SEQ ID NO: 2 is:

[0099]

[0100] Encoding mutant aroF fbr The nucleotide sequence is shown in SEQ ID NO: 3;

[0101] SEQ ID NO: 3 is:

[0102] ATGCAAAAAGACGCGCTGAATAACGTACATATTACCGACGAACAGGTTTTAATGACTCCGGAACAACTGAAGGCCGCTTTTCCATTGAGCCTGCAACAAGAAGCCCAGATTGCTGACTCGCGTAAAACCATTTCAGATATTATCGCCGGGCGCGATCCTCGTCTGCTGGTAGTATGTGGTCCTTGTTCCATTCATGATCCGGAAACTGCTCTGGAATATGCTCGTCGATTTAAAGCCCTTGCCGCAGAGGTCAGCGATAGCCTCTATCTGGTAATGCGCGTCTATTTTGAAAAACCCCGTACCACTGTCGGCTGGAAAGGGTTAATTAACGATCCCCATATGGATGGCTCTTTTGATGTAGAAGCCGGGCTGCAGATCGCGCGTAAATTGCTGCTTGAGCTGGTGAATATGGGACTGCCACTGGCGACGGAAGCGTTAGATCTGAATAGCCCGCAATACCTGGGCGATCTGTTTAGCTGGTCAGCAATTGGTGCTCGTACAACGGAATCGCAAACTCACCGTGAAATGGCCTCCGGGCTTTCCATGCCGGTTGGTTTTAAAAACGGCACCGACGGCAGTCTGGCAACAGCAATTAACGCTATGCGCGCCGCCGCCCAGCCGCACCGTTTTGTTGGCATTAACCAGGCAGGGCAGGTTGCGTTGCTACAAACTCAGGGGAATCCGGACGGCCATGTGATCCTGCGCGGTGGTAAAGCGCCGAACTATAGCCCTGCGGATGTTGCGCAATGTGAAAAAGAGATGGAACAGGCGGGACTGCGCCCGTCTCTGATGGTAGATTGCAGCCACGGTAATTCCAATAAAGATTATCGCCGTCAGCCTGCGGTGGCAGAATCCGTGGTTGCTCAAATCAAAGATGGCAATCGCTCAATTATTGGTCTGATGATCGAAAGTAATATCCACGAGGGCAATCAGTCTTCCGAGCAACCGCGCAGTGAAATGAAATACGGTGTATCCGTAACCGATGCCTGCATTAGCTGGGAAATGACCGATGCCTTGCTGCGTGAAATTCATCAGGATCTGAACGGGCAGCTGACGGCTCGCGTGGCTTAA。

[0103] The nucleotide sequence of the melA gene is shown as SEQ ID NO: 102;

[0104] SEQ ID NO: 102 is:

[0105]

[0106] The primers used in the following examples are shown in Table 1.

[0107] Table 1

[0108]

[0109]

[0110]

[0111]

[0112]

[0113] Information on the genetically engineered bacteria constructed in the examples is shown in Table 2.

[0114] Table 2

[0115] strain name strain information MEL-01 BL21(DE3)ΔpheA::aroE MEL-02 MEL-01ΔptsG::galP MEL-03 MEL-02ΔldhA::tyrB MEL-04 MEL-03ΔtyrR MEL-05 <![CDATA[MEL-04ΔtyrA::tyrA fbr ]]> MEL-06 <![CDATA[MEL-05ΔaroF::aroF fbr ]]> MEL-07 MEL-06ΔpykA::ppsA MEL-08 MEL-07ΔtrpE::tktA MEL-09 MEL-08ΔpoxB::hpaBC MEL-10 MEL-09ΔtrpR

[0116] Example 1: A genetically engineered bacterium producing melanin and its construction method

[0117] This embodiment provides a method for constructing a genetically engineered bacterium that produces melanin, including the following steps:

[0118] I. Construction of engineered bacteria MEL-01:

[0119] Taking ΔpheA::aroE as an example, the construction method for the other typed engineered bacteria is similar.

[0120] 1.1 Based on the shikimate dehydrogenase aroE sequence of Escherichia coli BL21(DE3), the aroE fragment was amplified by PCR using primers 95S-aroE-F and 95S-aroE-R. The aroE fragment was then assembled into the 95S plasmid backbone by Gibson ligation and transformed into DH5α to obtain the 95S-aroE plasmid.

[0121] 1.2 Using the BL21(DE3) genome as a template, pheA-U800F / pheA-U800R and pheA-D800F / pheA-D800R were used as primers for PCR amplification to obtain pheA UP800 and pheA Down 800 fragments, respectively.

[0122] 1.3 Using the 95S-aroE plasmid obtained in step 1.1 as a template, the J23119-aroE fragment was amplified by PCR using tac / 119-F1 and rrnB-R1 primers; then, using the pheA UP800, pheA Down 800 fragments and the J23119-aroE fragment obtained in 1.2 as templates, the ΔpheA::aroEDonor expression cassette was amplified by PCR extension using pheA-U500F and pheA-D500R primers.

[0123] 1.4 BL21(DE3) strain was prepared into competent cells, and the pCas9 plasmid was transformed into the competent cells. The cells were then plated on kanamycin-resistant LB agar plates, and the resulting single colonies were considered competent.

[0124] BL21(DE3) / pCas9.

[0125] 1.5 Using the website http: / / crispr.hzau.edu.cn / CRISPR2, primers pT-pheA-F and pT-pheA-R were designed for the pheA site sgRNA. PCR amplification was performed using pTargetF plasmid as a template. The obtained gene fragment was digested with DpnI enzyme and transformed into DH5α by chemical transformation to obtain the transformation product. The transformation product was plated on LB solid medium plates containing spectinomycin. The plasmid was extracted from the single colony and sequenced for verification. The strain that was verified correctly was the transformant carrying the pTargetF-pheA plasmid.

[0126] 1.6 The ΔpheA::aroE Donor expression cassette obtained in step 1.5 and the pTargetF-pheA plasmid obtained in step 1.5 were electroporated together into the BL21(DE3) / pCas9 electroporation competent cells obtained in step 1.4. After screening, colony PCR verification was performed using pheA-U800F and pheA-D800R, with BL21(DE3) as a control. Positive transformants were obtained by screening, and then the pTargetF-pheA plasmid and pCas9 plasmid in the positive transformants were eliminated to obtain the non-resistant, stable aroE overexpressing engineered bacteria MEL-01.

[0127] II. Construction of engineered bacteria MEL-02:

[0128] The construction method is the same as MEL-01, with the starting strain being MEL-02, the integrated gene being galP, and the integration site being ptsG. The linear galP fragment was amplified using primers 95S-galP-F and 95S-galP-R, assembled into a 95S backbone, and the resulting 95S-galP plasmid was amplified using primers tac / 119F and rrnB-R1 to obtain the J23119-galP fragment. Using the BET-01 genome as a template, ptsG-UP and ptsG-Down fragments were amplified using primers ptsG-U800F and ptsG-U800R, ptsG-D800F and ptsG-D800R. Using ptsG-UP, J23119-galP, and ptsG-Down as templates, the ΔptsG::galP Donor expression cassette was amplified using primers ptsG-U500F and ptsG-D500R. pTarget-ptsG was constructed using primers pT-ptsG-F and pT-ptsG-R. The MEL-02 engineered bacteria were then constructed according to method 1.6.

[0129] III. Construction of engineered bacteria MEL-03:

[0130] The starting strain was MEL-02, the integrated gene was tyrB, and the integration site was ldhA. The linear tyrB fragment was amplified using primers 95S-tyrB-F and 95S-tyrB-R, assembled into a 95S backbone, and the resulting 95S-tyrB plasmid was amplified using primers tac / 119F and rrnB-R1 to obtain the J23119-tyrB fragment. Using the MEL-03 genome as a template, the ldhA-UP and ldhA-Down fragments were amplified using primers ldhA-U800F and ldhA-U800R, ldhA-D800F and ldhA-D800R. Using ldhA-UP, J23119-tyrB, and ldhA-Down as templates, the ΔldhA::tyrB Donor expression cassette was amplified using primers ldhA-U500F and ldhA-D500R. pTarget-ldhA was constructed using primers pT-ldhA-F and pT-ldhA-R. The MEL-03 engineered bacteria were then constructed according to method 1.6.

[0131] IV. Construction of engineered bacteria MEL-04:

[0132] The starting strain was MEL-03, with tyrR knocked out. Using the MEL-03 genome as a template, the tyrR-UP and tyrR-Down fragments were amplified using primers tyrR-U800F and tyrR-U800R, tyrR-D800F and tyrR-D800R. Using tyrR-UP and tyrR-Down as templates, the ΔtyrR Donor fragment was amplified using primers tyrR-U500F and tyrR-D500R. pTarget-tyrR was constructed using primers pT-tyrR-F and pT-tyrR-R. The MEL-04 engineered strain was constructed according to method 1.6.

[0133] V. Construction of engineered bacteria MEL-05:

[0134] The originating strain was MEL-04, and the integrated gene was tyrA. fbr The integration site is tyrA. The mutated tyrA... fbr The sequence (the methionine at position 53 of the tyrA gene is mutated to leucine, and the alanine at position 354 is mutated to valine; the nucleotide sequence is shown in SEQ ID NO: 2) was sent to a biotechnology company to synthesize the gene fragment, using primer 95S-tyrA. fbr -F and 95S-tyrA fbr -R amplifies tyrA fbr Linear fragments are assembled into a 95S skeleton to obtain 95S-tyrA. fbr The plasmid was then amplified using primers tac / 119F and rrnB-R1 to obtain J23119-tyrA. fbr Fragments. Using the BET-04 genome as a template, the tyrA-UP and tyrA-Down fragments were amplified using primers tyrA-U800F and tyrA-U800R, tyrA-D800F and tyrA-D800R. The tyrA-UP and J23119-tyrA fragments were then amplified. fbr Using tyrA-Down as a template, ΔtyrA::tyrA was amplified using primers tyrA-U500F and tyrA-D500R. fbr Donor expression cassette. pTarget-tyrA was constructed using primers pT-tyrA-F and pT-tyrA-R. The MEL-05 engineered bacteria were then constructed according to method 1.6.

[0135] VI. Construction of engineered bacteria MEL-06:

[0136] The originating strain was MEL-05, and the integrated gene was aroF. fbr(The cytosine of the 443rd base of the aroF gene is mutated to guanine, nucleotide sequence as shown in SEQ ID NO: 3), the integration site is aroF. Primer 95S-aroF was used. fbr -F and 95S-aroF fbr -R amplification aroF fbr Linear segments are assembled into the 95S skeleton to obtain...

[0137] 95S-aroF fbr The plasmid was then amplified using primers tac / 119F and rrnB-R1 to obtain the J23119-tyrB fragment. Using the BET-05 genome as a template, the aroF-UP and aroF-Down fragments were amplified using primers aroF-U800F and aroF-U800R, aroF-D800F and aroF-D800R. fbr Using aroF-Down as a template, ΔaroF::aroF was amplified using primers aroF-U500F and aroF-D500R. fbr Donor expression cassette. pTarget-aroF was constructed using primers pT-aroF-F and pT-aroF-R. The MEL-06 engineered bacteria were then constructed according to method 1.6.

[0138] VII. Construction of engineered bacteria MEL-07:

[0139] The starting strain was MEL-06, the integrated gene was ppsA, and the integration site was pykA. The linear ppsA fragment was amplified using primers 95S-ppsA-F and 95S-ppsA-R, assembled into a 95S backbone, and the resulting 95S-ppsA plasmid was amplified using primers tac / 119F and rrnB-R1 to obtain the J23119-ppsA fragment. Using the MEL-06 genome as a template, the pykA-UP and pykA-Down fragments were amplified using primers pykA-U800F and pykA-U800R, and pykA-D800F and pykA-D800R. Using pykA-UP, J23119-ppsA, and pykA-Down as templates, the ΔpykA::ppsA Donor expression cassette was amplified using primers pykA-U500F and pykA-D500R. pTarget-pykA was constructed using primers pT-pykA-F and pT-pykA-R. The MEL-07 engineered bacteria were then constructed according to method 1.6.

[0140] VIII. Construction of engineered bacteria MEL-08:

[0141] The starting strain was MEL-07, the integrated gene was tktA, and the integration site was trpE. The linear tktA fragment was amplified using primers 95S-tktA-F and 95S-tktA-R, assembled into a 95S backbone, and the resulting 95S-tktA plasmid was amplified further using primers tac / 119F and rrnB-R1 to obtain the J23119-tktA fragment. Using the MEL-07 genome as a template, the trpE-UP and trpE-Down fragments were amplified using primers trpE-U800F and trpE-U800R, trpE-D800F and trpE-D800R. Using trpE-UP, J23119-tktA, and trpE-Down as templates, the ΔtrpE::tktA Donor expression cassette was amplified using primers trpE-U500F and trpE-D500R. pTarget-trpE was constructed using primers pT-trpE-F and pT-trpE-R. The MEL-08 engineered bacteria were then constructed according to method 1.6.

[0142] IX. Construction of engineered bacteria MEL-09:

[0143] The starting strain was MEL-08, the integrated gene was hpaBC, and the integration site was poxB. The linear hpaBC fragment was amplified using primers 95S-hpaBC-F and 95S-hpaBC-R, assembled into a 95S backbone, and the resulting 95S-hpaBC plasmid was amplified using primers tac / 119F and rrnB-R1 to obtain the J23119-hpaBC fragment. Using the MEL-08 genome as a template, poxB-UP and poxB-Down fragments were amplified using primers poxB-U800F and poxB-U800R, and poxB-D800F and poxB-D800R. Using poxB-UP, J23119-hpaBC, and poxB-Down as templates, the ΔpoxB::hpaBC Donor expression cassette was amplified using primers poxB-U500F and poxB-D500R. pTarget-poxB was constructed using primers pT-poxB-F and pT-poxB-R. The MEL-09 engineered bacteria were then constructed according to method 1.6.

[0144] 10. Construction of engineered bacteria MEL-10:

[0145] The starting strain was MEL-09, and the knockout gene was trpR. Using the MEL-09 genome as a template, trpR-UP and trpR-Down fragments were amplified using primers trpR-U800F and trpR-U800R, trpR-D800F and trpR-D800R. Using trpR-UP and trpR-Down as templates, the ΔtrpR Donor fragment was amplified using primers trpR-U500F and trpR-D500R. pTarget-trpR was constructed using primers pT-trpR-F and pT-trpR-R. The MEL-10 engineered strain was constructed according to the method described in section 1.6.

[0146] Example 2: Enzyme activity of tyrosinases from different sources

[0147] This embodiment screened tyrosinase genes from multiple sources. After codon optimization, the target gene sequence was synthesized by a biotechnology company and cloned into the pET28a expression vector. The constructed recombinant plasmid was introduced into the engineered strain MEL-10 to obtain the MEL-10 / pET28a-melC2-melC1 genetically engineered strain. Its effect on melanin synthesis yield was tested by shake-flask fermentation. Single clones were picked and activated in test tubes, and inoculated into NBS medium at a 2% inoculum. The culture was carried out at 30°C until the OD600 reached approximately 0.6. Protein expression was induced by adding 0.1 mM IPTG, and melanin production was measured after 48 h of culture.

[0148] The melanin production results of the engineered strain MEL-10 expressing tyrosinases from different sources are shown in Table 3 below:

[0149] Table 3

[0150] Gene source Production g / L Ab tyrA Agaricus bisporus 1.64 melC2-melC1 Streptomyces lincolnensis 4.89 melA Rhizobium meliloti 4.77 Af tyrA Aspergillus fumigatus 1.94 Ec TyrA Escherichia coli 0.86

[0151] The results showed that the tyrosinases expressed by the melC2-melC1 (SQE IDNO: 1) gene from *Streptomyces lincolnensis* and the melA gene from *Rhizobium meliloti* had relatively high efficiency in catalyzing the synthesis of melanin from L-DOPA, and the corresponding melanin shake flask yields were significantly better than those from other sources.

[0152] Example 3: A shake-flask culture method for synthesizing melanin

[0153] This embodiment provides a shake-flask culture method for synthesizing melanin, which includes the following steps:

[0154] Step 1: The MEL-10 / pET28a-melC2-melC1 genetically engineered bacteria from Example 2 were cultured in LB solid medium at 37°C for 16 hours.

[0155] Step 2: Pick a single colony and inoculate it into 5 mL of LB medium. Incubate at 30°C and 220 rpm for 16 h to obtain the primary seed culture.

[0156] Step 3: Add 2% of the primary seed culture to 25 mL of NBS medium and incubate at 25°C and 220 rpm until OD reaches 100%. 600 After approximately 0.6 hours (about 8-9 hours), 0.1 mM IPTG was added to induce enzyme expression, and then the mixture was incubated at 30°C for another 48 hours to obtain the melanin fermentation broth. During the shake flask test, the pH was controlled at 6.5, and 5 g / L glucose was added every 24 hours.

[0157] Example 4: Production of melanin by fermentation of genetically engineered strains

[0158] The highly active tyrosinase pET28a-melC2-melC1 screened in Example 2 was transformed into various genetically engineered bacteria, and the shake-flask test method of Example 3 was used. The final melanin yield and biomass were measured after 48 hours, and the results are shown in Table 4.

[0159] Table 4

[0160] strain name Melanin production (g / L) <![CDATA[OD 600 ]]> BL21(DE3) 0.02 28 MEL-01 0.4 23.6 MEL-02 1.05 23.8 MEL-03 1.2 23.04 MEL-04 1.83 24 MEL-05 3.3 22.64 MEL-06 4.6 22.47 MEL-07 4.93 21.6 MEL-08 4.96 21.87 MEL-09 5.6 21.09 MEL-10 6.2 20.23 MEL-10 / pET28a-melA 5.9 20.6

[0161] The results showed that with the gradual modification of the metabolic pathway, the ability of the engineered strain to synthesize melanin was significantly enhanced. When the final strain MEL-10 carried pET28a-melC2-melC1, the melanin production in the shake flask reached 6.2 g / L after 48 hours, which was about 280 times higher than that of the wild type BL21(DE3) (0.02 g / L).

[0162] Notably, after knocking out genes related to phenylalanine (pheA, which involves modification of the phenylalanine pathway) and tryptophan (trpE) synthesis, the strain's growth (OD) was significantly reduced. 600 The growth of the bacteria was inhibited to some extent (wild type 28 vs MEL-10 20.23). During the later stages of fermentation, cell growth could be improved by adding small amounts of phenylalanine and tryptophan to the culture medium.

[0163] Example 5: A fermentation method for synthesizing melanin

[0164] This embodiment provides a fermentation method for synthesizing melanin, which includes the following steps:

[0165] 1. Seed activation:

[0166] (1) Plate activation: Take the engineered bacteria MEL-10 stored at -80℃, melt it, streak it on solid LB medium, and then place it in an incubator at 37℃ and invert it for culture.

[0167] (2) Primary seed culture: Use a sterile inoculation loop to pick up one loop of activated colonies from a plate and inoculate them into LB liquid medium. Incubate at 37°C and 200 rpm for 12 hours to obtain activated bacterial solution.

[0168] (3) Secondary seed culture: The activated bacterial culture was inoculated into the secondary seed culture medium at a 10% inoculum. Cultured at 37℃ and 200 rpm until OD... 600 From 12 to 18.

[0169] (3) Transfer 200 mL of seed culture to a 5 L fermenter containing 2 L of fermentation medium for the first stage of fermentation. The pH was controlled at 6.8, the temperature at 25 °C, the initial aeration ratio at 1 vvm, the initial rotation speed at 300 rpm, and the dissolved oxygen (DO) was controlled at 20%. Under these conditions, the OD was cultured. 600 Add 0.1 mM IPTG inducer to a temperature of 20°C.

[0170] (4) After 16 hours, adjust the fermentation parameters to maintain dissolved oxygen (DO) at 30% and pH at 6.5. When the glucose concentration in the fermentation broth drops below 15 g / L, start feeding the culture medium, controlling the glucose concentration within the range of 15-20 g / L. Fermentation is completed after 48 hours to obtain the melanin fermentation broth. The maximum biomass OD during fermentation was measured. 600 The value is 255, and the melanin content is 18.5 g / L.

[0171] Melanin synthesis metabolic pathway, such as Figure 1 As shown.

[0172] The fermentation process curve of the melanin-producing genetically engineered bacterium MEL-10 / pET28a-melC2-melC1 is shown in the figure below. Figure 2 As shown.

[0173] The genetically engineered strain MEL-10 / pET28a-melC2-melC1 constructed in this application can efficiently utilize glucose as a carbon source to generate a large amount of L-DOPA precursor through modified and optimized glycolysis, shikimic acid, and L-DOPA synthesis pathways. This precursor then synthesizes melanin under the catalysis of the highly active tyrosinase melC2-melC1. Melanin yields reached 6.2 g / L in shake flask fermentation and 18.5 g / L in a 5L fermenter. Compared with existing technologies, the engineered strain of this application increases melanin production yield by 30% in shake flask fermentation and by 4.3 times in fermenter fermentation. Furthermore, by replacing expensive tyrosine with glucose as the fermentation precursor, production costs are significantly reduced, providing an efficient and feasible solution for the large-scale production of melanin.

[0174] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of this application and are not intended to limit the scope of protection of this application. Although this application has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of this application without departing from the substance and scope of the technical solutions of this application.

Claims

1. A genetically engineered bacterium that produces melanin, characterized in that, The genetically engineered bacteria are: Using *Escherichia coli* as the starting strain, the following genes were knocked out: ptsG (phosphoenolpyruvate-dependent glucose transporter), ldhA (lactate dehydrogenase), pheA (branching acid mutase and prebenzoic acid dehydratase bifunctional enzyme), pykA (pyruvate kinase), trpE (o-aminobenzoic acid synthase subunit), tyrR (DNA-binding transcription dual regulator), and poxB (pyruvate dehydrogenase). Meanwhile, the following genes were overexpressed: aroE (shikimate dehydrogenase), tyrB (tyrosine transaminase), galP (glucose transporter), tktA (transketolase), ppsA (phosphoenolpyruvate synthase), and hpaBC (4-hydroxyphenylacetate 3-hydroxylase complex).

2. The genetically engineered bacteria as described in claim 1, characterized in that, The pheA gene, a bifunctional enzyme combining branching acid mutase and prebenzoic acid dehydratase, was knocked out in the genetically engineered bacteria, and the aroE gene, a shikimate dehydrogenase, was knocked into this site. And / or, in the genetically engineered bacteria, the phosphoenolpyruvate-dependent glucose transporter ptsG gene is knocked out, and the glucose transporter galP gene is knocked in at this site. And / or, in the genetically engineered bacteria, the lactate dehydrogenase ldhA gene is knocked out, and the tyrosine transaminase tyrB gene is knocked in at this site; And / or, in the genetically engineered bacteria, the pyruvate kinase pykA gene is knocked out, and the phosphoenolpyruvate synthase ppsA gene is knocked into this site; And / or, in the genetically engineered bacteria, the trpE gene of the anthranilate synthase subunit is knocked out, and the tktA gene of the transketolase is knocked in at this site; And / or, in the genetically engineered bacteria, the pyruvate dehydrogenase poxB gene is knocked out, and the 4-hydroxyphenylacetate 3-hydroxylase complex hpaBC gene is knocked into this site.

3. The genetically engineered bacteria as described in claim 1, characterized in that, The genetically engineered bacteria contains the mutant tyrA. fbr ; mutant tyrA fbr The mutations are: methionine at position 53 of the tyrA gene for branching acid mutase and prephenylalanine dehydrogenase is replaced by isoleucine, and alanine at position 354 is replaced by valine. Encoding mutant tyrA fbr The nucleotide sequence is shown in SEQ ID NO:

2.

4. The genetically engineered bacteria as described in claim 1, characterized in that, The genetically engineered bacteria contain the mutant aroF. fbr ; mutant aroF fbr The mutation is: the cytosine at the 443rd base of the 3-deoxy-d-arabinohepenoyl-7-phosphate synthase aroF gene is changed to guanine; Encoding mutant aroF fbr The nucleotide sequence is shown in SEQ ID NO:

3.

5. The genetically engineered bacteria as described in claim 1, characterized in that, The genetically engineered bacteria also include the knock-in melC2-melC1 or melA gene; The nucleotide sequences of melC2-melC1 are shown in SEQ ID NO:

1.

6. The method for constructing genetically engineered bacteria according to any one of claims 1 to 5, characterized in that, CRISPR-Cas9 gene editing was used to knock out or knock in genes in E. coli. In the knock-in genes, a non-inducible promoter was introduced at the 5' end. The knocked-out genes include: ptsG gene (phosphoenolpyruvate-dependent glucose transporter), ldhA gene (lactate dehydrogenase), pheA gene (a bifunctional enzyme of branched acid mutase and prebenzoic acid dehydratase), pykA gene (pyruvate kinase), trpE gene (an anthranilate synthase subunit), tyrR gene (a DNA-binding transcription dual regulator), and poxB gene (pyruvate dehydrogenase). The knock-in genes include: shikimate dehydrogenase aroE gene, tyrosine transaminase tyrB gene, glucose transporter galP gene, transketolase tktA gene, phosphoenolpyruvate synthase ppsA gene, and 4-hydroxyphenylacetate 3-hydroxylase complex hpaBC gene.

7. The method for constructing genetically engineered bacteria as described in claim 6, characterized in that, The non-inductive promoter includes promoter J23119.

8. The method for constructing genetically engineered bacteria as described in claim 6, characterized in that, Includes the following steps: S1. Knock out the bifunctional enzyme pheA of branching acid mutase and prephenyl acid dehydratase in the E. coli originating strain and knock in the gene expressing shikimate dehydrogenase aroE at that site. S2. Knock out the phosphoenolpyruvate-dependent glucose transporter ptsG gene in the engineered bacteria obtained in step S1, and knock in the glucose transporter galP gene at that site. S3. Knock out the lactate dehydrogenase ldhA gene in the engineered bacteria obtained in step S2, and knock in the tyrB gene expressing tyrosine transaminase at that site. S4. Knock out the tyrR gene, a dual regulator of transcription, from the DNA of the engineered bacteria obtained in step S3. S5. Replace the tyrA genes for branching acid mutase and prephenylalanine dehydrogenase in the engineered bacteria obtained in step S4 with the mutant tyrA. fbr And its overexpression is driven by the J23119 promoter; S6. Replace the 3-deoxy-d-arabinohepenosyl-7-phosphate synthase aroF gene in the engineered bacteria obtained in step S5 with the mutant aroF. fbr And its overexpression is driven by the J23119 promoter; S7. Knock out the pykA gene of pyruvate kinase in the engineered bacteria obtained in step S6, and knock in the ppsA gene expressing phosphoenolpyruvate synthase at that site. S8. Knock out the trpE gene, the subunit of anthranilate synthase, in the engineered bacteria obtained in step S7, and knock in the tktA gene, which expresses transketase, at that site. S9. Knock out the pyruvate dehydrogenase poxB gene in the engineered bacteria obtained in step S8, and knock in the hpaBC gene expressing the 4-hydroxyphenylacetate 3-hydroxylase complex at that site. S10. Knock out the trpR gene in the engineered bacteria obtained in step S9 to obtain genetically engineered bacteria.

9. The application of the genetically engineered bacteria as described in any one of claims 1 to 5 in melanin production.

10. A shake-flask culture method for enhancing melanin production, characterized in that, Includes the following steps: 1) Inoculate a single colony of the genetically engineered bacteria as described in any one of claims 1 to 5 into a culture medium and culture it to obtain a primary seed culture; 2) Inoculate the primary seed culture into the culture medium and culture until OD reaches [value missing]. 600 The concentration was set to 0.6-0.8, and an inducer was added for further culture to obtain the melanin fermentation broth.

Images