Oil palm U6 promoter and application thereof
By cloning the U6 promoter gene from oil palm and linking it to a fluorescent protein gene, a recombinant vector and recombinant bacteria were constructed. The transcriptional activity of the recombinant gene in oil palm was verified, which solved the applicability problem of the CRISPR/Cas9 gene editing system in oil palm and promoted the development of efficient breeding technology for oil palm.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SANYA RES INST OF CHINESE ACAD OF TROPICAL AGRI
- Filing Date
- 2026-04-09
- Publication Date
- 2026-05-05
AI Technical Summary
The lack of a suitable U6 promoter gene for oil palm in existing technologies has limited the development of oil palm CRISPR/Cas9 gene editing systems, resulting in slow progress in efficient oil palm breeding technology.
The oil palm U6 promoter gene (EgU6) was cloned from oil palm and linked with the fluorescent protein gene mNeonGreen to construct a recombinant vector and recombinant bacteria. The feasibility of driving fluorescent protein expression was verified by protoplast transformation.
The transcriptional activity of the endogenous U6 promoter gene in oil palm was verified, laying the foundation for a high-efficiency gene editing technology system in oil palm and filling the gap in the research on the endogenous U6 promoter gene in oil palm.
Smart Images

Figure CN121975810A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to an oil palm U6 promoter and its applications. Background Technology
[0002] Oil palm (scientific name: Elaeis guineensis Jacq. is an important tropical economic palm crop. Currently, the breeding of new oil palm varieties in my country still mainly relies on traditional hybridization breeding, which suffers from low efficiency and long cycles, seriously hindering the process of breeding high-yield and high-quality oil palms. With the development of biotechnology, the application of molecular breeding technologies, represented by gene editing technology, in various crops has accelerated the breeding of new varieties, but related research on oil palms still needs to be carried out.
[0003] Genome editing technology is an important tool for studying gene function. It can precisely modify genes at specific sites on the chromosomes of recipient cells, efficiently generate functionally inactive mutants of specific genes, and provide high-quality genetic material for functional genomics research. The application of gene editing technology highly depends on transcriptional regulatory elements that can precisely control gene expression. Whether it's the expression of small RNAs (such as various sgRNAs edited by CRISPR / Cas), the expression of nucleases like CAS9, or the expression of reporter genes like fluorescent protein genes, all require the driving force of promoter genes. U6 RNA is a non-coding RNA involved in the splicing of precursor mRNA. The U6 promoter gene is a type III RNA polymerase promoter gene, a key element driving the transcription of U6 RNA genes, and has been widely used in CRISPR / Cas9 systems in many species.
[0004] Although CRISPR / Cas9 genome editing technology has been widely applied in many species, gene editing techniques for oil palm have not yet been reported. This is mainly because, while U6 promoter genes have been extensively reported in many species, exogenous U6 promoter genes are often not suitable. Therefore, the lack of suitable U6 promoter genes has become a limiting factor for current CRISPR / Cas9 gene editing systems in oil palm. Thus, screening for functionally active U6 promoter genes in oil palm is of positive significance for the development of gene breeding technology in oil palm. Summary of the Invention
[0005] In view of the shortcomings of the prior art, the present invention provides an oil palm U6 promoter gene and its application.
[0006] The technical solution of this invention mainly includes the following: An oil palm U6 promoter gene, the nucleotide sequence of which is shown in SEQ ID NO.1. The oil palm U6 promoter gene (EgU6) belongs to the type III RNA polymerase promoter gene of the oil palm U6 snRNA gene and is derived from oil palm (…). Elaeis guineensis Jacq.) Furthermore, the present invention provides biological materials containing the oil palm U6 promoter gene, wherein the biological materials include recombinant vectors, expression cassettes, or recombinant bacteria. The recombinant vector is obtained by ligating the oil palm U6 promoter gene with the mNeonGreen gene and a plant expression vector.
[0007] Furthermore, the plant expression vector is preferably the pUN1301 vector.
[0008] Furthermore, the recombinant bacteria is preferably *Escherichia coli* containing the oil palm U6 promoter gene.
[0009] Furthermore, this invention relates to the application of the oil palm U6 promoter gene or the aforementioned biological material in driving fluorescent protein genes in plant protoplast transformation. The plant includes monocotyledonous or dicotyledonous plants; specifically, in embodiments of this invention, the plant is an oil palm. The fluorescent protein gene is preferably the mNeonGreen gene.
[0010] Furthermore, the present invention provides a method for cloning the oil palm U6 promoter gene, comprising the following steps: (1) Using oil palm genomic DNA as a template, specific primers EgU6-F and EgU6-R were designed; the nucleotide sequence of EgU6-F is shown in SEQ ID NO.2, and the nucleotide sequence of EgU6-R is shown in SEQ ID NO.3; (2) PCR amplification was performed using KOD enzyme; (3) The amplification product is recovered to obtain the EgU6 fragment containing the 300bp oil palm U6 promoter gene, which can be used for seamless cloning. The nucleotide sequence of the oil palm U6 promoter gene is shown in SEQ ID NO.1.
[0011] Specifically, in the embodiments of the present invention, the PCR amplification reaction program of step (2) is as follows: 95℃ pre-denaturation for 6 min, 95℃ denaturation for 15 s, 57℃ annealing for 15 s, 72℃ extension for 5 s, 35 cycles, and 72℃ final extension for 7 min.
[0012] Furthermore, the present invention provides a method for constructing a transient transformation vector for oil palm protoplasts, comprising the following steps: (a) Preparation of an EgU6 fragment containing a 300 bp oil palm U6 promoter gene for seamless cloning; the nucleotide sequence of the oil palm U6 promoter gene is shown in SEQ ID NO.1; (b) Design specific primers EgU6-Neon F and EgU6-Neon R; use a plasmid containing the mNeonGreen gene as a template and perform PCR amplification with KOD enzyme to obtain the mNeonGreen fragment; The nucleotide sequence of EgU6-Neon F is shown in SEQ ID NO.4, and the nucleotide sequence of EgU6-Neon R is shown in SEQ ID NO.5; (c) The pUN1301 vector was digested with HindIII and BamHI, and the vector backbone fragment was recovered. (d) The EgU6 fragment, the mNeonGreen fragment, and the vector backbone fragment were ligated using a seamless cloning method to obtain the expression vector pEgU6-mNeonGreen containing the oil palm EgU6 promoter gene driving fluorescent protein.
[0013] Specifically, in the embodiments of the present invention, the PCR program is as follows: 95°C pre-denaturation for 6 min, 95°C denaturation for 15 s, 57°C annealing for 15 s, 72°C extension for 10 s, 35 cycles, and 72°C final extension for 7 min.
[0014] The beneficial effects of this invention are: This invention marks the first time that an oil palm RNA polymerase type III promoter gene, specifically the endogenous U6 promoter gene EgU6, has been cloned from oil palm. For the first time, the cloned endogenous RNA polymerase type III promoter gene was ligated with the mNeonGreen fluorescent protein gene. Transient transformation of oil palm leaf protoplasts verified the feasibility of this promoter gene driving fluorescent protein expression, laying a crucial foundation for the subsequent construction of an efficient gene editing technology system for oil palm. The discovery and application of this promoter gene fills a gap in the research field of endogenous U6 promoter genes in oil palm. Attached Figure Description
[0015] Figure 1 : Simplified structure of pEgU6-mNeonGreen expression vector.
[0016] Figure 2 : Fluorescence detection of unconverted oil palm protoplasts (control group).
[0017] Figure 3 Transformation group (treatment group) of oil palm protoplast EgU6-mNeon expression vector. Detailed Implementation
[0018] To facilitate a clearer understanding of the technical content of this invention by those skilled in the art, the invention will be further described below in conjunction with specific embodiments and accompanying drawings.
[0019] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0020] The vector pUN1301 used in the following examples was kindly provided by Professor Li Wenqiang's research group at Northwest A&F University, and the pmNeonGreen vector was purchased from the Miaoling plasmid platform. The above biological materials are only used to repeat the relevant experiments of this invention and should not be used for other purposes.
[0021] Example 1: Obtaining and analyzing the transcriptional activity of the oil palm U6 gene promoter gene EgU6. Using the DNA sequences of the Arabidopsis thaliana AtU6-26 gene (Genebank accession number: X52528.1) and the cotton GhU6-9 gene (Genebank accession number: XR_001680717.1) as references, the oil palm genome database (https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCF_000442705.2 / ) was searched. One candidate oil palm EgU6 gene was found through homology comparison analysis, and the upstream reference sequence of this gene was obtained, thus obtaining the promoter gene of the oil palm U6 gene (SEQ ID NO.1).
[0022] To verify the transcriptional activity of the U6 gene promoter, the promoter was ligated to the fluorescent protein gene mNeonGreen and the plant expression vector pUN1301, followed by protoplast transformation. The specific steps are as follows: (1) Using genomic DNA from leaves of oil palm seedlings (preserved by the Coconut Research Institute of the Chinese Academy of Tropical Agricultural Sciences) as a template, and EgU6 F and EgU6 R as EgU6-specific primers, PCR amplification was performed using KOD enzyme (TOYOBO) in a 20 μL reaction system. The target band was obtained by agarose electrophoresis and recovered for later use. Thus, a DNA fragment (EgU6 fragment) containing the promoter gene (300 bp) that can be used for seamless cloning was obtained.
[0023] EgU6 F (SEQ ID NO.2): GTAAAACGACGGCCAGTGCCAAGCT GTTCCAGCAGGCTGGAATTAAGC; EgU6 R (SEQ ID NO.3): cttgctcaccatc GACACCAAACAACAAGACTT; The specific reaction program for PCR amplification was as follows: 95℃ pre-denaturation for 6 min, 95℃ denaturation for 15 s, 57℃ annealing for 15 s, 72℃ extension for 5 s, 35 cycles, and a final extension at 72℃ for 7 min. The target band was obtained by agarose gel electrophoresis and recovered for later use.
[0024] (2) Using a plasmid containing the mNeonGreen gene as a template, specific primers (EgU6-Neon F and EgU6-Neon R) were designed to construct the EgU6-Neon expression cassette. PCR amplification was performed using KOD enzyme (TOYOBO) in a 20 μL reaction system. The target band was obtained by agarose gel electrophoresis and recovered for later use. This yielded the fluorescent protein gene fragment.
[0025] EgU6-Neon F (SEQ ID NO.4): GTTTGGTGTC gatggtgagcaagggcgagga; EgU6-Neon R (SEQ ID NO.5): AATTCGAGCTCGGTACCCGGGGATC ttacttgtacagctcgtccatgcc; The specific reaction program for PCR amplification was as follows: 95℃ pre-denaturation for 6 min, 95℃ denaturation for 15 s, 57℃ annealing for 15 s, 72℃ extension for 10 s, 35 cycles, and a final extension at 72℃ for 7 min. The target band was obtained by agarose gel electrophoresis and recovered for later use.
[0026] (3) The pUN1301 vector was digested with HindIII and BamHI, and the 12088bp vector backbone fragment was recovered. The target band was obtained by agarose gel electrophoresis and then recovered for later use.
[0027] (4) The prepared EgU6 fragment, mNeonGreen fluorescent protein gene fragment, and pUN1301 vector backbone fragment were ligated using a seamless cloning method to obtain the expression vector pEgU6-mNeonGreen containing the oil palm EgU6 promoter gene driving fluorescent protein. The vector expression structure is shown in [reference needed]. Figure 1 .
[0028] (5) The above expression vector pEgU6-mNeonGreen was transformed into Escherichia coli DH5α and propagated to obtain a high concentration of plasmid for oil palm protoplast transformation.
[0029] (6) Fluorescence detection was performed using a Nikon confocal microscope AX, and the results are as follows: Figure 2 and Figure 3 As shown. Among them, Figure 2 Untransformed protoplasts were used as a control group; Figure 3The sample transformed with pEgU6-mNeonGreen was used as the treatment group. Fluorescence was detected in the treatment group, indicating that EgU6 has transcriptional activity.
[0030] In summary, the endogenous U6 promoter gene of oil palm obtained by this invention has good transcriptional activity, which can provide support for the subsequent establishment of an oil palm gene editing technology system.
[0031] The above description is only a part of the embodiments of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention shall fall within the protection scope of the present invention.
Claims
1. A U6 promoter gene for oil palm, characterized in that, The nucleotide sequence of the oil palm U6 promoter gene is shown in SEQ ID NO.
1.
2. A biomaterial containing the oil palm U6 promoter gene as described in claim 1, characterized in that, The biomaterials include recombinant vectors, expression cassettes, or recombinant bacteria.
3. The biomaterial according to claim 2, characterized in that, The recombinant vector is obtained by linking the oil palm U6 promoter gene of claim 1 with the mNeonGreen gene and a plant expression vector.
4. The biomaterial according to claim 3, characterized in that, The plant expression vector is pUN1301.
5. The biomaterial according to claim 2, characterized in that, The recombinant bacteria is Escherichia coli containing the oil palm U6 promoter gene.
6. The application of the oil palm U6 promoter gene according to claim 1 or the biomaterial according to any one of claims 2 to 5, characterized in that, The application is to drive the transformation of the mNeonGreen gene in oil palm protoplasts.
7. A method for cloning the U6 promoter gene of oil palm, characterized in that, Includes the following steps: (1) Using oil palm genomic DNA as a template, specific primers EgU6-F and EgU6-R were designed; the nucleotide sequence of EgU6-F is shown in SEQ ID NO.2, and the nucleotide sequence of EgU6-R is shown in SEQ ID NO.3; (2) PCR amplification was performed using KOD enzyme; (3) The amplification product is recovered to obtain the EgU6 fragment containing the 300bp oil palm U6 promoter gene, which can be used for seamless cloning. The nucleotide sequence of the oil palm U6 promoter gene is shown in SEQ ID NO.
1.
8. A method for constructing a transient transformation vector for oil palm protoplasts, characterized in that, Includes the following steps: (a) Preparation of an EgU6 fragment containing a 300 bp oil palm U6 promoter gene for seamless cloning; the nucleotide sequence of the oil palm U6 promoter gene is shown in SEQ ID NO.1; (b) Design specific primers EgU6-Neon F and EgU6-Neon R; use a plasmid containing the mNeonGreen gene as a template and perform PCR amplification with KOD enzyme to obtain the mNeonGreen fragment; The nucleotide sequence of EgU6-Neon F is shown in SEQ ID NO.4, and the nucleotide sequence of EgU6-Neon R is shown in SEQ ID NO.5; (c) The pUN1301 vector was digested with enzymes, and the vector backbone fragment was recovered; (d) The EgU6 fragment, the mNeonGreen fragment, and the vector backbone fragment were ligated using a seamless cloning method to obtain the expression vector pEgU6-mNeonGreen containing the oil palm EgU6 promoter gene driving fluorescent protein.
9. The method according to claim 8, characterized in that, The enzyme digestion was performed using HindIII and BamHI double digestion.
Citation Information
Patent Citations
Rubber tree U6 gene promoter proHbU6.6 and cloning and application of rubber tree U6 gene promoter proHbU6.6
CN110144353A
Rubber tree U6 gene promoter proHbU6.2, and cloning and application of gene promoter proHbU6.2
CN110184268A
Areca-nut U6 promoter and application thereof
CN117866966A
Coconut U6 promoter and application thereof
CN119020364A
Cited By
Oil palm ubq promoter and use thereof
CN122146705A
A Palm Oil UBQ Promoter and Its Application
CN122146705B