Gene gmerf416 for plant yield increase and / or salt tolerance / saline-alkali tolerance and use thereof

Abstract

The present invention relates to a soybean transcription factor GmERF416 and a coding gene thereof, and a use thereof in regulating a plant yield and / or salt tolerance / alkali tolerance, and further relates to a method for cultivating plants having an increased yield and / or salt tolerance / saline-alkali tolerance, and prepared plants, such as soybeans, having an increased yield and / or salt tolerance / saline-alkali tolerance.

Description

Plant yield increase and / or salt / alkali tolerance gene GmERF416 and its uses

[0001] Priority information

[0002] This application claims priority to Chinese Patent Application No. 2024105755389, filed May 10, 2024, and Chinese Patent Application No. 2024114370313, filed October 15, 2024, the entire contents of which are incorporated herein by reference. Technical Field

[0003] This invention belongs to the field of biotechnology. Specifically, it relates to the plant yield and salt / salt-alkali tolerance-related gene GmERF416 and its use in cultivating yield-increasing and / or salt-tolerant / salt-alkali-tolerant plants. This invention also relates to methods for cultivating yield-increasing and / or salt-tolerant / salt-alkali-tolerant plants, the resulting yield-increasing and / or salt-tolerant / salt-alkali-tolerant plants, and plant materials thereof. Background Technology

[0004] Changes in physical or chemical factors in the environment, such as drought, salinity, cold damage, frost damage, and waterlogging, are among the causes of severe crop yield reductions. Statistics from insurance payouts in the United States between 1939 and 1978 show that approximately 40.8% of payouts were due to salinity and drought, higher than waterlogging (16.4%), low temperatures (13.8%), hail (11.3%), and wind (7.0%), and far higher than insect infestations (4.5%), diseases (2.7%), and other factors. Drought, rising groundwater levels, and low-lying areas without drainage are all contributing factors to soil salinization. Meanwhile, the excessive application of chemical fertilizers may cause approximately 50% of fertile land to become saline-alkali land in the near future, seriously threatening food production (A. Kumar, S. Singh, AK Gaurav, S. Srivastava, JP Verma, Plant growth-promoting bacteria: Biological tools for the mitigation of salinity stress in plants. Front. Microbiol. 11, 1216 (2020). doi:10.3389 / fmicb.2020.01216). Soil salinization and secondary salinization are global ecological and resource problems and are among the important abiotic stress factors causing crop yield reduction (Yamaguchi, T. and Blumwald, E. Developing salt-tolerant crop plants: challenges and opportunities. (2005). Trends in Plant Science 10:615-620). Utilizing low- to moderately saline land (including saline and alkaline soils) to produce crops such as soybeans, corn, and rice, and cultivating crops with increased yields and / or salt / alkali tolerance has become one of the main goals of the agricultural industry. In addition to traditional breeding methods, molecular genetic breeding has become a focus of scientific and technological research in increasing crop yields and / or improving crop salt / alkali tolerance.

[0005] Soybeans, as an important economic crop, are a significant source of edible oils and plant protein, holding a vital position in my country's food industry. Soybean oil also has many uses in industrial production, such as as a biofuel, surfactant, or softener. In recent years, my country's soybean production has only accounted for one-fifth of its demand, making China the world's largest soybean importer. Domestic soybean production falls far short of meeting national needs. Salt-tolerant / salt-alkali-tolerant soybeans can maximize the utilization of saline-alkali and / or saline-alkali soils, representing one strategy for increasing my country's soybean yield.

[0006] Furthermore, seed weight and shape are among the main traits that were domesticated during the evolution of wild soybeans into cultivated soybeans. However, for describing seed traits related to yield, seed weight, 100-seed weight, or 1000-seed weight are the most appropriate parameters. Most wild soybeans have a 100-seed weight of only about 2 grams, while cultivated soybeans typically have a 100-seed weight of 15-22 grams, with some reaching up to 25 grams, a significant difference. Generally, plants can increase yield by increasing seed weight, or by increasing the number of pods per plant (e.g., for legumes) or the yield per plant.

[0007] In recent years, several genes associated with increased yield have been identified in crops such as rice, sorghum, and wheat (e.g., genes that increase grain weight, genes that increase the number of tillers in rice, genes that resist lodging, or genes that tolerate salt and alkali). However, research on yield-related mechanisms in soybeans is relatively lagging. There is an urgent need in this field to identify genes that can increase the yield of legume crops and to find methods to produce legume plants that can increase yield and / or tolerate salt and alkali. Summary of the Invention

[0008] The technical problem this application aims to solve is how to improve the agronomic traits of plants, especially soybeans.

[0009] The purpose of this application is to study the mechanisms of increased plant yield and salt / salt-alkali tolerance at the genetic level, to develop methods for cultivating plants with increased yield and / or salt / salt-alkali tolerance, and to cultivate plants with higher yield and / or higher salt / salt-alkali tolerance.

[0010] To achieve the above objectives, the inventors identified and isolated the GmERF416 gene from soybeans and experimentally verified the correlation between this gene and soybean yield, salt tolerance, and salt-alkali tolerance. Based on this, the inventors completed this invention.

[0011] In a first aspect, the present invention provides an isolated nucleic acid molecule that encodes the following protein:

[0012] (i) A protein containing the amino acid sequence shown in SEQ ID NO:2 or a protein composed of the amino acid sequence shown in SEQ ID NO:2; or

[0013] (ii) A protein comprising an amino acid sequence of SEQ ID NO:2 obtained by substitution and / or deletion and / or addition of amino acid residues, having more than 80% sequence identity with SEQ ID NO:2 and having the same or similar function or activity as SEQ ID NO:2; or

[0014] (iii) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of the protein in (i) or (ii).

[0015] In some embodiments, the isolated nucleic acid molecule is named the GmERF416 gene, and the protein it encodes is named the GmERF416 protein.

[0016] In some embodiments, the isolated nucleic acid molecule encodes the protein shown in SEQ ID NO:2.

[0017] In some embodiments, the isolated nucleic acid molecule comprises the coding nucleotide sequence shown in SEQ ID NO:1 or the genomic DNA sequence shown in SEQ ID NO:3.

[0018] In some implementations, the protein tag refers to a peptide, polypeptide, or protein fused with a target protein using in vitro recombinant DNA technology for expression, detection, tracing, and / or purification of the target protein. The protein tag may be selected from, but is not limited to, Flag tags, His tags, MBP tags, HA tags, myc tags, GST tags, and / or SUMO tags. Those skilled in the art can select appropriate protein tags according to actual needs.

[0019] In some implementations, the isolated nucleic acid molecules are derived from soybean (Glycine max (L.) Merr.).

[0020] In some embodiments, the isolated nucleic acid molecules can be constructed into expression cassettes or recombinant vectors. Preferably, in the expression cassette or recombinant vector, a promoter, enhancer, or selective marker sequence can be operatively linked to the isolated nucleic acid molecules.

[0021] In some embodiments, the isolated nucleic acid molecules can be transformed or transfected into host cells either as is or in the form of an expression cassette or recombinant vector to obtain recombinant host cells. In some embodiments, the host cells can be selected from, but are not limited to, microbial cells or plant cells, wherein the microbial cells include bacterial cells or fungal cells, such as Escherichia coli cells, yeast cells, or Agrobacterium cells; the plant cells can be dicotyledonous plant cells, such as Rosales plant cells, preferably leguminous plant cells, more preferably soybean plant cells, and most preferably soybean plant cells.

[0022] In some embodiments, the isolated nucleic acid molecules can be transformed or transfected into plant cells or tissues either as is or in the form of expression cassettes or recombinant vectors to obtain transgenic plant cells or tissues, which can then be further cultivated to obtain transgenic plants or plant materials thereof. The transgenic plants or plant materials thereof can be used for breeding purposes.

[0023] In a second aspect, the present invention provides a protein encoded by a nucleic acid molecule of the first aspect.

[0024] In some implementations, the protein:

[0025] (i) Contains or is composed of the amino acid sequence shown in SEQ ID NO:2; or

[0026] (ii) Contains an amino acid sequence that is more than 80% sequence identical to SEQ ID NO:2, obtained by substitution and / or deletion and / or addition of amino acid residues, and has the same or similar function or activity as SEQ ID NO:2; or

[0027] (iii) is a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of the protein in (i) or (ii).

[0028] In some embodiments, the protein consists of the amino acid sequence shown in SEQ ID NO:2 and is named GmERF416 protein or protein GmERF416, and the corresponding encoding gene is named GmERF416 gene.

[0029] In some embodiments, the “amino acid sequence having more than 80% sequence identity with SEQ ID NO:2” described in (ii) includes an amino acid sequence having 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 95%, 96%, 98%, 99%, 99.5%, or 99.99% sequence identity with SEQ ID NO:2.

[0030] However, those skilled in the art should understand that when “amino acid sequence having more than 80% sequence identity with SEQ ID NO:2” is used alone, the statement covers amino acid sequences having 100% sequence identity with SEQ ID NO:2.

[0031] In some embodiments, the substitution of the amino acid residues includes conservative substitution.

[0032] In some embodiments, the present invention provides the use of the isolated nucleic acid molecules of the first aspect or the proteins of the second aspect in regulating the salt tolerance or salt-alkali tolerance of plants, wherein the plants are salt-sensitive or salt-alkali-sensitive when the expression level of the nucleic acid molecules in the plants increases or the content or activity of the proteins increases; or the salt tolerance or salt-alkali tolerance of the plants is improved when the expression level of the nucleic acid molecules in the plants decreases or the content or activity of the proteins decreases.

[0033] In some embodiments, the present invention provides the use of the isolated nucleic acid molecule described in the first aspect or the protein described in the second aspect in regulating plant yield, wherein plant yield increases when the expression level of the nucleic acid molecule in the plant decreases or the content or activity of the protein decreases.

[0034] For example, in soybeans, when the protein content of GmERF416 is reduced and the expression level of its encoding gene is lowered, the yield of soybeans increases (the number of pods per plant and the yield per plant increase) and the salt tolerance or salt-alkali tolerance is improved compared to the wild-type control.

[0035] In a third aspect, the present invention provides an expression cassette or recombinant vector comprising the isolated nucleic acid molecules described in the first aspect.

[0036] In a fourth aspect, the present invention provides a recombinant host cell comprising the isolated nucleic acid molecules described in the first aspect, or comprising the expression cassette or recombinant vector described in the third aspect.

[0037] In some embodiments, the host cell may be selected from, but is not limited to, microbial cells or plant cells, wherein the microbial cells include bacterial cells or fungal cells, such as Escherichia coli cells, yeast cells or Agrobacterium cells; the plant cells may be dicotyledonous plant cells, such as Rosales plant cells, preferably leguminous plant cells, more preferably soybean plant cells, and most preferably soybean plant cells.

[0038] In a fifth aspect, the present invention provides transgenic plant cells or tissues comprising the isolated nucleic acid molecules described in the first aspect, or comprising the expression cassette or recombinant vector described in the third aspect.

[0039] In some implementations, plant cells or tissues include, but are not limited to, cells or tissues derived from seeds, suspension cultures, embryos, meristematic regions, callus, leaves, roots, seedlings, gametophytes, sporophytes, pollen, and microspores.

[0040] In a sixth aspect, the present invention provides a transgenic plant or plant material thereof, which comprises the isolated nucleic acid molecules described in the first aspect, or the expression cassette or recombinant vector described in the third aspect, or which can be grown from transgenic plant cells or tissues described in the fifth aspect.

[0041] In some embodiments, the transgenic plant may be a dicotyledonous plant, such as a plant of the order Rosales, preferably a legume, more preferably a plant of the genus *Glycine*, and most preferably a soybean plant. In some embodiments, the plant material may be, for example, a plant part, plant organ, plant tissue, seed, plant protoplast, or plant cell, such as an embryo, pollen, ovule, seed, leaf, flower, branch, fruit, stem, root, root tip, anther, plant cell culture, or plant callus.

[0042] In a seventh aspect, the present invention provides a method for cultivating plants with increased yield and / or salt tolerance / salt-alkali tolerance, the method comprising: inhibiting the expression or activity of a nucleic acid molecule in the plant encoding a protein comprising an amino acid sequence having more than 80% sequence identity with SEQ ID NO:2, wherein the plant comprises a nucleic acid molecule encoding a protein comprising an amino acid sequence having more than 80% sequence identity with SEQ ID NO:2.

[0043] In some implementations, the term "inhibition" includes reducing (i.e., downregulating) the expression or activity of the nucleic acid molecule or eliminating the nucleic acid molecule (i.e., rendering it unexpressed or inactive).

[0044] In some implementations, the "suppression" step can be achieved through gene editing (e.g., gene knockout or knockdown) or gene silencing.

[0045] In some embodiments, reducing the expression level of the GmERF416 gene or its homologs in plants (e.g., through gene editing, gene silencing, targeted mutagenesis, chemical induction, radiation induction, natural mutation, RNAi, or the addition of a substance that inhibits the expression of the target gene) or preventing the expression of the GmERF416 gene or its homologs can improve plant yield and / or salt tolerance / salt-alkali tolerance, wherein the GmERF416 gene is as shown in SEQ ID NO:1 or 3.

[0046] The salt-tolerant / salt-alkali-tolerant plants of the present invention grow better than wild-type control plants under saline and saline-alkali conditions. The saline conditions include growth conditions with a total salt content greater than or equal to 5‰, for example, soil containing 0.5% sodium salt (e.g., NaCl); the saline-alkali conditions include growth conditions with pH ≥ 8.5 and a total salt content of 4-5‰.

[0047] In some implementations, increasing the expression level of the GmERF416 gene or its homologs in plants (e.g., overexpression) can enhance the salt sensitivity or salinity sensitivity of plants.

[0048] In some implementations, the expression level of the GmERF416 gene or its homologs in plants is reduced or the GmERF416 gene or its homologs are not expressed by gene editing methods, gene silencing methods, targeted mutagenesis, chemical induction, radiation induction, natural mutation, RNAi, or the addition of substances that inhibit the expression of the target gene.

[0049] In some implementations, the GmERF416 gene or its homolog in the plant is mutated, for example, by knocking out the GmERF416 gene or its homolog by homologous recombination, or by editing the GmERF416 gene or its homolog by CRISPR technology, thereby reducing the expression level of the gene or reducing or eliminating the activity of the encoded protein.

[0050] In some implementations, the GmERF416 gene or a portion of its homolog is mutated, thereby reducing the expression level of the gene or reducing or eliminating the activity of the encoded protein.

[0051] In some embodiments, the expression level of the GmERF416 gene or its homologs is reduced by at least 60% compared to wild-type control plants, preferably by 65%, 70%, or 80%, more preferably by 85%, 90%, or 95%, or even not expressed.

[0052] In some embodiments, the plant is a dicotyledonous plant, such as a plant of the order Rosales, preferably a legume, more preferably a plant of the genus Soybean, and most preferably a soybean plant.

[0053] In some embodiments, the plants with increased yield and / or salt tolerance / salt-alkali tolerance obtained by the method of the present invention are homozygous mutants of the GmERF416 gene.

[0054] In some embodiments, the increased yield and / or salt-tolerant / salt-alkali-tolerant plants cultivated by the method of the present invention, compared with the corresponding wild-type control, have increased number of pods per plant or increased yield per plant under normal growth conditions; and increased survival rate, increased number of pods per plant or increased yield per plant under saline or saline-alkali growth conditions, wherein the saline conditions include growth conditions with a total salt content greater than or equal to 5‰, for example, soil containing 0.5% sodium salt (e.g., NaCl); and the saline-alkali conditions include growth conditions with pH ≥ 8.5 and a total salt content of 4-5‰.

[0055] In some embodiments, the increased yield and / or salt-tolerant / salt-alkali-tolerant plants (e.g., soybeans) bred by the methods of the present invention can grow under conditions with a total salt content greater than or equal to 5‰, or under alkaline conditions with a pH of 8.5 to 9.5 or even greater than 9.5, or under conditions with a pH of 8.5 to 9.5 or even greater than 9.5 and a total salt content of 4-5‰, and have a high survival rate and increased yield compared to wild-type controls.

[0056] In some embodiments, the breeding method can be accomplished through self-pollination or hybridization, including: identifying parental plants containing mutations or nonfunctional alleles in the GmERF416 gene or its homologs; performing self-pollination or hybridization with another parental plant containing mutations or nonfunctional alleles in the GmERF416 gene or its homologs to obtain one or more generations of offspring plants, wherein the mutation reduces or eliminates the expression of the GmERF416 gene or its homologs, or reduces the content, activity, or activity of the protein encoded by the GmERF416 gene or its homologs. Alternatively or additionally, the one or more generations of offspring plants obtained through self-pollination or hybridization are further identified or screened to obtain homozygous mutant plants of the GmERF416 gene or its homologs, which possess traits of increased yield and / or improved salt tolerance / salt-alkali tolerance.

[0057] In some embodiments, the method for cultivating plants with increased yield and / or salt tolerance / salt-alkali tolerance may include the following steps:

[0058] (1) Construct a recombinant vector that suppresses the GmERF416 gene or its homologous gene; and

[0059] (2) Introduce the recombinant expression vector constructed in step (1) into the recipient plant to obtain plants with increased yield and / or salt tolerance / salt-alkali tolerance.

[0060] In other embodiments, the method for cultivating plants with increased yield and / or salt tolerance / salt-alkali tolerance may include the following steps:

[0061] (1) Construct a recombinant vector that inhibits the GmERF416 gene or its homolog;

[0062] (2) Introduce the recombinant expression vector constructed in step (1) into plant cells or tissues to obtain plant cells or tissues in which the expression of the GmERF416 gene or its homologous gene is suppressed; and

[0063] (3) Plant cells or tissues in which the expression of the GmERF416 gene or its homolog obtained in step (2) is suppressed grow into plants with increased yield and / or salt tolerance / salt-alkali tolerance.

[0064] In some embodiments, suppressing the expression of the GmERF416 gene or its homolog may include introducing a dual-target gene knockout vector containing the sequences 5'-TCTCGCAGCTCGCAGTACCG-3' and 5'-ACTCCCATCTACCAGTCCTG-3' into the target plant.

[0065] In a preferred embodiment, the gene knockout vector is pCBSG015-sgRNA, that is, a recombinant plasmid obtained by inserting a DNA fragment with the sequence SEQ ID NO:4 between the restriction endonuclease Bsa I restriction sites of the pCBSG015 vector while keeping other sequences of the pCBSG015 vector unchanged.

[0066] In one specific embodiment, the present invention provides a method for cultivating soybean plants with increased yield and / or improved salt / alkali tolerance, the method comprising performing a single-vector dual-target double knockout of the genome of a target soybean plant (e.g., Dongnong 50 (DN50)) to knock out the GmERF416 gene, thereby obtaining a GmERF416 gene homozygous mutant soybean plant.

[0067] In a more specific implementation, the soybean plant with increased yield and / or improved salt / alkali tolerance may be a soybean plant that has undergone the following mutations:

[0068] 1) Compared with control soybean plants, the GmERF416 gene in the genome of the soybean plants with increased yield and / or improved salt / alkali tolerance has the following mutation: a deletion of one nucleotide at position 513 of SEQ ID NO:1 (corresponding to position 513 of SEQ ID NO:3) on both chromosomes, i.e., deletion of nucleotide "G", leading to premature termination of GmERF416 translation, thereby knocking out the GmERF416 gene; or

[0069] 2) Compared with the control soybean plants, the GmERF416 gene in the genome of the soybean plants with increased yield and / or improved salt / alkali tolerance has the following mutation: a 24-nucleotide deletion exists in positions 489-512 of SEQ ID NO:1 (corresponding to positions 489-512 of SEQ ID NO:3) on both chromosomes, namely the deletion of nucleotide 5'-CCGGGGTGTCACCTTCTACCGCAG-3', which causes premature termination of GmERF416 translation, thereby knocking out the GmERF416 gene.

[0070] In an eighth aspect, the present invention provides cultivated plants or plant materials thereof that have increased yield and / or salt tolerance / salt-alkali tolerance.

[0071] In some embodiments, the plant with increased yield and / or salt tolerance / salt-alkali tolerance may be a dicotyledonous plant, such as a plant of the order Rosales, preferably a legume, more preferably a plant of the genus *Glycine*, and most preferably a soybean plant. In some embodiments, the plant material may be a plant part, plant organ, plant tissue, seed, plant protoplast, or plant cell, such as an embryo, pollen, ovule, seed, leaf, flower, branch, fruit, stem, root, root tip, anther, plant cell culture, or plant callus, etc.

[0072] In a ninth aspect, the present invention provides a molecule for regulating the expression or activity of the GmERF416 gene or its homologs in plants, wherein the regulation comprises increasing or inhibiting, preferably inhibiting.

[0073] In some embodiments, the molecule regulating the expression or activity of the GmERF416 gene or its homologs can be a molecule that performs at least one of the following six types of regulation:

[0074] 1) Regulation occurring at the transcriptional level of the aforementioned gene;

[0075] 2) Regulation that occurs after the gene is transcribed (i.e., regulation of the splicing or processing of the primary transcript of the gene);

[0076] 3) Regulation of RNA transport of the gene (that is, regulation of the transport of mRNA of the gene from the nucleus to the cytoplasm);

[0077] 4) Regulation of the translation of the aforementioned genes;

[0078] 5) Regulation of mRNA degradation of the aforementioned gene; or

[0079] 6) Post-translational regulation of the gene (i.e., regulation of the activity of the protein translated from the gene).

[0080] In some embodiments, molecules that increase the expression or activity of the GmERF416 gene or its homologs in plants include expression cassettes or recombinant vectors containing the nucleotide sequence of the GmERF416 gene or its homologs. When said expression cassette or recombinant vector is transformed or transfected into plants, the GmERF416 protein or its homologs can be overexpressed. Increasing the expression or activity of the GmERF416 gene or its homologs in plants can increase the plant's salt sensitivity or salt-alkali sensitivity.

[0081] In some embodiments, molecules that inhibit the expression or activity of the GmERF416 gene or its homologs in plants include nucleotide molecules that inhibit the expression or activity of the GmERF416 gene or its homologs, expression cassettes containing such nucleotide molecules, or recombinant vectors.

[0082] Those skilled in the art can readily mutate the nucleotide sequence of the present invention that inhibits the expression of the GmERF416 gene or its homologs using known methods, such as directed evolution or point mutation. Nucleotide sequences that have been mutated (including modified) and possess more than 80% sequence identity with the nucleotide molecule obtained in this invention that inhibits the expression or activity of the GmERF416 gene or its homologs, and which also have the function of inhibiting the expression or activity of the GmERF416 gene or its homologs, are also within the scope of this invention.

[0083] In some implementations, molecules that inhibit the expression or activity of the GmERF416 gene or its homologs in plants include RNAi molecules, gRNA molecules for gene editing, molecules that enable homologous recombination, and molecules that enable GmERF416 knockout or knockdown.

[0084] In one specific embodiment, the molecule that inhibits the expression or activity of the GmERF416 gene or its homolog in plants is a dual-target knockout vector comprising DNA fragments with sequences 5'-TCTCGCAGCTCGCAGTACCG-3' (sgRNA1) and 5'-ACTCCCATCTACCAGTCCTG-3' (sgRNA2). The target sequence of sgRNA1 is the DNA fragment at positions 472-494 of SEQ ID NO:1 or SEQ ID NO:3, and the target sequence of sgRNA2 is the DNA fragment at positions 507-529 of SEQ ID NO:1 or SEQ ID NO:3.

[0085] In a preferred embodiment, the backbone vector of the dual-target knockout vector may be selected from, but is not limited to: pCBSG015 vector, pYLCRISPR / Cas9-gRNA, pHee401E and pKSE401.

[0086] In some preferred embodiments, molecules that inhibit the expression or activity of the GmERF416 gene or its homologs in plants, compared to wild-type control plants, can reduce the expression level of the GmERF416 gene or its homologs by at least 60%, preferably by 65%, 70%, or 80%, more preferably by 85%, 90%, or 95%, or even to no expression.

[0087] In a tenth aspect, the present invention provides a method for preparing hybrid planting seeds, the method comprising:

[0088] (i) Crossing a first parent plant with a second parent plant, wherein each of the first and second parent plants contains a mutation in a gene encoding a protein comprising an amino acid sequence having more than 80% sequence identity with SEQ ID NO:2; and

[0089] (ii) Harvesting seeds of hybrid plants or their offspring;

[0090] The mutation reduces or stops the expression of the gene, or reduces the content, activity, or inactivation of the protein encoded by the gene.

[0091] Optionally or otherwise, the hybrid plant or its offspring may be further identified or screened to obtain a homozygous mutant plant for the gene, which has the trait of increased yield and / or improved salt tolerance / salt-alkali tolerance.

[0092] In some implementations, the first parental plant and / or the second parental plant contains a nonfunctional allele of the GmERF416 gene.

[0093] In some implementations, the first parent plant and / or the second parent plant are inbred lines.

[0094] In some embodiments, the present invention also provides a method for preparing conventionally grown seeds, the method comprising:

[0095] Propagation of parental seeds to harvest their offspring seeds, wherein in the parental seeds, all alleles encoding a protein containing an amino acid sequence having more than 80% sequence identity with SEQ ID NO:2 are mutated such that the protein is not expressed or has a reduced expression level or activity compared to the wild-type plant, or even has no activity.

[0096] In the eleventh aspect, the present invention provides a plant or plant material thereof grown from the seeds of the tenth aspect.

[0097] In a twelfth aspect, the present invention provides a method for cultivating salt-sensitive / salt-alkali-sensitive plants, the method comprising:

[0098] Increase the expression level of genes in plants that encode proteins containing amino acid sequences with more than 80% sequence identity to SEQ ID NO:2.

[0099] In some implementations, the expression level of the target gene is increased by introducing a foreign nucleic acid molecule encoding a protein containing an amino acid sequence that has more than 80% sequence identity with SEQ ID NO:2 into the plant.

[0100] In some embodiments, genetic material carrying the nucleic acid molecule is introduced into the cells or tissues of the plant. The genetic material exists in the plant in a free form or integrated into the plant's chromosomes. The cells or tissues with the introduced genetic material are then cultured into complete plants to obtain the salt-sensitive / salt-alkali-sensitive plant.

[0101] In a thirteenth aspect, the present invention also provides products made from plants or plant materials thereof that have increased yield and / or salt tolerance / salt-alkali tolerance obtained by the method of the present invention.

[0102] In some implementations, the product is a soybean product, such as soybean oil, soybean protein powder, biofuel, surfactant, softener, etc.

[0103] The embodiments of the present invention will now be described in detail with reference to the accompanying drawings and examples. However, those skilled in the art will understand that the following drawings and examples are for illustrative purposes only and are not intended to limit the scope of the invention. Various objects and advantages of the present invention will become apparent to those skilled in the art from the following detailed description of the drawings and preferred embodiments. Attached Figure Description

[0104] Figure 1 shows a schematic diagram of the preparation of GmERF416 gene-editing mutants. The upper figure shows the two target sequences of GmERF416 (sgRNA1 and sgRNA2) and their specific locations on the GmERF416 gene, while the lower figure shows the sequencing verification of the two gene-editing mutants erf416-1 and erf416-2.

[0105] Figure 2 shows the relative expression levels of GmERF416 in control soybean DN50 and homozygous mutants of GmERF416, erf416-1 and erf416-2 soybeans.

[0106] Figure 3 shows the plant phenotypes of control DN50 soybeans and mutants erf416-1 and erf416-2 during their vegetative growth period (top), reproductive growth period (middle), and harvest period (bottom) under normal soil growth conditions.

[0107] Figure 4 shows the statistical results of single-plant yield (A) and single-plant pod number (B) of soybeans with control DN50 and mutants erf416-1 and erf416-2.

[0108] Figure 5 shows that the transcription of the GmERF416 gene in salt-sensitive wild soybean Y0532 was higher than that in salt-tolerant wild soybean Y55 after 12 hours of salt (150 nM NaCl) stress.

[0109] Figure 6 shows the phenotypes of control DN50 soybeans and mutants erf416-1 and erf416-2 during the V3-V7 growth stages in saline-free soil (untreated) and saline-containing soil (salt-treated).

[0110] Figure 7 shows the phenotypic results of soybeans of control DN50 and mutants erf416-1 and erf416-2 during their growth stages under salt-free treatment (normal growth conditions, as a control, i.e., "Water" in the figure) and salt treatment (0.5% NaCl). Figure A shows the leaf area at the first trifoliate leaf stage (V3 stage); Figure B shows the plant height at the fifth to sixth trifoliate leaf stage (V5-6 stage); Figure C shows the plant height at the sixth to seventh trifoliate leaf stage (V6-7 stage); and Figure D shows the plant height under salt stress relative to normal growth conditions at the sixth to seventh trifoliate leaf stage (salt stress condition is soil containing 0.5% NaCl).

[0111] Figure 8 shows the phenotypes of control DN50 soybeans and mutants erf416-1 and erf416-2 during their growth periods in normal soil (control growth conditions) and alkaline saline soil (75 mM mixed alkaline salt treatment).

[0112] Figure 9 shows a comparison of the fresh weight of control DN50 soybeans and mutants erf416-1 and erf416-2 soybeans at the seedling stage after mixed alkaline salt treatment (B, 75 mM alkali treatment), where (A) shows the fresh weight without alkali treatment (control growth conditions).

[0113] Figure 10 shows the soil pH test results before and after sowing.

[0114] Figure 11 shows the detection of salt content in the soil before and after sowing.

[0115] Figure 12 shows a comparison of the number of pods per plant in control DN50 soybean and mutants erf416-1 and erf416-2 soybeans grown in saline-alkali soil. (A) shows the phenotype at maturity, and (B) shows the pod count per plant.

[0116] Sequence List Description

[0117] Table A. Sequences in this invention

[0118] Invention Details

[0119] Those skilled in the art will understand that the present invention is not limited to the specific methodologies, embodiments, and reagents described herein, as these are illustrative. It should also be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of the invention, which is defined only by the appended claims.

[0120] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0121] Furthermore, unless the context otherwise requires, singular terms shall include plural terms, and plural terms shall include singular terms. More specifically, as used in this specification and the appended claims, unless the context otherwise clearly indicates, the singular forms “a” and “this” include plural indicators.

[0122] definition

[0123] The following definitions and methods are provided to better define this application and to guide those skilled in the art in its practice. Unless otherwise stated, the terms are to be understood in accordance with their conventional usage by those skilled in the art. All patent literature, academic papers, industry standards, and other publicly available publications cited herein are incorporated herein by reference in their entirety.

[0124] As used herein, "plant" in a broad sense includes the whole plant, plant organs, plant tissues, seeds, and plant cells, as well as their offspring. Plant cells include, but are not limited to, cells derived from seeds, suspension cultures, embryos, meristematic regions, callus, leaves, roots, seedlings, gametophytes, sporophytes, pollen, and microspores. "Offspring" includes any subsequent generations of the plant. Plant material includes, for example, plant parts, plant organs, plant tissues, seeds, plant protoplasts, or plant cells, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, stems, roots, root tips, anthers, plant cell cultures, or plant callus.

[0125] As used herein, the terms "saline-alkali soil," "salt soil," or "alkaline soil" refer to soil types where salts accumulate, indicating that the salt or alkaline salts in the soil affect the normal growth of plants (e.g., crops). The formation of alkaline and alkalized soils is largely related to the accumulation of carbonates in the soil, resulting in generally high alkalinity. In severely saline-alkali soil areas, plants can hardly survive. Based on soil salinity and pH value, saline-alkali land is classified into slightly saline-alkali land, moderately saline-alkali land, and severely saline-alkali land. Slightly saline-alkali land refers to land with a seedling emergence rate of 70%-80% and a salt content below 0.3%; severely saline-alkali land refers to land with a salt content exceeding 0.6% and a seedling emergence rate below 50%; moderately saline-alkali land falls between slightly and severely saline-alkali land. In terms of pH value: slightly saline-alkali land has a pH of 7.1-8.5, moderately saline-alkali land has a pH of 8.5-9.5, and severely saline-alkali land has a pH above 9.5. In the laboratory, "saline-alkali soil" is often simulated by mixing sodium salts (e.g., sodium carbonate and sodium bicarbonate) and by adding sodium chloride to the soil.

[0126] Unless otherwise specified, nucleic acids are written from left to right in a 5' to 3' direction; amino acid sequences are written from left to right in a amino to carboxyl direction. Amino acids may be represented in this text using their commonly known three-letter symbols or the single-letter symbols recommended by the IUPAC-IUB Committee on Biochemistry Nomenclature. Similarly, nucleotides may be represented using commonly accepted single-letter codes. Numerical ranges include the numbers that define the range.

[0127] As used herein, “nucleic acid” includes deoxyribonucleotides or ribonucleotide polymers in single-stranded or double-stranded form, and unless otherwise limited, includes known analogs (e.g., peptide nucleic acids) that have the basic properties of natural nucleotides and hybridize with single-stranded nucleic acids in a manner similar to that of naturally occurring nucleotides.

[0128] As used herein, the term "coding sequence," when used in the context of a specific nucleic acid, refers to a nucleic acid that contains the essential information to guide the translation of that nucleotide sequence into a specific protein. Codons are used to represent the information encoding the protein. As used herein, "full-length sequence" referring to a specific polynucleotide or the protein it encodes means the entire nucleic acid sequence or the entire amino acid sequence having a natural (non-synthetic) endogenous sequence. The full-length polynucleotide encodes the full-length or catalytically active form of that specific protein.

[0129] The terms “peptide,” “polypeptide,” and “protein” are used interchangeably in this document to refer to polymers of amino acid residues. The term is used to refer to naturally occurring amino acid polymers or to amino acid polymers containing non-naturally occurring amino acids, wherein one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids.

[0130] The term "residue" or "amino acid residue" or "amino acid" may be used interchangeably in this document to refer to an amino acid incorporated into a protein, polypeptide, or peptide. An amino acid may be a naturally occurring amino acid, and unless otherwise limited, may include known analogues of a naturally occurring amino acid that can function in a similar manner to the naturally occurring amino acid.

[0131] In some embodiments, the nucleotide sequence of this application may be modified to perform conserved amino acid substitutions. Principles and examples of conserved amino acid substitutions are further described below. In some embodiments, the nucleotide sequence of this application may be substituted without altering the amino acid sequence, according to disclosed dicotyledonous codon preferences. For example, a codon encoding the same amino acid sequence may be substituted with a dicotyledonous preferred codon without changing the amino acid sequence encoded by the nucleotide sequence. In some embodiments, a portion of the nucleotide sequence in this application may be substituted with a different codon encoding the same amino acid sequence, thereby changing the nucleotide sequence without altering the encoded amino acid sequence. Conserved variants include those sequences that encode an amino acid sequence of one of the proteins of the embodiments due to genetic codon degeneracy. In some embodiments, a portion of the nucleotide sequence in this application may be substituted according to dicotyledonous preferred codons. Those skilled in the art will recognize that amino acid additions and / or substitutions are generally based on the relative similarity of amino acid side-chain substituents, such as the hydrophobicity, charge, size, etc., of the substituents. Exemplary amino acid substituents having the various properties considered above are well known to those skilled in the art and include arginine and lysine; glutamic acid and aspartic acid; serine and threonine; glutamine and asparagine; and valine, leucine, and isoleucine. Guidance on appropriate amino acid substitutions that do not affect the biological activity of the target protein can be found in the model of Dayhoff et al. (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, DC) (incorporated herein by reference). Conservative substitutions, such as replacing one amino acid with another amino acid having similar properties, can be made. A “conservative amino acid substitution” is one in which an amino acid is substituted with a different amino acid that is predicted to have the least interference with the properties of the reference peptide. In other words, a conservative amino acid substitution substantially preserves the structure and function of the reference peptide. Table B below provides a list of exemplary conserved amino acid substitutions considered herein.

[0132] Table B. Exemplary Conserved Amino Acid Substitutions

[0133] Regarding proteins, a "deletion" refers to a change in the amino acid sequence that results in the absence of one or more amino acid residues. A deletion may remove at least 1, 2, 3, 4, 5, 10, 20, 50, 100, 200, or more amino acid residues. Deletions may include internal deletions and / or terminal deletions (e.g., N-terminal truncation, C-terminal truncation, or both of a reference polypeptide sequence). A "variant," "mutant," or "derivative" of the reference polypeptide sequence may contain deletions relative to the reference polypeptide sequence.

[0134] Regarding proteins, the terms "insertion" and "addition" refer to changes in the amino acid sequence that result in the addition of one or more amino acid residues. An insertion or addition can refer to 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, or more amino acid residues. A "variant," "mutant," or "derivative" of a reference polypeptide sequence can include insertions or additions relative to the reference polypeptide sequence. Protein variants can have any combination of N-terminal insertions, C-terminal insertions, internal insertions, or N-terminal insertions, C-terminal insertions, and internal insertions.

[0135] The term "homology" generally refers to the degree of similarity between the nucleotide sequences of two nucleic acid molecules or the amino acid sequences of two protein molecules. In the process of molecular evolution, two nucleic acid molecules or two protein molecules that are homologous usually originate from the same ancestor, have similar sequences, and have the same or similar functional activities.

[0136] Regarding proteins, the terms "percentage of sequence identity" and "% identity" refer to the percentage of residue matches between at least two amino acid sequences aligned using a normalized algorithm. Methods for amino acid sequence alignment are well-known. Some alignment methods take into account conserved amino acid substitutions. Such conserved substitutions, explained in more detail below, typically preserve the charge and hydrophobicity at the substitution site, thereby preserving the structure (and therefore function) of the polypeptide. The percentage of identity of an amino acid sequence can be determined as is understood in the art (see, for example, U.S. Patent No. 7,396,664, which is incorporated herein by reference in its entirety). The National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST) provides a suite of commonly used and freely available sequence comparison algorithms, available from multiple sources, including NCBI, Bethesda, and Md., on their websites. The BLAST software suite includes various sequence analysis programs, including "blastp," which is used to align known amino acid sequences with other amino acid sequences from various databases.

[0137] Regarding proteins, the percentage of identity can be measured over the entire length of a defined polypeptide sequence (e.g., as determined by a specific SEQ ID NO), or over a shorter length, such as over a fragment taken from a larger, defined polypeptide sequence (e.g., a fragment of at least 15, 20, 30, 40, 50, 70, or 150 consecutive residues). Such lengths are merely exemplary and it should be understood that any fragment length supported by the sequences shown in the tables, figures, or sequence listings herein can be used to describe the length over which the percentage of identity can be measured.

[0138] As used herein, “nucleic acid sequence identity” refers to the sequence similarity between two polynucleotide sequences. When positions in two compared sequences are occupied by the same bases—for example, if every position in two DNA molecules is occupied by adenine—then the molecules are identical at that position. The percentage of identity between two sequences is a function of the number of matching or homologous positions shared by the two sequences divided by the number of compared positions multiplied by 100.

[0139] Identification of nucleic acid sequence identity includes hybridization techniques. For example, a known nucleotide sequence, in whole or in part, is used as a probe for selective hybridization with other corresponding nucleotide sequences present in a cloned genomic DNA fragment or cDNA fragment group (i.e., a genomic library or cDNA library) from a selected organism. The hybridization probe can be a genomic DNA fragment, cDNA fragment, RNA fragment, or other oligonucleotide, and can be labeled with a detectable group such as 32P or other detectable markers. Thus, for example, hybridization probes can be prepared by labeling synthetic oligonucleotides based on sequences from an embodiment. Methods for preparing hybridization probes and constructing cDNA and genomic libraries are generally known in the art. Hybridization of the sequences can be performed under stringent conditions. As used herein, the term "stringent conditions" or "stringent hybridization conditions" refers to conditions under which the probe will hybridize with its target sequence to a detectable extent (e.g., at least 2, 5, or 10 times the background) relative to hybridization with other sequences. Stringent conditions are sequence-dependent and vary in different environments. By controlling hybridization stringency and / or controlling washing conditions, target sequences that are 100% complementary to the probe can be identified (homology probe method). Alternatively, stringent conditions can be adjusted to allow for some sequence mismatches in order to detect lower similarities (heterologous probe method). Typically, the probe length is less than about 1000 or 500 nucleotides. Typically, stringent conditions are as follows: a salt concentration of less than about 1.5 M Na ions at pH 7.0 to 8.3, typically about 0.01 M to 1.0 M Na ion concentration (or other salts), and temperature conditions of at least about 30 °C for short probes (e.g., 10 to 50 nucleotides) and at least about 60 °C for long probes (e.g., greater than 50 nucleotides). Stringent conditions can also be achieved by adding a destabilizing agent such as formamide. Exemplary low-threat conditions include hybridization at 37°C using 30% to 35% formamide buffer, 1M NaCl, and 1% SDS (sodium dodecyl sulfate), followed by washing at 50°C to 55°C in 1× to 2× SSC (20× SSC = 3.0M NaCl / 0.3M trisodium citrate). Exemplary medium-threat conditions include hybridization at 37°C using 40% to 45% formamide, 1.0M NaCl, and 1% SDS, followed by washing at 55°C to 60°C in 0.5× to 1× SSC. Exemplary high-threat conditions include hybridization at 37°C using 50% formamide, 1M NaCl, and 1% SDS, followed by a final wash at 60°C to 65°C in 0.1× SSC for at least about 20 minutes. Optionally, the wash buffer may contain about 0.1% to about 1% SDS. Hybridization duration is typically less than about 24 hours, typically from about 4 hours to about 12 hours. Specificity usually depends on washing after hybridization, and the key factors are the ionic strength and temperature of the final washing solution.The thermodynamic melting point (Tm) of a DNA-DNA hybrid can be approximated by the formula from Meinkoth and Wahl (1984) Anal. Biochem. 138:267-284: Tm = 81.5 °C + 16.6 (logM) + 0.41 (% GC) - 0.61 (% formamide) - 500 / L; where M is the molar concentration of the monovalent cation, % GC is the percentage of guanosine and cytosine nucleotides in the DNA, "formamide%" is the percentage of formamide in the hybridization solution, and L is the base pair length of the hybrid. Tm is the temperature at which 50% of the complementary target sequence hybridizes with a perfectly matched probe (at a given ionic strength and pH). Washing is typically performed at least until equilibration and a low hybridization background level is achieved, such as for 2 hours, 1 hour, or 30 minutes. Each 1% mispairing should lower Tm by approximately 1 °C; therefore, Tm, hybridization, and / or washing conditions can be adjusted to hybridize with the desired sequence of homogeneity. For example, if a sequence with ≥90% homology is required, the Tm can be lowered by 10°C. Typically, stringent conditions are chosen to be approximately 5°C lower than the Tm of the specific sequence and its complementary sequence at the determined ionic strength and pH. However, under very stringent conditions, hybridization and / or washing can be performed at 4°C lower than the stated Tm; under moderately stringent conditions, hybridization and / or washing can be performed at 6°C lower than the stated Tm; and under low stringent conditions, hybridization and / or washing can be performed at 11°C lower than the stated Tm.

[0140] As used herein, “knockdown” refers to a reduction in the expression of a specific gene product (e.g., protein, mRNA, or both). Protein knockdown can be measured by detecting proteins secreted by a tissue or cell population (e.g., in cell culture medium) or by detecting the total cellular amount of protein from the tissue or cell population of interest before and after knockdown. Methods for measuring mRNA knockdown are known in the art and include sequencing mRNA isolated from the tissue or cell population of interest. In some embodiments, “knockdown” can refer to some loss of expression of a specific gene product, such as a reduction in the amount of transcribed mRNA or a reduction in the amount of protein expressed or secreted by a cell population.

[0141] As used in this article, "knockout" refers to an experimental method that specifically renders a target gene in an organism nonfunctional through genetic engineering techniques. This method typically utilizes gene editing tools (such as CRISPR-Cas9, TALENs, or homologous recombination) to directionally delete, insert, or modify the sequence of the target gene, causing it to be unable to be expressed normally or to produce functional proteins.

[0142] A protein tag is a polypeptide or protein fused with a target protein using in vitro recombinant DNA technology for expression, detection, tracing, and / or purification of the target protein. Protein tags include, but are not limited to, Flag tags, His tags, MBP tags, HA tags, myc tags, GST tags, and / or SUMO tags. Example

[0143] The embodiments of the present invention will now be described in detail with reference to examples.

[0144] Material:

[0145] The soybean variety Williams 82 (W82) is documented in the following literature: Scott A. Jackson et al., Genome sequence of the palaeopolyploid soybean, Nature, 2010, Vol.463, 178-183; it is available to the public from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences; this soybean material is an American cultivar, donated by Professor Scott Jackson of the Department of Agronomy, Purdue University, USA.

[0146] The soybean variety Dongnong 50 (Glycine max L. Merr, abbreviated as DN50) is a new variety developed by Northeast Agricultural University in China. It has been widely recognized and promoted due to its high production performance, stress resistance and processing quality. Dongnong 50 is recorded in the following literature: Junmei Hu, Yongbin Zhuang, Xianchong Li, Xiaoming Li, Chanchan Sun, Zhaojun Ding, Ran Xu, Dajian Zhang, Time-series transcriptome comparison reveals the gene regulation network under salt stress in soybean (Glycine max) roots, BMC Plant Biology, 2022 Mar 31; 22(1):157. doi:10.1186 / s12870-022-03541-9. Although DN50 is a Northeast variety and is not suitable for growth in Beijing greenhouses, it is easy to convert, has a short growth cycle and has certain salt and alkali tolerance. Therefore, it is used as a recipient control in the following examples.

[0147] Wild soybean materials Y0532 (salt sensitivity) and Y55 (salt tolerance) were provided by Researcher Lai Yongcai of the Heilongjiang Academy of Agricultural Sciences, China, and are described in: Bian XH, et al., A class B heat shock factor selected for during soybean domestication contributes to salt tolerance by promoting flavonoid biosynthesis. New Phytologist (2020). 225:268-283. This biological material is available to the public from the applicant and is intended solely for the replication of experiments of this invention; it may not be used for any other purpose.

[0148] Agrobacterium tumefaciens EHA105 is described in the following literature: Rodrigues SD, Karimi M, Imppens L, Van Lerberge E, Coussens G, Aesaert S, Rombaut D, Holtappels D, Ibrahim HMM, Van Montagu M, Wagemans J, Jacobs TB, De Coninck B, Pauwels L., Efficient CRISPR-mediated base editing in Agrobacterium spp., Proc Natl Acad Sci US A. 2021 Jan, 12; 118(2):e2013338118. doi:10.1073 / pnas.2013338118. Agrobacterium tumefaciens EHA105 is commercially available.

[0149] The gene editing was performed by Wimi Biotechnology Co., Ltd. (formerly known as Baige Biotechnology Co., Ltd.), and the pCBSG015 vector used was purchased from Wimi Biotechnology Co., Ltd., with the catalog number wimi-pCXB053.

[0150] The aforementioned biological materials are available to the public from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. These biological materials are only for repeating the relevant experiments of this invention and shall not be used for other purposes.

[0151] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0152] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0153] The following examples used SPSS 11.5 statistical software to process the data. The experimental results are expressed as mean ± standard deviation. One-way ANOVA was used. P < 0.05 (*) indicates a significant difference, P < 0.01 (**) indicates a highly significant difference, and P < 0.001 (***) indicates a highly significant difference.

[0154] Example 1. Obtaining the soybean GmREF416 gene

[0155] GmERF416 (Glyma.02G087400) belongs to the AP2 / ERF family of transcription factors, which is found exclusively in plants. The AP2 / ERF family is a large family, named for its AP2 / ERF domain, which consists of 60-70 amino acids. AP2 / ERF transcription factors participate in various biological processes, including plant growth, flower, fruit and seed development, damage repair, pathogen defense, and abiotic stress responses. AP2 / ERF transcription factors are involved in multiple hormone signaling pathways, including those involving salicylic acid, jasmonic acid, ethylene, and abscisic acid. In analyzing the target genes of soybean miRNA172a, the applicant discovered that GmERF416 is associated with yield per plant. Overexpression of GmERF416 leads to a decrease in soybean yield per plant, thus inferring and verifying that GmERF416 negatively regulates soybean seed weight. Further research also revealed that GmERF416 negatively regulates the salt tolerance and salinity tolerance of soybean.

[0156] Total RNA was extracted from Williams 82 and reverse transcribed into cDNA using reverse transcriptase. Primers were designed based on the reference genome sequence of Williams 82 (W82), and the primer sequences are shown in Table 1.

[0157] Table 1 Primers for GmERF416 gene amplification

[0158] Using Williams 82 cDNA as a template, PCR amplification was performed using ERF416-CDS-F and ERF416-CDS-R primers. The GmERF416 gene was amplified from soybean total RNA using PCR: W82 leaves were crushed in liquid nitrogen, suspended in 4 mol / L guanidine thiocyanate, and extracted with acidic phenol and chloroform. The supernatant was precipitated with anhydrous ethanol, and the precipitate was dissolved in RNase-free water to obtain total RNA. 1 μg of total RNA was reverse transcribed using a reverse transcription kit (Thermo Fisher Scientific) according to the kit instructions. The resulting cDNA fragment was then used as a template for PCR amplification.

[0159] The 50 μl PCR reaction system consisted of: 1 μl single-stranded cDNA (0.05 μg), 1.5 μl of the above primers (10 μM), 25 μl 2× PCR buffer, 10 μl dNTPs (10 mM), and 1 U KOD DNA polymerase, with the volume made up to 50 μl with ultrapure water. The reaction was performed on a PE9600 PCR instrument with the following program: denaturation at 94℃ for 5 min; 98℃ for 1 min, 58℃ for 1 min, 68℃ for 1 min, for a total of 30–32 cycles; extension at 68℃ for 10 min; and storage at 4℃. A PCR product of approximately 1.3 kb was obtained. Sequencing revealed that the PCR product was 1251 bp, corresponding to the nucleotide sequence shown in SEQ ID NO:1, which is the GmERF416 gene. The coding sequence (CDS) of the GmERF416 gene is SEQ ID NO:1, and the encoded protein is named GmERF416 (SEQ ID NO:2). The genomic DNA sequence of the GmERF416 gene is SEQ ID NO:3.

[0160] Example 2. GmERF416 gene mutation leads to increased soybean seed weight.

[0161] 1. Knockout of the GmERF416 gene in soybean Williams 82

[0162] 1.1 Construction of the pCBSG015 gene editing vector

[0163] Target sequence selection: A high-throughput CRISPR-Cas9 target design program developed by China Weimi Biotechnology Co., Ltd. was used. The target design principles of this program are as follows: 1) The knockout site is located in the coding sequence (CDS) and preferably at the protein's front end or in an important functional domain; 2) It should cover a higher proportion of transcripts; 3) There should be no off-target effects or off-target effects should be located in intergenic regions; 4) Targets with higher editing efficiency should be preferred; 5) The sequence should have a relatively balanced GC content and be less prone to secondary structure formation. The successful application of this program in the whole-genome target design of rice has proven its feasibility.

[0164] The GmERF416 gene was edited using a dual-gene, dual-target knockout approach.

[0165] The selected target sites are located in the first exon region of the GmERF416 gene. The target sequence of T1 (sgRNA1) is nucleotides 472-494 of SEQ ID NO:1, with the sequence 5'-TCTCGCAGCTCGCAGTACCGGGG-3'; the target sequence of T2 (sgRNA2) is nucleotides 507-529 of SEQ ID NO:1, with the sequence 5'-CCGCAGGACTGGTAGATGGGAGT-3'. The positions of T1 and T2 in SEQ ID NO:1 are shown in Figure 1.

[0166] Promoter selection: The AtU6 promoter derived from Arabidopsis thaliana was used to start the T1 and T2 target sites.

[0167] Preparation of sgRNA expression cassettes containing target sites: pCBSG015 vector was linearized by Bsa I restriction enzyme digestion. The T1 sequence was directly synthesized using primer synthesis method, and 16bp vector sequences were added to both ends as homologous arms (U6-T1, U6-T2). Reverse complementary sequences (Anti-U6-T1, Anti-U6-T2) were synthesized, annealed to form double strands, and homologously recombinated with the backbone linear vector.

[0168] T1:TCTCGCAGCTCGCAGTACCG(5'-3')

[0169] T2:ACTCCCATCTACCAGTCCTG(5'-3')

[0170] The specific steps are as follows:

[0171] Sense-U6-T1: 5'-ggcaccgagtcggtgcTCTCGCAGCTCGCAGTACCGgttgaacaacggaaac-3';

[0172] Anti-U6-T1: 5'-gtttccgttgttcaacCGGTACTGCGAGCTGCGAGAgcaccgactcggtgcc-3';

[0173] Lowercase letters indicate homologous arms, and uppercase letters indicate T1 sequences.

[0174] Sense-U6-T2: 5'-ggcaccgagtcggtgcACTCCCATCTACCAGTCCTGgttgaacaacggaaac-3';

[0175] Anti-U6-T2: 5'-gtttccgttgttcaacCAGGACTGGTAGATGGGAGTgcaccgactcggtgcc-3';

[0176] Lowercase letters represent homologous arms, and uppercase letters represent T2 sequences.

[0177] Preparation of annealed AtU6-T1-gRNA and AtU6-T2-gRNA fragments: The synthesized Sense-U6-T1 and Anti-U6-T1 sequences were annealed to form double strands, and the synthesized Sense-U6-T2 and Anti-U6-T2 sequences were annealed to form double strands. The reaction system was as follows: the synthesized sequences were dissolved in 75 mM NaCl solution to a final concentration of 0.2 nM, and equal volumes of the forward and reverse strand solutions (Sense-U6-T1 and Anti-U6-T1, Sense-U6-T2 and Anti-U6-T2) were mixed. The mixture was heated in a 95°C water bath for 5-10 min, followed by slow cooling to obtain the annealed AtU6-T1-gRNA and AtU6-T2-gRNA fragments.

[0178] Vector linearization by enzyme digestion: 1-2 μg of pCBSG015 plasmid, 10X CutSmart TM Add 5 μl of NEB buffer, 1 μl of Bsa I restriction enzyme, and sterile double-distilled water to a final volume of 50 μl. Incubate at 37°C for 30 min. Purify the DNA using the EZ-10 Column DNA Purification Kit (purchased from Shanghai Sangon Biotech), dissolve in an appropriate amount of water, and obtain the linearized pCBSG015 vector.

[0179] Homologous recombination of the target sgRNA expression cassette with the pCBSG015 vector was performed using the EasyGeno Rapid Recombinant Cloning Kit (purchased from TianGen). The reaction mixture consisted of 5 μL of 2×EasyGeno Assembly mix buffer, 0.5 μL of linearized pCBSG015 vector, and 4.5 μL of annealed AtU6-T1-gRNA and AtU6-T2-gRNA. The reaction conditions were 50℃ for 15 min. The ligation product was transformed into E. coli DH5α competent cells, and plasmids were extracted from positive colonies. After successful sequencing, the recombinant vector pCBSG015-sgRNA was obtained.

[0180] The recombinant vector pCBSG015-sgRNA is a recombinant plasmid obtained by replacing the fragments between 5'-ggcaccgagtcggtgc-3' and 5'-gttgaacaacggaaac-3' in the pCBSG015 vector with DNA fragments containing the sequences 5'-TCTCGCAGCTCGCAGTACCG-3' (sgRNA1) and 5'-ACTCCCATCTACCAGTCCTG-3' (sgRNA2) while keeping the other sequences of the pCBSG015 vector unchanged. The recombinant plasmid is named the recombinant vector pCBSG015-sgRNA.

[0181] The recombinant vector pCBSG015-sgRNA was transformed into Agrobacterium EHA105 competent cells to obtain Agrobacterium EHA105-pCBSG015-sgRNA.

[0182] 1.2 Genetic transformation of soybean

[0183] Soybean DN50 contains the GmERF416 genomic DNA sequence shown in SEQ ID NO:3. In SEQ ID NO:3, positions 1-539, 1689-1714, 1856-1886, 1993-2080, 2164-2312, 3033-3136, 3278-3408, and 4421-4603 are exons, and the remaining nucleotide sequences are introns.

[0184] The soybean variety DN50 was infected with the Agrobacterium EHA105-pCBSG015-sgRNA prepared above to obtain soybean plants with the GmERF416 gene edited. T0 generation seeds were harvested, and T1 generation seeds were obtained by self-pollination of T1 generation. T2 generation seedlings were obtained by planting T1 generation seeds and then performing the following tests.

[0185] 1.3 Screening of homozygous GmERF416 gene mutations

[0186] Using the genomic DNA of the T2 generation seedlings obtained in 1.2 as a template, PCR primers designed at approximately 219 bp upstream and 690 bp downstream of the target sequence T1 were used to amplify the DNA sequence of approximately 932 bp near the target sequence and then sequenced to detect the GmERF416 gene editing method. The target PCR primers and sequencing primers are shown in Table 2.

[0187] Table 2 Target PCR and Detection Primer Sequences

[0188] After successful sequencing, the CRISPR target editing method was analyzed using the website DSDecode (http: / / dsdecode.scgene.com / ) and compared with the standard gene sequence using manual peak reading. The editing methods of each target sequence and its upstream and downstream sequences were analyzed and passaged.

[0189] The gene editing methods of the homozygous mutants erf416-1 and erf416-2 of the GmERF416 gene screened by the above method are shown in Figure 1.

[0190] In the homozygous mutant erf416-1 of the GmERF416 gene, compared with the recipient soybean variety DN50, the GmERF416 gene in the genome has the following mutation: one guanine deoxyribonucleotide (G) is missing at position 513 of SEQ ID NO:3 in both homologous chromosomes (corresponding to nucleotide G at position 513 of SEQ ID NO:3), which causes the encoded protein GmERF416 to terminate prematurely at amino acid 205, thereby knocking out the GmERF416 gene.

[0191] In the homozygous mutant erf416-2 of the GmERF416 gene, compared with the recipient soybean variety DN50, the GmERF416 gene in the genome has the following mutation: 24 nucleotides (CCGGGGTGTCACCTTCTACCGCAG) are deleted from positions 489 to 512 of SEQ ID NO:1 (corresponding to positions 489 to 512 of SEQ ID NO:3) on both homologous chromosomes, causing the encoded protein to terminate prematurely at amino acid 162, thereby knocking out the GmERF416 gene.

[0192] Seeds from T2 generation plants (T3 generation) of mutants erf416-1 and erf416-2 were harvested for subsequent experiments.

[0193] 2. Phenotypic analysis of GmERF416 gene-edited materials erf416-1 and erf416-2

[0194] 2.1 Detection of GmERF416 gene expression levels in erf416-1 and erf416-2

[0195] Total RNA was extracted from soybean variety DN50 and its mutants erf416-1 and erf416-2 during mid-seed development and reverse transcribed. The cDNA obtained from the reverse transcription was used as a template for real-time PCR to identify the expression level of the GmERF416 gene. The primers used are shown in Table 3.

[0196] Table 3. Real-time PCR primers for identifying GmERF416 gene expression levels.

[0197] Using the soybean tubulin gene as an internal standard, the primers used for the internal standard are:

[0198] Primer-TF: 5′-AACCTCCTCCTCATCGTACT-3′

[0199] Primer-TR: 5′-GACAGCATCAGCCATGTTCA-3′.

[0200] The results are shown in Figure 2. The relative expression level of GmERF416 in DN50 was 0.016, while the expression levels of GmERF416 in mutants erf416-1 and erf416-2 were approximately 0.0043 and 0.0052, respectively. This indicates that the expression level of GmERF416 in erf416-1 and erf416-2 was significantly reduced (by approximately 73% and 67%, respectively).

[0201] 2.2 Downregulation of the GmERF416 gene increased the number of pods per soybean plant.

[0202] The first-generation seeds of erf416-1 and erf416-2 (seeds from the T2 generation plants of the transgenic event in 1.2) and the control soybean variety DN50 seeds were planted in greenhouse pots. Greenhouse conditions included a photoperiod of 16h:8h (daytime:nighttime); temperatures of 30-37℃ during the day and 25-28℃ at night. Reproductive development was observed. Seeds were harvested after 130 days. Phenotypic photographs at different growth stages are shown in Figure 3, indicating no significant differences in phenotype between erf416-1 and erf416-2 and the control DN50 during the vegetative growth stage (top), reproductive growth stage (middle), and harvest stage (bottom).

[0203] Pod count per plant: After the above-mentioned potted soybean seeds matured, the seeds harvested from each plant were dried at 37℃ for one week, and the number of pods per plant was measured for the recipient controls DN50, erf416-1, and erf416-2. Fifteen plants were taken from each line, and the biological experiment was repeated three times. Results were expressed as mean ± standard deviation. One-way ANOVA was used, with P < 0.05 (*) indicating a significant difference and P < 0.01 (**) indicating a highly significant difference.

[0204] The results are shown in Figure 4(B). The number of pods per plant in the recipient control DN50, erf416-1, and erf416-2 were 181.83±22, 207.46±19, and 224.57±21, respectively. Compared with the control DN50, the number of pods per plant in erf416-1 and erf416-2 increased by approximately 13% and 22.9%, respectively, indicating that downregulation of the GmERF416 gene increased the number of pods per soybean plant.

[0205] 2.3 Downregulation of the GmERF416 gene increased soybean yield.

[0206] Comparison of yields of receptor control DN50, mutant erf416-1 and erf416-2.

[0207] The first-generation seeds of erf416-1 and erf416-2 (seeds from the T2 generation plants of the transgenic event in 1.2) and the control DN50 seeds were planted in greenhouse pots and cultured under greenhouse conditions with a photoperiod of 16h:8h (daytime:nighttime); temperature: 30-37℃ during the day and 25-28℃ at night. Reproductive development was observed, and seeds were harvested after 130 days. After seed maturity, the yield per plant of the recipient control DN50, mutant erf416-1, and erf416-2 was measured. Mature seeds harvested from each plant were dried at 37℃ for one week. Fifteen plants from each line were taken, and all seeds from each plant were collected. The total weight of thoroughly dried seeds from each plant was weighed. The biological experiment was repeated three times, and the results were expressed as mean ± standard deviation. One-way ANOVA was used; P < 0.05 (*) indicated a significant difference, and P < 0.01 (**) indicated a highly significant difference.

[0208] The results are shown in Figure 4(A). The grain weights of the recipient control DN50, erf416-1, and erf416-2 were 36.06±2.8, 44.40±3.7, and 47.54±4.2 grams, respectively. The grain weights of the mutants erf416-1 and erf416-2 increased by approximately 23% and 32% compared to the control DN50, respectively.

[0209] The above statistics show that three biological replicate experiments with 15 individual plants in greenhouse pots showed that the number of pods per plant of erf416-1 and erf416-2 soybeans was significantly higher than that of the recipient DN50, and the yield per plant of erf416-1 and erf416-2 soybeans was also significantly higher than that of the control DN50. This indicates that GmERF416 negatively regulates the number of pods per plant and the yield per plant of soybeans, and reducing the expression level of the GmERF416 encoding gene can significantly increase the number of pods per plant and the yield per plant of soybeans.

[0210] Example 3. Transcription of the GmREF416 gene in salt-sensitive and salt-tolerant soybeans under salt stress

[0211] Salt-sensitive wild soybean Y0532 and salt-tolerant wild soybean Y55 were sown in vermiculite. Two weeks after emergence, the vermiculite was washed off the roots, and the seedlings were hydroponically cultured for two days to recover growth. They were then treated with 150 mM NaCl for 3, 6, and 12 hours, respectively. RNA was extracted from the roots at the time points after salt treatment for transcriptome sequencing.

[0212] FPKM (Fragments Per Kilobase of exon per Million fragments mapped) is a widely used gene expression reporter unit in the sequencing field. It measures the expression level of a gene (or transcript) by dividing the amplification of sequencing fragments on a chromosome into a numerical index. FPKM is a standardized unit of measurement; the FPKM ratio can measure the expression level of a gene under specific conditions. FPKM can also be used to compare the expression levels of different genes or between genes, as well as the differences in expression levels between different biological samples. Therefore, FPKM is a commonly used method for representing gene expression results and can reflect the gene expression status. Its calculation method is: the number of reads per million mapped fragments per thousand bases of transcription. FPKM values ​​can reflect the expression level of a specific gene under specific experimental conditions and have relatively good reliability.

[0213] The FPKM of GmERF416 was calculated based on the above transcriptome sequencing results, as shown in Figure 5. Under normal growth conditions (i.e., at 0 hours), the FPKM values ​​of soybean Y0532 and Y55 were approximately 2.6 and 3.9, respectively. The transcriptional level of GmERF416 in the salt-tolerant material Y55 was significantly higher than that in the salt-sensitive material Y0532. After treatment with 150 mM NaCl for 3 hours, the transcriptional levels of both materials increased significantly, reaching approximately 4.9 and 5.2, respectively, while the FPKM values ​​of the two materials were similar. After treatment with 150 mM NaCl for 6 hours, the transcriptional level of GmERF416 in both materials continued to increase, reaching approximately 8.5. After treatment with 150 mM NaCl for 12 hours, the FPKM value in Y0532 increased sharply to approximately 12.5, while that in Y55 decreased to approximately 6.4. The above results indicate that, after 12 hours of salt stress, the transcriptional level of GmERF416 in the salt-tolerant material Y55 was significantly lower than that in the salt-sensitive material Y0532. This suggests that GmERF416 and its encoding gene may negatively regulate plant salt tolerance.

[0214] Example 4. Effect of the GmERF416 gene on the salt tolerance of soybean

[0215] To verify the relationship between GmERF416 and plant salt tolerance, salt tolerance tests were conducted in a greenhouse. First-generation seeds of the homozygous GmERF416 gene mutants erf416-1 and erf416-2 (constructed and screened in Example 2) and seeds of the control soybean variety DN50 (which exhibits some salt and alkali tolerance) were planted in the greenhouse. The control group was irrigated with water, while the experimental group had its soil salinity (excluding the original soil salinity) adjusted to 0.5% using NaCl solution.

[0216] The specific procedure is as follows: Dry the soil thoroughly, weigh out 35 kg of soil, and then add 0.5% Na... + To determine the content of NaCl, 0.175 kg of NaCl was dissolved in 35 kg of water. The solution was then poured into the soil and mixed evenly. After weighing the pots with soil, control DN50 soybeans and the two mutant soybeans were sown in the same pot, with four plants per pot (four replicates). The soil moisture content was maintained at 70-75% during growth. Greenhouse conditions: photoperiod 16h:8h (daytime:night); temperature: 30-37℃ during the day and 25-28℃ at night. The growth status at each stage was observed. The biological experiment was repeated three times, and the results were expressed as mean ± standard deviation. A one-way ANOVA test was used, with P < 0.05 (*) indicating a significant difference and P < 0.01 (**) indicating a highly significant difference.

[0217] Figure 6 shows the growth status of soybean mutants erf416-1 and erf416-2 (control DN50 and GmERF416 gene homozygous mutants) at the first trifoliate leaf stage (V3), the fifth-sixth trifoliate leaf stage (V5-6), and the sixth-seventh trifoliate leaf stage (V6-7) in soil containing 0.5% NaCl. The results indicate that in soil containing 0.5% NaCl, the growth of mutant soybeans erf416-1 and erf416-2 was significantly better than that of the control DN50 at all growth stages.

[0218] Specifically, the phenotypic analysis results of soybean erf416-1 and erf416-2, homozygous mutants of the DN50 and GmERF416 genes, at each growth stage in soil containing 0.5% NaCl are as follows:

[0219] 1) Under normal conditions, at the first trifoliate leaf stage (V3 stage), the leaf areas of the control DN50 and the mutant soybeans erf416-1 and erf416-2 were 9.8±4.9, 10.5±2.3, and 9.0±2.4 cm², respectively. 2 In soil containing 0.5% NaCl, the leaf areas of the control DN50 and the mutant soybeans erf416-1 and erf416-2 were 5.7±2.5, 9.0±2.6, and 9.0±3.6 cm², respectively. 2 Compared with growth in salt-free soil (untreated, control conditions), the leaf area of ​​control DN50 and mutant soybeans erf416-1 and erf416-2 decreased by approximately 42%, 14%, and 0%, respectively, under salt stress. The results indicate that the salt tolerance of mutant soybeans erf416-1 and erf416-2 is significantly higher than that of the control GN50 (Figure A in Figure 7).

[0220] 2) Under normal conditions, at the 5th-6th trifoliate leaf stage (V5-6 stage), the plant heights of the control DN50 and the mutant soybeans erf416-1 and erf416-2 were 26.0±7.5 cm, 31.9±9.8 cm, and 26.6±7.5 cm, respectively. In soil containing 0.5% NaCl, the plant heights of the control DN50 and the mutant soybeans erf416-1 and erf416-2 were 14.1±3.5 cm, 24.1±12.6 cm, and 22.3±7.4 cm, respectively. Compared with growth in untreated (untreated, control) soil, the plant heights of the control DN50 and the mutant soybeans erf416-1 and erf416-2 decreased by approximately 46%, 24%, and 19%, respectively, under salt stress. The results showed that the salt tolerance of the mutant soybeans erf416-1 and erf416-2 was significantly higher than that of the control GN50 (Figure 7, B).

[0221] 3) Under normal conditions, at the 6th-7th trifoliate leaf stage (V6-7 stage), the plant heights of the control DN50 and the mutant soybeans erf416-1 and erf416-2 were 34.9±9.2, 40.7±13.8, and 37.9±6.5 cm, respectively. In soil containing 0.5% NaCl, the plant heights of the control DN50 and the mutant soybeans erf416-1 and erf416-2 were 21.5±4.1, 32.5±13.5, and 32.2±9.4 cm, respectively. Compared with growth in untreated (control) soil, the relative plant heights of the control DN50 and the mutant soybeans erf416-1 and erf416-2 under salt stress were approximately 62%, 80%, and 82%, respectively, representing a decrease of approximately 38%, 20%, and 17%. The results showed that the salt tolerance of mutant soybeans erf416-1 and erf416-2 was significantly higher than that of the control DN50 (Figures C and D in Figure 7).

[0222] The growth phenotypic results in Figure 6 show that, in soil containing 0.5% NaCl, the mutant soybeans erf416-1 and erf416-2 exhibited significantly better growth than the control DN50 at all growth stages. The statistical results in Figure 7 show that the leaf area, plant height, and relative plant height of the mutant soybeans erf416-1 and erf416-2 were all significantly higher than those of the control receptor DN50. These results indicate that GmERF416 negatively regulates soybean salt tolerance, and reducing the expression level of the gene encoding GmERF416 can significantly improve soybean salt tolerance. The mutant soybeans bred in this invention can grow under conditions with a total salt content greater than or equal to 5‰, and compared to the wild-type control, they exhibit high survival rates and increased yields.

[0223] Example 5. Alkali-tolerance phenotype analysis of GmERF416 gene-edited mutant soybeans erf416-1 and erf416-2

[0224] 1. Testing the alkaline salt tolerance of GmERF416 mutant soybeans erf416-1 and erf416-2 at the seedling stage.

[0225] 1.1 Preparation of Alkaline-Saline Soil

[0226] Mix the potting soil and vermiculite in a 1:1 volume ratio, add 2 kg of small-particle compound fertilizer per cubic meter of mixed soil, and mix thoroughly to ensure that the potting soil, vermiculite and compound fertilizer are mixed evenly.

[0227] Fill 9cm x 9cm square black boxes with the mixed soil, and press them down with your palm until they are level with the edge of the box. Each box weighs about 180 grams (soil moisture content is about 13%). Place 18 9cm x 9cm square black boxes filled with soil on each tray.

[0228] 1.2 Preparation of 75 mM alkaline solution

[0229] Weigh 30.18 g of NaHCO3 and 7.98 g of Na2CO3 (molar ratio NaHCO3:Na2CO3 = 5:1), dissolve them in 6 L of deionized water, and mix the alkaline solution. + The final concentration was 75 mM. The above solution was poured into the soil in the trays, with 6 L of the 75 mM mixed alkaline solution poured into each tray. The trays were left to stand for 6 hours to allow the soil in each tray to become saturated with the mixed alkaline solution and for all the mixed alkaline solution to be absorbed. In the control experiment, 6 L of deionized water was poured into each tray.

[0230] 1.3 Test the pH and salinity of the soil.

[0231] Six hours after the above treatment, the soil pH and salinity (g / L) were measured using a COMBI 5000 instrument. Subsequently, these measurements were performed before sowing, and at 7, 14, and 21 days after sowing to ensure that alkaline salt stress in the soil was maintained until the end of the experiment. The unit of salinity measured by the COMBI 5000 instrument is g / L. The initial salt content was calculated according to Table 4. Based on the measured results, during the growing season, the total salt concentration in the soil treated with a 75 mM mixed alkaline solution (molar ratio NaHCO3:Na2CO3 = 5:1) was 4‰-5‰ (in this experiment, equal to the total sodium salt content).

[0232] Table 4. Initial total salt content (total sodium content) in soil

[0233] 2. Sowing

[0234] 2.1 Seeds of the control DN50 and mutant soybeans erf416-1 and erf416-2 were sown separately in soil containing 75 mM alkaline salt, with 12 seeds per replicate, for a total of 14 replicates / treatment. After normal emergence, seedlings with uniform growth vigor were retained, with 8 plants per replicate. The control material was sown normally in soil under 0 mM alkaline stress, with the same number of replicates as the alkaline salt stress treatment.

[0235] 2.2 Greenhouse growing conditions

[0236] After sowing DN50 soybean mutants erf416-1 and erf416-2 plant materials, the growth conditions were as follows: light: 14 / 10 hours darkness, light intensity 400 μmol / m². -2 s -1 Temperatures are 25℃ (daytime) and 18℃ (nighttime), with humidity at 60-70%.

[0237] 3. Evaluation of the alkaline salt stress tolerance of control and GmERF416 mutant seedlings.

[0238] 3.1 Phenotypic Analysis

[0239] After 3 weeks of treatment with a 75 mM mixed alkaline salt (NaHCO3:Na2CO3), the phenotypes of control DN50 and mutant soybean erf416-1 and erf416-2 seedlings were observed (Figure 8). Under normal growth conditions, the average fresh weight per plant of control DN50 and mutant soybean erf416-1 and erf416-2 were approximately 3.59 g / plant, 3.75 g / plant, and 3.63 g / plant, respectively. However, after 3 weeks of treatment with the 75 mM mixed alkaline salt, the average fresh weight per plant of control DN50 and mutant soybean erf416-1 and erf416-2 were approximately 1.21 g / plant, 1.44 g / plant, and 1.45 g / plant, respectively. This indicates that after treatment with the 75 mM mixed alkaline salt, the biomass per plant of control DN50 was lower than the average biomass of mutant soybean erf416-1 and erf416-2, showing a highly significant difference. Under normal growth conditions (i.e., control growth conditions without mixed alkaline salts), there were no significant differences among the three.

[0240] 3.2 Soil pH test results

[0241] After soybean seedlings were sown, soil pH was measured using a COMBI 5000 instrument. Measurements were taken weekly for each sample from the start of sowing until the end of the alkaline salt treatment. The soil pH values ​​during soybean growth are shown in Figure 10. Under the 75 mM mixed alkaline salt treatment, the average soil pH was approximately 8.87, while the average pH of the control soil (i.e., untreated with mixed alkaline salt) was approximately 7.0 (Figure 10).

[0242] 3.3 Soil salinity test results

[0243] Meanwhile, soil salinity was measured using a COMBI 5000 instrument. Measurements were taken weekly for each sample, starting before sowing and continuing until the alkaline salt treatment ended. Soil salinity is shown in Figure 11. Under the 75 mM mixed alkaline salt treatment, the average soil salinity was 0.67 g / L, while the average salinity of the control soil (i.e., untreated with mixed alkaline salt) was 0.16 g / L. This conversion indicates that the salinity of the soil treated with 75 mM mixed alkaline salt was 4-5‰.

[0244] 3.4 Yield analysis after alkali treatment

[0245] Three weeks after alkaline salt treatment, some soybean materials were used for biomass analysis, while others were transplanted to a greenhouse for analysis of the number of pods per plant in the later stages of growth. The statistical results in Figure 12(B) show that the average number of pods per plant for mature DN50, erf416-1, and erf416-2 were approximately 21.4, 26.0, and 29.6, respectively. The average number of pods per plant for erf416-1 and erf416-2 was significantly higher than that for the control DN50.

[0246] The above results indicate that under alkaline and salt stress, the seedling biomass (Figure 9) and mature pod number per plant (Figure 12) of the mutant soybeans erf416-1 and erf416-2 were significantly higher than those of the recipient control DN50. These results demonstrate that GmERF416 negatively regulates soybean salt tolerance, and reducing the expression level of the gene encoding GmERF416 can significantly improve soybean salt tolerance. The mutant soybeans bred in this invention can grow under conditions of pH 8.5 to 9.5 and / or total salt content of 4-5‰, and exhibit higher survival rates and increased yields compared to the wild-type control.

[0247] Those skilled in the art will further recognize that the invention can be practiced over a wide range of conditions with equivalent parameters, concentrations, and without departing from the spirit or central features of the invention, and without requiring unnecessary experimentation. While specific embodiments are given, it should be understood that the invention is not limited to these detailed embodiments and further modifications can be made. In summary, in accordance with the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. An isolated nucleic acid molecule, said nucleic acid molecule encoding the following protein: (i) A protein containing the amino acid sequence shown in SEQ ID NO:2 or a protein composed of the amino acid sequence shown in SEQ ID NO:2; or (ii) A protein comprising an amino acid sequence of SEQ ID NO:2 obtained by substitution and / or deletion and / or addition of amino acid residues, having more than 80% sequence identity with SEQ ID NO:2 and having the same or similar function or activity as SEQ ID NO:2; or (iii) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of the protein in (i) or (ii).

2. A protein encoded by the nucleic acid molecule of claim 1.

3. An expression cassette or recombinant vector comprising the nucleic acid molecule of claim 1.

4. A recombinant host cell comprising the nucleic acid molecule of claim 1 or the expression cassette or recombinant vector of claim 3, wherein the host cell is a microbial cell, such as a bacterial cell or a fungal cell.

5. A transgenic plant cell or tissue comprising the nucleic acid molecule of claim 1 or the expression cassette or recombinant vector of claim 3.

6. A method for cultivating plants with increased yield and / or salt tolerance / salt-alkali tolerance, the method comprising: Inhibit the expression or activity of nucleic acid molecules in plants that encode proteins containing amino acid sequences with more than 80% sequence identity to SEQ ID NO:

2.

7. The method according to claim 6, wherein the expression level of the GmERF416 gene or its homologous gene is reduced or the GmERF416 gene or its homologous gene is not expressed by means of gene editing, gene silencing, targeted mutagenesis, chemical induction, radiation induction, natural mutation, RNAi, or the addition of a substance that inhibits the expression of the target gene, wherein the GmERF416 gene is as shown in SEQ ID NO:1 or 3.

8. The method according to claim 7, wherein the expression level of the GmERF416 gene or its homolog is reduced by at least 60% compared to the wild-type control plant, preferably by 65%, 70% or 80%, more preferably by 85%, 90% or 95%, or even not expressed.

9. The method according to claim 6, wherein the plant is a dicotyledonous plant, for example, a plant of the order Rosales, preferably a legume, more preferably a plant of the genus Glycine, and most preferably a soybean plant.

10. The method according to claim 7, wherein the plant with increased yield and / or salt tolerance / salt-alkali tolerance is the GmERF416 gene or a homozygous mutant of its homolog.

11. A method for cultivating plants with increased yield and / or salt tolerance / salt-alkali tolerance, the method comprising: Identify parental plants that contain mutations or nonfunctional alleles in the GmERF416 gene or its homologs, and then perform self-pollination or hybridization with another parental plant that contains mutations or nonfunctional alleles in the GmERF416 gene or its homologs to obtain one or more generations of offspring plants. The mutation reduces or eliminates the expression of the GmERF416 gene or its homologs, or reduces the content, activity, or activity of the protein encoded by the GmERF416 gene or its homologs.

12. A method for cultivating plants with increased yield and / or salt tolerance / salt-alkali tolerance, said method comprising: (1) Construct a recombinant vector that inhibits the GmERF416 gene or its homolog; and (2) Introduce the recombinant expression vector constructed in step (1) into the recipient plant to obtain plants with increased yield and / or salt tolerance / salt-alkali tolerance.

13. A method for cultivating plants with increased yield and / or salt tolerance / salt-alkali tolerance, said method comprising: (1) Construct a recombinant vector that inhibits the GmERF416 gene or its homolog; (2) Introduce the recombinant expression vector constructed in step (1) into plant cells or tissues to obtain plant cells or tissues in which the expression of the GmERF416 gene or its homologous gene is suppressed; and (3) Plant cells or tissues in which the expression of the GmERF416 gene or its homolog obtained in step (2) is suppressed grow into plants with increased yield and / or salt tolerance / salt-alkali tolerance.

14. The method according to claim 12 or 13, wherein the recombinant vector is a gene knockout vector.

15. The method according to any one of claims 11-13, wherein the expression level of the GmERF416 gene or its homologous gene is reduced by at least 60% compared to the wild-type control plant, preferably by 65%, 70% or 80%, more preferably by 85%, 90% or 95%, or even not expressed.

16. The method according to any one of claims 11-13, wherein the plant is a dicotyledonous plant, for example, a plant of the order Rosales, preferably a legume, more preferably a plant of the genus Glycine, and most preferably a soybean plant.

17. A method for cultivating soybean plants with increased yield and / or improved salt / alkali tolerance, the method comprising: The genome of the target soybean plant was knocked out using a single vector with two target sites, thereby knocking out the GmERF416 gene and obtaining a homozygous mutant soybean plant with the GmERF416 gene.

18. The method according to claim 17, wherein the homozygous mutant soybean plant of the GmERF416 gene has a deletion of 1 nucleotide at position 513 of SEQ ID NO:1, or a deletion of 24 nucleotides at positions 489-512 of SEQ ID NO:

1.

19. A plant or plant material, wherein the plant is obtained by the method of any one of claims 6-18.

20. The plant or plant material according to claim 19, wherein the plant material is a plant part, plant organ, plant tissue, seed, plant protoplast or plant cell, such as embryo, pollen, ovule, seed, leaf, flower, branch, fruit, stem, root, root tip, anther, plant cell culture or plant callus.

21. A method for preparing hybrid plant seeds, the method comprising: (i) Crossing a first parent plant with a second parent plant, wherein each of the first and second parent plants contains a mutation in a gene encoding a protein comprising an amino acid sequence having more than 80% sequence identity with SEQ ID NO:2; and (ii) Harvesting seeds of hybrid plants or their offspring; The mutation reduces or stops the expression of the gene, or reduces the content, activity, or inactivation of the protein encoded by the gene.

22. A product made from the plant or plant material as described in claim 19 or 20.

23. The product of claim 22, wherein the product is a soybean product, such as soybean oil, soybean protein powder, biofuel, surfactant, or softener.

24. The use of the nucleic acid molecule of claim 1 or the protein of claim 2 in regulating plant salt tolerance or salt-alkali tolerance, wherein, When the expression level of the nucleic acid molecule described in claim 1 or the content or activity of the protein described in claim 2 increases in a plant, the plant is salt-sensitive or salt-alkali-sensitive; or when the expression level of the nucleic acid molecule described in claim 1 or the content or activity of the protein described in claim 2 decreases in a plant, the plant's salt tolerance or salt-alkali tolerance increases.

25. Use of the nucleic acid molecule of claim 1 or the protein of claim 2 in regulating plant yield, wherein plant yield increases when the expression level of the nucleic acid molecule of claim 1 is reduced or the content or activity of the protein of claim 2 is reduced in the plant.

Images