KASP molecular marker primer combination for detecting resistance to peanut late spot disease and application of KASP molecular marker primer combination

Abstract

The invention discloses a KASP molecular marker primer combination for detecting peanut late spot disease resistance and application of the KASP molecular marker primer combination, and belongs to the technical field of peanut molecular breeding. The molecular marker linked with the late spot resistance character can be used for detecting the genotype of peanuts so as to judge whether a material has late spot resistance or not, through high-throughput genotyping detection, manpower and material resources are greatly saved, the detection is not influenced by environmental factors, the result is accurate and reliable, and the molecular marker can be used for early screening of peanut late spot resistance varieties and can be applied to early screening of peanut late spot resistance varieties. The breeding period can be shortened and the breeding efficiency is improved.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of peanut molecular breeding, and particularly relates to a KASP molecular marker primer combination for detecting peanut late leaf spot resistance and application thereof. BACKGROUND

[0002] Peanut (Arachis hypogaea L.) Arachis hypogaea L . ), also known as fall-borne, fall-borne, long-lived fruit, long fruit, is a legume of the legume family Arachis; annual herb, erect or creeping; underground results. Peanut is an important economic and oil crop in the world, and is also an important source of oil and protein in people's daily diet. The yield of peanuts directly affects the economic income of the growers. Under suitable environmental conditions, the yield of peanuts is largely affected by diseases. Late leaf spot (LLS), also known as black spot, is one of the leaf diseases that seriously affect the yield of peanuts, and the yield of peanuts is generally reduced by 10% ~ 20%, and the yield of peanuts is reduced by more than 50% in severe cases. It is estimated that the economic loss of global peanut industry caused by late leaf spot is as high as tens of millions of dollars, which further highlights the urgent need for effective and sustainable disease control strategies. However, the current traditional prevention and control measures of peanut late leaf spot mainly rely on chemical fungicides such as chlorothalonil and tebuconazole. Although these chemical agents have significant effect on reducing the incidence and severity of diseases, they also have some limitations that cannot be ignored, including environmental pollution, negative impact on human and animal health, and emergence of resistant pathogenic strains. Therefore, peanut disease resistance breeding has become one of the key directions of peanut breeding research, and the exploration of peanut late leaf spot resistance related genes and molecular markers is of great significance to high yield and high quality breeding of peanuts.

[0003] However, the research on the mechanism of peanut late leaf spot resistance and disease resistance breeding is relatively less, and the mechanism of peanut late leaf spot resistance has not been elucidated. Although some progress has been made in the development of molecular markers for peanut late leaf spot resistance, few of them have played a real role in variety breeding, and the breeding of peanut late leaf spot resistance is mainly based on traditional conventional breeding methods. Therefore, it is urgent to develop new molecular markers for detecting peanut late leaf spot resistance. SUMMARY

[0004] In view of the above prior art, the present application aims to provide a KASP molecular marker primer combination for detecting peanut late leaf spot resistance and application thereof.

[0005] To achieve the above-mentioned purpose, the technical scheme adopted by the present application is as follows: In a first aspect of the present application, the application of a primer for detecting a specific SNP in identifying peanut late leaf spot resistance is provided. The specific SNP includes SNP-2-4 and SNP-2-5; the SNP-2-4 is the nucleotide at position 1334356 on chromosome 2 of peanut genome, and the base polymorphism is G / A; and the SNP-2-5 is the nucleotide at position 1653773 on chromosome 2 of peanut genome, and the base polymorphism is C / G.

[0006] The peanut with SNP-2-4 site being A and SNP-2-5 site being G has higher resistance to peanut late leaf spot than the peanut with SNP-2-4 site being G and SNP-2-5 site being C.

[0007] The positions of the specific SNP are determined with reference to peanut cultivar genome Tifrunner.gnm1.KYV3 (Tifrunner.gnm1.KYV3 - data.legumeinfo.org>Arachis>hypogaea>genomes>Tifrunner.gnm1.KYV3).

[0008] In the second aspect of the present application, a KASP molecular marker primer combination for detecting peanut late leaf spot resistance is provided, comprising: a first KASP molecular marker primer group and a second KASP molecular marker primer group. The first KASP molecular marker primer group comprises: an allele-specific primer AlleleX-2-4 as shown in SEQ ID NO. 1, an allele-specific primer AlleleY-2-4 as shown in SEQ ID NO. 2, and a universal primer Primer_Common-2-4 as shown in SEQ ID NO. 3. The second KASP molecular marker primer group comprises: an allele-specific primer AlleleX-2-5 as shown in SEQ ID NO. 4, an allele-specific primer AlleleY-2-5 as shown in SEQ ID NO. 5, and a universal primer Primer_Common-2-5 as shown in SEQ ID NO. 6.

[0009] The first KASP molecular marker primer group is used for detecting the nucleotide polymorphism of SNP-2-4 site, and the second KASP molecular marker primer group is used for detecting the nucleotide polymorphism of SNP-2-5 site.

[0010] In the third aspect of the present application, the KASP molecular marker primer combination is applied in (1) or (2) as follows: (1) identifying or assisting in identifying peanut late leaf spot resistance; (2) peanut breeding.

[0011] In the above application, the peanut breeding is breeding of peanut varieties resistant to peanut late leaf spot.

[0012] In a fourth aspect, the present application provides a method for identifying or assisting in identifying peanut resistance to late leaf spot, comprising the following steps: detecting the genotype of the peanut to be tested based on specific SNPs, and determining the peanut resistance to late leaf spot according to the genotype, wherein the haplotype Hap_AG is higher than the haplotype Hap_GC .

[0013] The specific SNPs include SNP-2-4 and SNP-2-5; SNP-2-4 is the 1334356th nucleotide on chromosome 2 of the peanut genome, and the base polymorphism is G / A; SNP-2-5 is the 1653773th nucleotide on chromosome 2 of the peanut genome, and the base polymorphism is C / G.

[0014] In the above method, the haplotype Hap_AG refers to the nucleotide at SNP-2-4 site is A, and the nucleotide at SNP-2-5 site is G; the haplotype Hap_GC refers to the nucleotide at SNP-2-4 site is G, and the nucleotide at SNP-2-5 site is C.

[0015] Preferably, the KASP molecular marker primer combination is used to detect the genotype of the peanut to be tested based on specific SNPs.

[0016] In a fifth aspect, the present application provides a peanut breeding method for peanut resistance to late leaf spot, comprising the following steps: detecting the genotype of the peanut material based on specific SNPs, and selecting the peanut material with haplotype Hap_AG as a germplasm resource for peanut resistance to late leaf spot; The specific SNPs include SNP-2-4 and SNP-2-5; SNP-2-4 is the 1334356th nucleotide on chromosome 2 of the peanut genome, and the base polymorphism is G / A; SNP-2-5 is the 1653773th nucleotide on chromosome 2 of the peanut genome, and the base polymorphism is C / G.

[0017] The present application has the following advantages: (1) The molecular marker linked to the resistance to late leaf spot in the present application can be used to detect the genotype of peanut, and then determine whether the material has resistance to late leaf spot. Through high-throughput genotyping detection, the manpower and material resources can be greatly saved, the detection is not affected by environmental factors, the result is accurate and reliable, and it can be used for early screening of peanut varieties resistant to late leaf spot, which can shorten the breeding period and improve the breeding efficiency.

[0018] (2) The KASP molecular marker primer combination developed based on molecular markers SNP-2-4 and SNP-2-5 can be used for the selection of peanut germplasm resistant to late leaf spot, accurately perform genotyping of peanut late leaf spot traits, and can be applied to the screening of late leaf spot resistant germplasm to assist in peanut molecular breeding. Attached Figure Description

[0019] Figure 1 Disease susceptibility of Baisha 1016 and ICGV86699 120 days after sowing.

[0020] Figure 2 Major QTL for peanut late leaf spot resistance.

[0021] Figure 3 Genotyping results of KASP markers in 130 varietal lines.

[0022] Figure 4 : Hap_GC and Hap_AG Comparison of late spot disease severity between two haplotype cultivars. Detailed Implementation

[0023] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0024] As mentioned earlier, late leaf spot (LLS) is one of the foliar diseases that seriously affect peanut yield. Discovering genes and molecular markers related to peanut resistance to LLS is of great significance for high-yield and high-quality peanut breeding.

[0025] However, due to the large and complex structure of the peanut genome, coupled with the complex pathogenesis of peanut late leaf spot, the resistance mechanism has not yet been elucidated, and there are very few reported molecular markers related to peanut resistance to late leaf spot.

[0026] In view of this, the present invention constructs a RIL population, develops SNP markers closely linked to peanut late leaf spot resistance, and finally locates a major QTL interval related to peanut late leaf spot resistance on peanut chromosome 2, and screens two SNP markers closely linked to peanut late leaf spot resistance within this major QTL interval, namely SNP-2-4 and SNP-2-5.

[0027] Based on the newly discovered SNP-2-4 and SNP-2-5, the KASP molecular marker primer combination for detecting the two SNP markers is further developed for better use in actual production, and the KASP molecular marker primer combination can be used to accurately identify the resistance of peanut late leaf spot, and can be used for early screening of peanut late leaf spot resistant varieties.

[0028] In order to enable those skilled in the art to more clearly understand the technical solutions of the present application, the technical solutions of the present application will be described in detail below in combination with specific embodiments.

[0029] The test materials used in the embodiments of the present application are all conventional test materials in the art and can be purchased through commercial channels. The experimental methods without detailed conditions are carried out according to the conventional test methods or according to the operation instructions recommended by the suppliers.

[0030] Example 1: Development of KASP molecular markers SNP-2-4 and SNP-2-5 closely linked to peanut late leaf spot 1. Field investigation of late leaf spot resistance traits of RIL population The present application takes the recombinant inbred line (RIL) population containing 257 families obtained by hybridizing Baisha 1016 and ICGV86699 as the material, and is used for investigation of peanut late leaf spot resistance traits and marker development. The female parent Baisha 1016 is a susceptible peanut variety to late leaf spot, and the male parent ICGV86699 is a high-resistance germplasm to late leaf spot. Figure 1 ).

[0031] The RIL population was planted in the peanut disease plot field of the agronomy test station of Shandong Agricultural University in Tai'an, Shandong from 2018 to 2022, and in the experimental base of Xuzhou Academy of Agricultural Sciences in 2021, a total of 6 planting environments. Randomized block design was adopted, and two repetitions were set in the test. Each family was planted into a row of plants, and two seeds were planted in each hole with a hole distance of 20 cm. Disease grade identification was carried out at 120 days after peanut planting, and the disease grade of all materials of each family was investigated and counted, and the average was taken as the disease grade of the family. The field disease grade investigation method refers to the international 9-level investigation standard, and the peanut plant disease grade is judged according to the overall plant disease and the percentage of leaf necrosis area to the total area, and the grading standard is as follows: No disease spot is recorded as level 1; disease spot mainly appears on lower leaves, no leaf fall, 1% < necrotic leaf area < 10%, recorded as level 2; disease spot mainly appears on lower leaves, rarely on middle leaves, lower part of small leaves fall, 11% < necrotic leaf area < 20%, recorded as level 3; middle and lower leaves are all diseased, but lower leaves are more serious, lower part of small leaves fall, 21% < necrotic leaf area < 30%, recorded as level 4; middle and lower leaves are all diseased, lower leaf fall is more than 50%, 31% < necrotic leaf area < 40%, recorded as level 5; middle and lower leaves are all diseased, lower leaf fall is serious, middle part of small leaves fall, 41% < necrotic leaf area < 50%, recorded as level 6; all leaves are diseased, but upper leaves are lighter, lower leaves all fall, part of middle leaves fall, 51% < necrotic leaf area < 60%, recorded as level 7; middle and lower leaves all fall, upper leaves are seriously diseased, part of upper leaves fall, 61% < necrotic leaf area < 80%, recorded as level 8; almost all leaves fall, only a small amount of small leaves remain, 81% < necrotic leaf area < 100%, recorded as level 9.

[0032] The results of field investigation of resistance to late leaf spot of RIL population are shown in Table 1.

[0033] Table 1: Statistics of Baisha 1016 and ICGV86699 resistance phenotype to late leaf spot in multiple planting environments 2. Development of SNP markers closely linked to resistance to late leaf spot of peanut Genomic DNA of Baisha 1016, ICGV86699 and 257 RIL families was extracted from young leaves according to the operation manual of Tian Gen Plant DNA Extraction Kit. The extracted DNA was fragmented, purified and end-repaired, and then subjected to size selection and PCR amplification to construct a re-sequencing library with a fragment length ranging from 250 to 350 bp. Subsequently, high-throughput sequencing was performed on the Illumina HiSeq2500 platform using a 150 bp double-end sequencing strategy. The original sequences obtained by sequencing were filtered for quality control, and sequences containing adapters, sequences with N base content exceeding 10%, sequences with base quality value less than 10 accounting for more than 50%, and other low-quality sequences were removed, and finally effective sequences were obtained. Referring to the peanut cultivar Tifrunner genome (accessed at: https: / / www.peanutbase.org / peanut_genome / ), the effective sequences were aligned with the reference genome using BWA software. The MarkDuplicates function of the Picard tool was used to remove duplicate sequences to eliminate the effects of PCR amplification. Finally, SNP variation detection was performed by GATK software to identify SNP sites in the genome, and combined with the peanut late leaf spot resistance phenotype data of the RIL population, a major QTL related to peanut late leaf spot resistance was located on chromosome A02, located in the 0.04-2.31 Mb region of chromosome A02 Figure 2 ).

[0034] Specific evaluation of SNP sites in the major QTL interval of chromosome A02 was performed, and each SNP site and its upstream and downstream 100 bp sequences were selected, and Blast analysis was performed with reference to the peanut genome of cultivar Tifrunner to calculate the number of similar sequences in the genome (criteria: identity>83% and coverage>80%). In the major QTL interval of chromosome A02, 2 SNP sites with a genome copy number of 1 and different genotypes between parents were selected, named SNP-2-4 and SNP-2-5 (Table 2).

[0035] Table 2: qLLS.A02 2 SNP sites for developing KASP markers 3. Design PCR primers for detecting KASP markers: Design 2 pairs of allele-specific primers AlleleX-2-4, AlleleY-2-4 and AlleleX-2-5, AlleleY-2-5, and 2 pairs of common primers Primer_Common-2-4, Primer_Common-2-5 to detect the genotypes of different varieties of SNP-2-4 and SNP-2-5. The specific sequences are as follows: AlleleX-2-4: GAAGGTGACCAAGTTCATGCT ATGGACCAAAAATTGATATAGCTGTCA; (SEQ ID NO. 1) AlleleY-2-4: GAAGGTCGGAGTCAACGGATT GGACCAAAAATTGATATAGCTGTCG; (SEQ ID NO. 2) Primer_Common-2-4: ATCCATAATTGTGTTCCTCGTGAAAATATT. (SEQ ID NO. 3) AlleleX-2-5: GAAGGTGACCAAGTTCATGCT AATTAAATCGGATGCGAGCCAATTC; (SEQ ID NO. 4) AlleleY-2-5: GAAGGTCGGAGTCAACGGATT AATTAAATCGGATGCGAGCCAATTG; (SEQ ID NO. 5) Primer_Common-2-5: CCATGCTCAAAATTTCAAAAGGGGCTATA. (SEQ ID NO. 6) Note: The underlined part in the sequence is the fluorescent tag sequence, which is used for genotyping SNP sites by different fluorescent tags.

[0036] Example 2: Application of KASP markers linked to peanut late leaf spot resistance The KASP markers developed in Example 1 were successfully used to genotype 130 peanut variety and line materials from multiple breeding units in China, and the effectiveness of the markers was verified.

[0037] (1) Extraction of peanut leaf genomic DNA: The genomic DNA of 130 varieties and lines was extracted by the traditional CTAB method. The purity and concentration of the DNA samples were determined by spectrophotometry, A260 / 280: 1.8-2.2, 260 / 230 >= 2.0; the DNA was diluted to 100 ng / μL for standby use.

[0038] (2) KASP marker detection: KASP detection PCR reaction system: DNA: 0.8 μL, 2×Master mix: 0.4 μL, primers: 0.022 μL, H2O: 0.4 μL.

[0039] KASP PCR reaction procedure: 94℃ pre-denaturation for 15 mins; 94℃ denaturation for 10 s, gradient annealing from 61 to 55℃, gradient annealing for 60 s (decreasing by 0.6℃ per cycle), 10 cycles; 94℃ denaturation for 20 s, 55℃ annealing extension for 60 s, 26 cycles.

[0040] After the PCR reaction is completed, the PCR products are placed on the Omega fluorescence signal reader and Araya to convert the fluorescence signal into analyzable values. Then, the Kraken™ analysis software provided by LGC is used for genotyping.

[0041] (3) Correlation analysis between KASP marker typing and peanut late leaf spot resistance KASP marker testing accurately classified 130 peanut varieties into the following types: Hap_GC and Hap_AG Two haplotypes ( Figure 3 ); haplotype Hap_GC This refers to a haplotype where the nucleotide at SNP-2-4 is G and the nucleotide at SNP-2-5 is C. Hap_AG This means that the nucleotide at SNP-2-4 is A and the nucleotide at SNP-2-5 is G.

[0042] Late leaf spot disease severity was assessed for 130 peanut varieties and lines according to the international level 9 survey standard in Example 1. Among them, 108 materials had haplotypes of [missing information]. Hap_GC The average disease grade of late spot disease was 6.25; the haplotypes of the 22 materials were... Hap_ AG The average disease grade of late spot disease was 3.71. Hap_AG The resistance of this type of cultivar to late leaf spot disease is significantly higher than that of other varieties. Hap_GC type( Figure 4 The above results indicate that the identification results based on KASP marker typing are consistent with the actual resistance to peanut late leaf spot, and the results are accurate, reliable, and have practical application value.

[0043] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. The application of primers for detecting specific SNPs in identifying peanut late leaf spot resistance, characterized in that, The specific SNPs include SNP-2-4 and SNP-2-5; SNP-2-4 is nucleotide 1334356 on chromosome 2 of the peanut genome, with a base polymorphism of G / A; SNP-2-5 is nucleotide 1653773 on chromosome 2 of the peanut genome, with a base polymorphism of C / G.

2. The application according to claim 1, characterized in that, Peanuts with SNP-2-4 site A and SNP-2-5 site G have higher resistance to peanut late leaf spot than peanuts with SNP-2-4 site G and SNP-2-5 site C.

3. A KASP molecular marker primer combination for detecting peanut late leaf spot resistance, characterized in that, include: First KASP molecular marker primer set and second KASP molecular marker primer set; The first KASP molecular marker primer set includes: the allele-specific primer AlleleX-2-4 shown in SEQ ID NO.1, the allele-specific primer AlleleY-2-4 shown in SEQ ID NO.2, and the universal primer Primer_Common-2-4 shown in SEQ ID NO.3; The second KASP molecular marker primer set includes: the allele-specific primer AlleleX-2-5 shown in SEQ ID NO.4, the allele-specific primer AlleleY-2-5 shown in SEQ ID NO.5, and the universal primer Primer_Common-2-5 shown in SEQ ID NO.

6.

4. The use of the KASP molecular marker primer combination according to claim 3 in either (1) or (2) below: (1) To identify or assist in the identification of peanut late leaf spot resistance; (2) Flowering and breeding.

5. The application according to claim 4, characterized in that, The aforementioned peanut cultivar is a peanut variety bred to be resistant to peanut late leaf spot disease.

6. A method for identifying or assisting in the identification of peanut late leaf spot resistance, characterized in that, Includes the following steps: Genotyping of peanut samples based on specific SNPs was performed, and resistance to peanut late leaf spot disease was determined according to the genotyping. Haplotypes were identified as follows: Hap_AG The resistance of peanuts to late leaf spot is higher than that of haplotypes. Hap_GC Peanuts. The specific SNPs include SNP-2-4 and SNP-2-5; SNP-2-4 is nucleotide 1334356 on chromosome 2 of the peanut genome, with a base polymorphism of G / A; SNP-2-5 is nucleotide 1653773 on chromosome 2 of the peanut genome, with a base polymorphism of C / G.

7. The method according to claim 6, characterized in that, haplotype Hap_AG This refers to a haplotype where the nucleotide at SNP-2-4 is A and the nucleotide at SNP-2-5 is G. Hap_GC This means that the nucleotide at SNP-2-4 is G and the nucleotide at SNP-2-5 is C.

8. The method according to claim 6, characterized in that, The KASP molecular marker primer combination described in claim 3 was used to detect the genotyping of peanuts based on specific SNPs.

9. A peanut breeding method resistant to late leaf spot disease, characterized in that, Includes the following steps: Genotyping of peanut materials based on specific SNPs was performed, with haplotypes selected as... Hap_AG Peanut materials were used as germplasm resources resistant to peanut late leaf spot disease; The specific SNPs include SNP-2-4 and SNP-2-5; SNP-2-4 is nucleotide 1334356 on chromosome 2 of the peanut genome, with a base polymorphism of G / A; SNP-2-5 is nucleotide 1653773 on chromosome 2 of the peanut genome, with a base polymorphism of C / G.

Images