88 results about "Xanthomonas campestris" patented technology

The invention belongs to the field of gene engineering, and particularly relates to application of an XC3225 gene in increasing the yield of xanthomonas campestris pv. Campestris xanthan gum. The invention finds that the XC3225 gene has a negative regulation effect on the xanthan gum yield, and the xanthan gum yield is remarkably improved by inhibiting or knocking out the XC3225 gene in the genome of xanthomonas campestris pv. Campestris, so that a new gene resource is provided for xanthan gum preparation.

The invention discloses a salt-tolerant brevibacillus for promoting growth and preventing and controlling plant diseases and application of the salt-tolerant brevibacillus. The brevibacillus halotolerans T101 is preserved in the Guangdong Microbial Culture Collection Center (GDMCC) on July 23, 2025, and the preservation number of the brevibacillus halotolerans T101 is GDMCC No: 66731. The brevibacillus halotolerans T101 is preserved in the Guangdong Microbial Culture Collection Center (GDMCC) on July 23, 2025. The strain T101 disclosed by the invention can effectively antagonize plant pathogenic fungi peronophythora litchii and plant pathogenic bacteria such as pseudomonas syringae, xanthomonas campestris, citrus canker pathogen and ralstonia solanacearum, can generate siderophores and plant growth hormone IAA, and can remarkably promote the growth of tomato root systems in a pot experiment. Therefore, the strain T101 can be used for preparing microbial preparation products for preventing and treating plant diseases and promoting plant root growth, and has important application potential in the aspects of microbial agents, biological fertilizers and the like for promoting plant growth and development.

Xanthomonas campestris for fermentative production of transparent xanthan gum and a method for using Xanthomonas campestris are provided. The Xanthomonas campestris is Xanthomonas campestris F417-6, deposited in Guangdong Province Microbiological Culture Collection Center on May 12, 2023, with a deposit number of GDMCC NO: 63459. The method includes preparing xanthan gum by performing fermentation using the Xanthomonas campestris as a fermentation strain.

The invention provides a pseudoxanthomonas wenibertii strain TY3-10 and application thereof in preparation of rare ginsenoside, and belongs to the technical field of biological medicine. The preservation number of the pseudoxanthomonas wenibertii strain TY3-10 disclosed by the invention is CGMCC (China General Microbiological Culture Collection Center) No.35238. The pseudoxanthomonas wenibertii The strain TY3-10 has the characteristic of producing beta-glucosidase and beta-xylosidase, and can be used for converting various ginsenosides and notoginsenoside into rare ginsenosides F2, Rd2, Fd, C-Mc1 and Rh1. The invention further provides a method for preparing the rare ginsenoside, and ginsenoside is subjected to a conversion reaction under the action of the pseudoxanthomonas wenibertii strain TY3-10 to obtain the rare ginsenoside. The invention provides a new process for preparing the rare ginsenoside, and has a wide application prospect.

The invention discloses a low pyruvic acid xanthan gum production strain and application, and relates to the technical field of biology, the xanthan gum production strain is Xanthomonas campestris L1, and is preserved in the Guangdong Microbial Culture Collection Center on February 20, 2025, the preservation number is GDMCC NO: 65931, and the preservation address is No.59 building, No.100 Courtyard, Xianlie Middle Road, Guangzhou. The Xanthomonas campestris L1 provided by the invention is used as a fermentation strain to produce xanthan gum, the content of pyruvic acid is lower than 1.2% and is obviously lower than that of non-mutagenic Xanthomonas campestris, and the xanthan gum production capacity of the Xanthomonas campestris L1 is still the same as that of the non-mutagenic Xanthomonas campestris.

The invention discloses recombinant xanthomonas campestris with xanthan gum hydrolase displayed on the surface and a construction method and application of the recombinant xanthomonas campestris. The recombinant xanthomonas campestris for surface display of xanthan hydrolase is constructed by introducing a recombinant vector obtained by fusion expression of an ice crystal nuclein (INP) gene and a xanthan hydrolase gene into xanthomonas campestris. The gel yield of recombinant xanthomonas campestris fermentation is twice that of a wild strain and reaches 6.7 g / L. The strain can efficiently hydrolyze xanthan gum with high molecular weight (such as more than 100 wDa), the traditional production process which is relatively complicated is simplified, and a new method is provided for large-scale production of the xanthan gum with low molecular weight.

The present invention relates to a composite microbial agent and its use in the remediation or management of chlorinated hydrocarbon contaminated sites. The composite microbial agent comprises composite microorganisms, wherein the composite microorganisms include Gordonia, Pseudomonas, Pseudomonas, and Terrestria in a viable cell count ratio of 100:(25-600):(10-900):(10-500). The present invention effectively addresses the difficulty in remediating chlorinated hydrocarbon contaminated sites, overcomes the problems of low mass transfer efficiency and limited microbial activity of traditional remediation technologies, and improves the efficiency of remediation and risk management of chlorinated hydrocarbon contaminated sites. The agent is particularly suitable for green and efficient remediation of soil and groundwater in silty soil sites, pollution source reduction, and risk management. Furthermore, the agent offers advantages such as low cost and ease of operation, and thus has significant application prospects.

The invention discloses leuconostoc mesenteroides a3 antagonizing xanthomonas oryzae and application of the leuconostoc mesenteroides a3, and belongs to the technical field of microorganisms. The leuconostoc mesenteroides a3 is preserved in the China Center for Type Culture Collection on April 7, 2025, the preservation number of the strain is CCTCC No: M 2025646, and the leuconostoc mesenteroides a3 has high antagonistic activity on rice bacterial leaf blight germs and rice bacterial leaf streak germs. The biocontrol microbial inoculum prepared from the strain has a good biocontrol effect on rice bacterial leaf blight and rice bacterial leaf streak, the use of chemical pesticides can be reduced, the safety of grains and the ecological environment can be improved, and good economic and social benefits can be brought.

The invention relates to the technical field of microorganisms, and discloses efficient detoxification of a strain of pseudoxanthomonas to ochratoxin A and application of the strain of pseudoxanthomonas to the ochratoxin A. A strain of OTA efficient detoxification strain pseudoxanthomonas X-22 is screened out, and the pseudoxanthomonas X-22 can reduce 50 mu g / mL of OTA (10000 times of the national standard) to 0 within 70 min. The strain is mainly used for performing biological detoxification on OTA through intracellular enzyme, and a detoxification product is OTalpha with extremely low toxicity. The optimal growth conditions of the pseudoxanthomonas X-22 are as follows: 1.5 wt% of glucose is added into a basic culture medium as a carbon source, 1.5 wt% of yeast extract is added into the basic culture medium as a nitrogen source, the pH value of the culture medium is adjusted to 7.5, and the culture temperature is 37 DEG C. The OTA detoxification strain pseudoxanthomonas X-22 is applied to fermentation detoxification of polluted corn and oat, the detoxification rates of the corn and the oat are 61.29% and 97.26% respectively, OTA detoxification strain resources are enriched, and a theoretical basis is provided for application of a biological detoxification technology in the corn and the oat.

The invention discloses a strain of parateratomycosis aveosphaeroides and application thereof, and belongs to the technical field of microorganism and biological prevention and control. In order to screen new species of fungi and provide alternative strains for application of plant beneficial bacteria in agriculture, a fungus SGSF1293 is separated, and the fungus SGSF1293 is identified to be a new species of the cystis clavatum and is named as the parateratosis aveoensis, and the new species of the cystis clavatum is named as the parateratosis aveoensis. According to the present invention, the activity research results show that the strain SGSF1293 has rice root-knot nematode killing activity, plant pathogen resistance (Brassica oleracea black rot xanthomonas, Pseudomonas syringae, Ralstonia solanacearum and Fusarium oxysporum) resistance, oxidation resistance and phosphorus solubilizing activity; besides, the secondary metabolite of the strain is separated and identified, two active compounds, namely, wintergreen ambrotic acid and brefeldin A, are separated, and the wintergreen ambrotic acid has the activity of killing rice root-knot nematode. The discovery of the strain SGSF1293 and the active metabolite thereof has certain application value in the agricultural fields of plant disease control and the like.

The present invention provides a new bacteriophage with SEQ ID No.: 1 against Xanthomonas campestris and / or Xanthomonas citri infections and use of same for treating and / or preventing a Xanthomonas campestris and / or Xanthomonas citri infection in a crop.

The present application relates to a kind of parabacillus (Bacillus paralicheniformis) Bacillus paralicheniformis ) HMF14, the preservation number is CGMCC No.30480.The parabacillus HMF14 of the present application can resist salt and alkali, can simultaneously antagonize fusarium oxysporum, microdochium nivale var. avenae and xanthomonas campestris pv. tridii, also has toxic effect to pratylenchus penetrans and tetranychus cinnabarinus, can effectively prevent and treat wheat take-all disease and wheat black foot disease.

The present invention belongs to the technical field of germ detection, and discloses a primer for detecting Xanthomonas fragariae. The forward primer sequence of the primer pair is: The forward primer sequence of the primer pair is: 5′ ‑ GTATGTGAATTTCCGGTCATTCTGCCCACT‑ 3′; the reverse primer sequence is: 5′ ‑CACTTGCCGACAACACCTTTGCCATAGAG‑ 3′. The primer of the present invention has good specificity and does not cross-react with other fungi and bacteria. The kit composed of this primer can complete the on-site detection of Xanthomonas fragariae within 30 minutes, with a short detection time, low detection cost, and can be operated without professional personnel, and can be widely promoted at the grass-roots level.

The invention belongs to the technical field of genetic engineering, and particularly relates to application of a negative regulation XC1141 gene in improving the yield of xanthan gum produced by xanthomonas campestris var. Campestris. According to the invention, an Xcc 8004 genome is subjected to knockout modification, and a gene XC1141 in the Xcc 8004 genome is deleted, so that an Xcc 8004 mutant strain (mutant strain Xcc 1141) with high yield of xanthan gum is obtained; the xanthan gum yield of the obtained Xcc 8004 mutant strain can reach 9.11 g / L, and the yield is increased by 65% compared with that of wild fungus Xcc 8004 (5.52 g / L).

The invention provides a carpet grass xanthomonas phage, a compound phage preparation and application of the carpet grass xanthomonas phage and the compound phage preparation. The carpet grass xanthomonas phage is carpet grass xanthomonas phage XAC17P1, and the preservation number is CCTCC (China Center for Type Culture Collection) NO: M 20241062. The compound bacteriophage preparation provided by the invention has higher sterilization efficiency and better application stability, belongs to a green and efficient plant disease biological prevention and control means, and can effectively prevent and treat citrus canker.

The invention relates to a compound microbial agent and application thereof in repairing or controlling chlorinated hydrocarbon contaminated sites, the compound microbial agent comprises compound microorganisms, and the compound microorganisms comprise Gordonia, pseudomonas, pseudoxanthomonas and geomonas in a viable count ratio of 100: (25-600): (10-900): (10-500). The method effectively solves the problem that the chlorohydrocarbon contaminated site is difficult to repair, overcomes the problems of low mass transfer efficiency, limited microbial activity and the like of the traditional repair technology, improves the repair and risk management and control efficiency of the chlorohydrocarbon contaminated site, and reduces the construction cost. The method is especially suitable for green and efficient remediation of soil and underground water in silt soil sites, pollution source reduction and risk management and control, has the advantages of low cost, convenience in operation and the like, and has important application prospects.

The invention belongs to the technical field of biological environmental protection, and discloses Pseudoxanthomonas suwangensis NS44, a microbial agent and application of the Pseudoxanthomonas suwangensis NS44, the Pseudoxanthomonas suwangensis NS44 is preserved in the China General Microbiological Culture Collection Center (CGMCC), the preservation number is CGMCC No.35937, the preservation date is September 16, 2025, and the preservation number is CGMCC No.35937. The preservation address is Institute of Microbiology, Chinese Academy of Sciences, No.3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The pseudoxanthomonas suwangensis NS44 has the effects of efficiently degrading cellulose, synthesizing IAA and dissolving organic and inorganic phosphorus. The cellulose degrading bacterial agent prepared by the invention is applied to the process of mixing and composting corn straws and pig manure in different proportions, so that the temperature of a compost body can reach more than 55 DEG C faster and lasts for a long time, the degradation of corn straw cellulose and hemicellulose is remarkably improved, insoluble phosphorus in the compost body is synchronously converted into effective nutrients, and the compost quality is improved.

The invention discloses a lyase preparation for preventing and treating rice bacterial blight and a preparation method and application thereof, and relates to the technical field of agricultural biology.The lyase preparation comprises one or more of lyase LysXO1 of xanthomonas phage GRNXOP1, lyase LysXO5 of xanthomonas phage GRNXOP5 and lyase LysXO6 of xanthomonas phage GRNXOP6; wherein the amino acid sequence of the LysXO1 is as shown in SEQ ID NO. 1; the amino acid sequence of the LysXO5 is as shown in SEQ ID NO. 2; and the amino acid sequence of the LysXO6 is as shown in SEQ ID NO. 3. The lyase preparation provided by the invention has the advantages of being efficient in sterilization, safe to use, environment-friendly and the like, and a novel effective solution is provided for green prevention and control of rice bacterial blight.

The application provides a composite microbial agent for decomposing soil insoluble phosphorus and an application thereof, and relates to the technical field of microorganisms. Active ingredients of the composite microbial agent include Xanthomonas campestris, Burkholderia cenocepacia and Burkholderia parafungorum. The three strains have the ability to dissolve Ca3(PO4)2, FePO4, AlPO4, lecithin and calcium phytate, and can synergistically dissolve the above-mentioned five kinds of insoluble phosphorus sources. The phosphorus solubilizing activity of the composite microbial agent after oscillation culture can reach 53.32 mg·L ‑1 , and the phosphorus solubilizing function is stable. Meanwhile, the composite microbial agent has the characteristics of degrading lignin, producing siderophores and indole acetic acid. When applied to the rhizosphere soil of plants, the composite microbial agent has a significant phosphorus solubilizing and growth promoting effect, and solves the technical problems of single type of phosphorus source dissolved by the phosphorus solubilizing bacteria in the prior art or poor stability of the phosphorus solubilizing function.

The application discloses a preparation method and application of an indole oxadiazole aryl thiourea derivative, and has the structure shown in the following general formula: The compound has a good inhibiting effect on pathogenic bacteria, and has a good inhibiting effect on pathogenic bacteria such as Xanthomonas campestris, Pseudomonas syringae pv. tabaci, Pseudomonas syringae pv. lachrymans, Pseudomonas syringae pv. mori, Xanthomonas axonopodis pv. citri, Xanthomonas axonopodis pv. viticola, Xanthomonas axonopodis pv. vesicatoria, Xanthomonas axonopodis pv. actinidiae, Xanthomonas axonopodis pv. apodrecedens, Botrytis cinerea, Fusarium oxysporum f. sp. cubense, Sclerotinia sclerotiorum, Gibberella zeae, Phytophthora infestans, Monilinia fructicola, and the like, and provides an important scientific basis for research and development of new pesticides.

The present application provides a kind of compound biocontrol agent and its preparation method and application technology, and it is composed of 1000ml of fermentation mixed liquor of multiple strains of biocontrol bacteria mixed in equal volume ratio and 0.5%-1.5% stabilizer with complementary mechanism and target.The fermentation concentrated solution of multiple strains of bacteria is prepared in fermentation medium to obtain the present application, which is used for preventing and controlling fusarium, pythium, phytophthora, rhizoctonia solani, ralstonia solanacearum, erwinia carotovora, streptomyces scabiei, xanthomonas campestris and other plant pathogenic bacteria and nematodes, which can inhabit in soil for a long time and spread through soil, and one or several of them can cause plant soil-borne diseases.The preparation process of the present application is not affected by too many chemical and physical factors, the activity of live bacteria and metabolites is high, the average control effect is 78%-85%, the application effect is good;The production process is simple, energy and auxiliary materials are saved, and the production cost is low.

The present application relates to a kind of 1,2,3-triazole-biotin molecular probe and its preparation and application, the molecular probe has the structure shown in formula I:It has very strong inhibitory effect (EC 50 =10.37 μg / mL) to Xanthomonas campestris pv.Mangiferae, can be used for mango preservation and antiseptic, while still can be used to detect the difference protein of probe and Xanthomonas campestris pv.Mangiferae protein interaction, provides theoretical guidance for further study its mechanism of action on Xanthomonas campestris pv.Mangiferae.

The invention relates to the technical field of gene engineering, in particular to a bidirectional promoter Para *, an araa * expression system, application and an engineering strain. The araa * expression system comprises the bidirectional promoter Para *, a repressor protein araR gene module is arranged on one side of the bidirectional promoter Para *, and a fluorescent protein gene module is arranged on the other side of the bidirectional promoter Para *. Wherein the repressor protein araR gene module comprises a repressor protein araR gene and a first RBS sequence corresponding to the repressor protein araR gene; and the fluorescent protein gene module comprises a fluorescent protein gene and a second RBS sequence corresponding to the fluorescent protein gene. By characterizing and designing an exogenous inducible promoter, an ara * expression system capable of realizing inducible expression in xanthomonas campestris is obtained, and a basic element is provided for construction of a xanthomonas campestris genetic engineering strain.

This invention belongs to the field of genetic engineering and biotechnology, specifically relating to a β-glucosidase PO3 for the conversion of rare ginsenosides, its preparation method, and its applications. This invention obtains β-glucosidase PO3 by PCR amplification using genomic DNA of *Xanthomonas pseudoepiplo* TY3-10 as a template. The results of the examples show that this enzyme can not only convert total ginsenosides into rare ginsenosides F2, C-O, C-Mx1, and C-Mc1, but also convert ginsenoside Rb1 into F2, ginsenoside Rb2 into C-O, ginsenoside Rb3 into C-Mx1, and ginsenoside Rc into C-Mc1; it also exhibits excellent catalytic performance and high expression efficiency, possessing extremely high application value and commercial prospects.

The application provides a refreshing appetizing phyllanthus emblica honey compound beverage and a preparation method thereof, and belongs to the technical field of fruit juice beverages. According to mass percentages, the phyllanthus emblica compound beverage comprises 8-12% fructose syrup, 3-8% white granulated sugar, 15-25% phyllanthus emblica hydrolate fermentation liquor, 25-35% phyllanthus emblica original juice, 1-3% jujube flower honey, 2-4% honey, 0.6-1% citric acid monohydrate and 0.3-0.8% sodium citrate; wherein the phyllanthus emblica hydrolate fermentation liquor is prepared by mixing fermentation of Kluyveromyces marxianus and Xanthomonas campestris after phyllanthus emblica peel extraction. The phyllanthus emblica compound beverage prepared by the application not only retains the original aroma and nutritional substances of phyllanthus emblica, but also effectively reduces the bitterness, thereby providing a new idea for fruit juice beverages.

The invention relates to an isolated bacteriophage deposited under the accession number DSM 34666 at the German Collection of Microorganisms and Cell Cultures (Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ); Inhoffenstraße 7B, 38124 Braunschweig, Science Campus Braunschweig-Süd, Germany) on May 25, 2023; or a derivative, variant or mutant thereof, the genomic sequence of which is at least 95% identical to the sequence of SEQ ID NO: 1. Preferably, the bacteriophage is capable of killing the bacterium Xanthomonas arboricola pv. juglandis.. The invention also relates to a composition comprising the bacteriophage. The invention also relates to the use of the bacteriophage or the composition comprising the bacteriophage on a plant for the prevention or treatment of a bacterial infection caused by Xanthomonas arboricola pv. juglandis.

The present invention relates to the application of polyether compounds as fungicides in controlling plant diseases caused by Xanthomonas, specifically, the polyether compounds are one or more of nigericin, lasalocid and nanchangmycin, which have a stronger inhibitory effect on Xanthomonas than the currently commonly used commercial drugs bismerthiazol and thiodiazole copper, and have good development prospects.

The present invention relates to an oral dietary composition comprising a combination of three edible ingredients of (i) an extract from the seeds of carob, preferably carob gum, (ii) a polysaccharide from xanthomonas campestris, preferably xanthan gum, and (iii) an extract from cactus of the genus cactus, more specifically, a dietary composition comprising a combination of three edible ingredients of (i) an extract from the seeds of carob, preferably carob gum, (ii) a polysaccharide from xanthomonas campestris, preferably xanthan gum, and (iii) an extract from cactus of the genus cactus. An extract of one or more leafy stems from the species opuntia ficus-indica.

The invention relates to the use of a lytic bacteriophage, stabilised in a carrier, of the family Myoviridae, Foxunavirus genus (deposit IDAC 261122-01), which acts as a biocontroller of Xanthomonas campestris pv. Campestris (Xcc), a phytopathogen responsible for the main disease affecting brassicas globally, angular leaf spot or black rot. In addition, the invention relates to the preparation of a bioproduct comprising the phage and an agronomically acceptable carrier, such as alginate and / or chitosan.

The invention discloses a salt-tolerant nitrogen-fixing Klebsiella pasteurii and application thereof, and relates to the technical field of microorganisms, and the Klebsiella pasteurii S8812 provided by the invention is a salt-tolerant combined nitrogen-fixing bacterial strain which is screened from corn roots and has outstanding comprehensive performance; the strain is preserved in the China General Microbiological Culture Collection Center (CGMCC) on March 21, 2025, and the preservation number of the strain is CGMCC No: 33923. The strain is high in nitrogen fixation activity, strong in salt resistance and capable of tolerating a culture medium environment with the NaCl concentration as high as 7%. Meanwhile, the strain also has the functions of dissolving organic phosphorus, dissolving potassium, producing amylase, producing ammonia, producing siderophore, producing auxin and the like. Greenhouse pot experiments show that the strain has a growth promoting effect on various crops such as wheat and corn, and the plant height, stem length, fresh weight and the like of plants can be remarkably improved. In addition, the strain has a good inhibition effect on rhizoctonia solani, pectobacterium and xanthomonas oryzae.