Patents
Literature
PatSnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

128 results about "Erwinia" patented technology

Erwinia is a genus of Enterobacterales bacteria containing mostly plant pathogenic species which was named for the famous plant pathologist, Erwin Frink Smith. It contains Gram-negative bacteria related to Escherichia coli, Shigella, Salmonella, and Yersinia. They are primarily rod-shaped bacteria.

Bacillusamyloliquefaciens subsp Lh-1 and application thereof

The invention relates to the field of microbial control, in particular to bacillusamyloliquefaciens subsp Lh-1 and application thereof. With a preservation number of CGMCC No.8548, the bacillusamyloliquefaciens subsp Lh-1 is applied in control of Verticillium dahliae, erwinia carotovora, ralstonia solanacearum, valsa leucostoma, Valsa Mali Miyabe et Yamada, Phytophthora capsici and phytophthora infestans. According to the invention, the bacillusamyloliquefaciens subsp Lh-1 and pesticide and chitosan oligosaccharide with dual effects of fertilizer and pesticide are combined into an Lh-1 microecological agent, the viable count is small, the dosage is small, the production process is simple, the cost is low, and the Lh-1 microecological agent has the dual functions of disease prevention and growth promotion. Nursery test proves that reduce the disease incidence of crop is reduced, especially for control of Verticillium dahliae, the disease incidence drops to 6%, and the control effect is significant. In addition, the Lh-1 microecological agent is a biological strain preparation, is completely free of a series of problems caused by use of chemical pesticides, thus being conducive to pollution-free production of crops, and farmers can have no need for pesticide or reduce the dosage of chemical pesticide, thus greatly saving the expenditure.
Owner:AGRI BIOTECH RES CENT OF SHANXI PROVINCE

Chemical and biological agents for the control of molluscs

Compositions and methods for controlling molluscs, members of the Gastropoda and Bivalvia classes which includes but is not limited to lactones, lactams, carbamates, amides, and / or carboxylic acid containing compounds as active ingredients and / or compounds derived from Pseudomonas and / or Erwinia. Also provided are methods and compositions for increasing the efficacy of chemical and biological control for invasive molluscs in open waters, power plants, and drinking water treatment facilities under coldwater conditions.
Owner:POINT FINANCIAL

Industrial fermentation ramee rapid extraction technique for Erwinia

ActiveCN101235357AReduce technical difficultyImprove activation process parametersBacteriaMutant preparationAnimal ForagingHigh pressure
The invention discloses a technique for rapidly extracting ramie hemp erwinia bacterium factory production fermentation, the technique comprises preprocessing material, immersing or sprinkling and inoculating, immersing or fermenting, deactivating with hot water, and the procedure of circulation washing, water dressing and fiber finish, erwinia bacterium which has broad-spectrum and high effective to degumming, pulping and saccharifying of herb fiber material, and bacterial agent preparation and activated technical parameter. The erwinia bacterium addicts the mannose, the peak for secreting non-cellulose to degrade key enzyme (pectic enzyme, beta-mannase and xylanase) can be achieved through purely culturing for 7h to 9h. Bacterial agent is inoculated on herb fiber material such as ramie and the like for activating the bacterial agent for 5h-6h, fermentation forage fodder turns to blue after fermenting for 5h-6h, pectine, hemicellulose and partial lignin which are partially degraded and associated in fiber cell are stripped, non-cellulose residues which are absorbed on fiber can be removed by means of the flushing of high-pressure flushing, and the purpose of extracting net fiber can be reached.
Owner:INST OF BAST FIBER CROPS CHINESE ACADEMY OF AGRI SCI

Bacillus amyloliquefaciens D2WM as well as preparation method and application of bacillus amyloliquefaciens D2WM

The invention discloses a bacillus amyloliquefaciens D2WM as well as a preparation method and application of bacillus amyloliquefaciens D2WM. The bacillus amyloliquefaciens D2WM comprises the steps of A, bacillus separation and purification, namely collecting after inoculating a slope; B, preliminary screening of bacillus, namely sequentially selecting strains having antagonistic effects on Erwinia and camellia oleifera diseases by using a point connection method and a plate confrontation method; and C, secondary screening of bacillus, namely culturing the preliminarily-screened strains with the antagonistic effects in an LB liquid culture medium by using a cup-plate method, and screening the strains simultaneously having the antagonistic effects on main diseases of Erwinia and camellia oleifera through an antagonistic bacterium fermentation liquid and sterile filtrate. When being applied to preparation of drugs for treating or preventing soft rot of vegetables and camellia oleifera diseases, the bacillus amyloliquefaciens has a broad-spectrum antagonistic effect, high in growth speed, capable of efficiently antagonizing anthracnose of camellia oleifera, leaf spot diseases of camellia oleifera, black spot of camellia oleifera, canker of camellia oleifera and various diseases and remarkable in antibacterial effect, the culture time for general bacteria and fungi is greatly shortened, and the production cost is reduced.
Owner:HUBEI ENG UNIV

Chemical and biological agents for the control of molluscs

Compositions and methods for controlling molluscs, members of the Gastropoda and Bivalvia classes which includes but is not limited to lactones, lactams, carbamates, amides, and / or carboxylic acid containing compounds as active ingredients and / or compounds derived from Pseudomonas and / or Erwinia. Also provided are methods and compositions for increasing the efficacy of chemical and biological control for invasive molluscs in open waters, power plants, and drinking water treatment facilities under coldwater conditions.
Owner:MARRONE BIO INNOVATIONS

Hypersensitive response elicitor fragments eliciting a hypersensitive response and uses thereof

Isolated fragments of an Erwinia hypersensitive response elicitor protein or polypeptide that elicit a hypersensitive response in plants and isolated DNA molecules that encode those fragments are disclosed. Isolated fragments of hypersensitive response elicitor proteins or polypeptides, which elicit a hypersensitive response, and the isolated DNA molecules that encode them can be used to impart disease resistance to plants, to enhance plant growth, and / or to control insects on plants, either by applying the hypersensitive response eliciting fragments to plants or plant seeds or by providing transgenic plants or plant seeds transformed with a DNA molecule encoding a hypersensitive response eliciting fragment.
Owner:CORNELL RES FOUNDATION INC +1

L-glutamic acid producing bacterium and a method for producing l-glutamic acid

The present invention describes an L-glutamic acid-producing bacterium which belongs to the genus Pantoea, Enterobacter, Klebsiella or Erwinia, wherein the bacterium has been modified by gene recombination to inactivate the rpoS gene. A method is also described for culturing the bacterium in a medium to cause accumulation of L-glutamic acid in the medium, and collecting L-glutamic acid from the medium.
Owner:AJINOMOTO CO INC

Method for producing an organic acid

An organic acid is produced by allowing a bacterium belonging to the family Enterobacteriaceae, which has an ability to produce an organic acid and has been modified so that the phosphoenolpyruvate carboxykinase activity is enhanced, which is selected from Enterobacter, Pantoea, Erwinia, Klebsiella and Raoultella bacteria, or a product obtained by processing the bacterium, to act on an organic raw material in a reaction mixture containing carbonate ions, bicarbonate ions, or carbon dioxide gas to produce the organic acid, and collecting the organic acid.
Owner:AJINOMOTO CO INC

Bacillus velezensis having various disease preventive effects, application thereof and biocontrol inoculant

The invention relates to bacillus velezensis having various disease preventive effects, application thereof and a biocontrol inoculant and belongs to the technical field of plant disease and pest prevention and control. Bacillus velezensis MS012 having bacteriostatic activity is obtained by separating and screening from healthy branches of malus sieversii. Bacillus amyloliquefaciens has remarkableantagonistic effect on botryosphaeria dothidea, colletotrichum gloeosporioides, phomopsis mali, rhizoctonia cerealis, gaeumannomyces graminis, botrytis cinerea, fusarium graminerum, clivia stem basaldecay pathogen, nandina anthrax pathogen and erwinia amylovora and has broad spectra in bacteriostatic object, and a new microbial resource is provided for biocontrol on disease and pest of plants like apple trees.
Owner:HENAN UNIV OF SCI & TECH

Multiple intermolecular rapid detection method for banana wilt bacteria and bacterial Erwinia carotovora

ActiveCN103789443AAvoid spreadingFast and accurate multiple detection technologyMicrobiological testing/measurementDNA/RNA fragmentationHyphaErwinia
The invention discloses a multiple intermolecular rapid detection method for banana wilt bacteria and bacterial Erwinia carotovora. The invention provides a group of specific primers, No.1 and No.4 physiological races of the banana wilt bacteria, and bacterial Erwinia carotovora can be simultaneously detected in a one-step PCR (Polymerase Chain Reaction) amplified reaction. When a 636bp stripe presents in the PCR product, the sample contains FOC1; when a 796bp stripe presents in the PCR product, the sample contains FOC4; when a 218bp stripe presents in the PCR product, the sample contains the bacterial Erwinia carotovora. The method is easy to operate, low in time consumption and high in detection sensitivity. The sensitivity of detecting the banana wilt bacteria mycelium can be 1 mu g, and the sensitivity of detecting the bacterial Erwinia carotovora can be 10<3>CFU / ml. The method can be applied to detection of banana disease tissues, pathogenic bacteria which are directly separated or soil and has the advantages of high accuracy and the like, diffusion and spread of the banana wilt disease and bacterial Erwinia carotovora can be avoided, and safety production of bananas is guaranteed.
Owner:广东粤科植保农业科技有限公司

Method for promoting orchid to grow and preventing diseases

ActiveCN103875717APromote growthProlonged Flowering SynergyBiocidePlant growth regulatorsDiseasePlant disease
The invention discloses a method for promoting orchid to grow and preventing diseases, and relates to a method for preventing the diseases and promoting orchid branches to grow and prolonging a flowering phase. The method disclosed by the invention comprises the following steps of uniformly mixing a solid state culture and a culture medium into a basin according to the mass ratio of 1 to 50 in orchid plant transplantation, wherein the solid state culture has the spore concentration s 1*10<7>-1*10<8> spore / g and prepared from Trichoderma harzianum T216, and planting an orchid plant, wherein the solid state culture can induce the resistance of the orchid plant to the fungoid diseases such as southern blight, rhizoctonia solani and anthracnose and bacterial soft rot caused by Erwinia carotovara during orchid growth, the plant morbidity is reduced, the disease index is reduced, the orchid is promoted to grow in advance, and the number of blades of the orchid are increased. In addition, the method disclosed by the invention has the advantages that a liquid state culture of the Trichoderma harzianum T216 is regulated into 1*10<5>-1*10<7> spore / mL when the orchid peeps a bud, and the spray treatment is carried out on the orchid plant, so that the branch number of the orchid is increased, and the flowering phase of the orchid is prolonged.
Owner:HUNAN PLANT PROTECTION INST

Control of Erwinia amylovora in plants

The invention relates to the control of fireblight (Erwinia amylovora) in plants by application of acylcyclohexadiones to plants susceptible to fireblight to reduce or prevent the infestation and disease caused by Erwinia amylovora. Specific compounds suitable for use in practicing the invention include prohexadione calcium and trinexapac ethyl. Included in the invention are compounds from the formula: and compounds of the formula and the metal or ammonium salts thereof.
Owner:BASF CORP

Method and apparatus for growing sprouts

Provided are methods for growing and shipping sprouts and microgreens in the same container, growing while in shipment using moisture provided in a water-absorbent layer, with optional added beneficials, and including methods for producing sprouts and microgreens for consumption, and for pharmaceutical / nutriceutical use, comprising growth of sprouts in retail-ready containers, the container comprising a moisture-retaining layer of agar media or the like providing water for growth and obviating the need for irrigation during sprout growth. In certain aspects, media is supplemented with beneficial organisms or additives such as probiotic microbes, vitamins (e.g., B12), cofactors, nutrients, and other items (e.g., phytochemicals, natural colors, and antioxidants) which promote the growth of the beneficial microbes on the product, and / or which become incorporated into the product. In certain aspects, added beneficial microorganisms are selected to compete antagonize human pathogens such as Listeria, Salmonella, enterohaemorrhagic E. coli, Yersinia, and / or spoilage organisms (e.g., Erwinia, Pseudomonas and Xanthomonas).
Owner:INST FOR ENVIRONMENTAL HEALTH

Application of methylmalonic acid in preparation of nematode pesticide

The invention relates to the technical field of agricultural microbiology, and specifically relates to an application of methylmalonic acid in preparation of a nematode pesticide. Through determination of the fatality rate of meloidogyne incognita and caenorhabditis elegans, it finds that the methylmalonic acid has a good insecticidal effect on nematodes; LC50 of the methylmalonic acid to the meloidogyne incognita and the caenorhabditis elegans is separately 13.11 and 1.20; and after the methylmalonic acid and betaine are compounded, the LC50 of the methylmalonic acid to the meloidogyne incognita and the caenorhabditis elegans is separately 2.85 and 0.27; and at the same time, the methylmalonic acid has an inhibition effect on ralstonia solanacearum and erwinia carotovora. The preparationprovides new selectivity for the preparation of biocontrol preparations of meloidogyne.
Owner:HUBEI BIOPESTICIDE ENG RES CENT

Calla lily germplasm resources in vitro conservation method

The invention discloses an in vitro conservation method of a color calla idioplasm resource, pertaining to the vegetable idioplasm resource conservation and tissue cultivation technical field. The method comprises such steps as preparation of a culture medium, disinfection of an explant and inoculation and induction culture, multiplication culture, root culture, a corm intumescence culture, idioplasm conservation culture, restore culture, and the detection and utilization of genetic stability, etc. The method adopts the meristem tissue of a 0.5mm stem tip of the color calla as the explant, a large quantity of elements in the culture medium are reduced and mannitol and penicillin are added, and a protocorm seedling is conserved at 10 to 15 DEG C under the surroundings of light intensity of 1000Lx for 10h / d, and after 15 months, the contamination of Erwinia is eliminated, the survival rate reaches 100 percent; the growth and multiplication are still normal without genetic variation. The method of the invention is characterized by low cost and simple operation etc., and can be popularized and applied in the idioplasm conservation field of the color calla.
Owner:ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES

Erwinia carotovora pv. Carotovora strain Ecc 36, plant immune activator protein secreted by same and application of plant immune activator protein

ActiveCN106867929AInhibition of soft rot diseaseAvoid residueBiocideBacteriaBiotechnologyErwinia
The invention discloses an Erwinia carotovora pv. Carotovora strain Ecc 36 with the preservation number of CGMCC No. 11751; plant immune activator protein HrpNEccPR secreted by the Erwinia carotovora pv. Carotovora strain Ecc 36 has an effect of preventing and controlling plant soft rot. The invention also discloses a protein sequence of the plant immune activator protein HrpNEccPR and a gene sequence that expresses the protein, and further provides a method for obtaining the plant immune activating protein. According to the invention, an activator protein crude product generated by the selected strain with the preservation number of CGMCC No. 11751 has a good antagonistic effect for plants, especially for Chinese cabbage soft rot, and the activator protein crude product can effectively prevent and control the occurrence of the Chinese cabbage soft rot.
Owner:BIOLOGY INST OF HEBEI ACAD OF SCI

Padlock probe for detecting erwinia amylovora and Asian erwinia amylovora and multiple detection method

The invention provides a padlock probe for detecting erwinia amylovora and Asian erwinia amylovora and a multiple detecting method, belonging to the fields of disease prevention and disease treatment of crops and quarantine of plants. A padlock probe sequence P-e.amy for detecting the erwinia amylovora is GACTTCGCAGGCGCCTTGCTCATTACTTPIP2ATCGGCCTGTAATCGGATCGACACGGTGTGTCGC. A padlock probe sequence P-e.pyr for detecting the Asian erwinia amylovora is TATGGCGTCCCCAAGGGGATTCGAACCCPIP2CCGACTCTAGGATCGTGGATCACTTCGTTACCGG. The method multiple detection is combined with a Macroaary technique on the basis of the probe to simultaneously detect the erwinia amylovora and the Asian erwinia amylovora and has strong specialty, sensitivity and stability; and and a rapid, sensitive and special method is provided for detecting the erwinia amylovora and the Asian erwinia amylovora. The figure shows the result of combining the padlock probe and the macroaary technique to simultaneously detect the erwinia amylovora and the Asian erwinia amylovora.
Owner:NANJING AGRICULTURAL UNIVERSITY

Pesticide fertilizer for controlling soft rot of Amorphophallus konjac and preparation method thereof

The invention belongs to the fields of plant disease control and biological pesticides, and relates to a pesticide fertilizer for controlling soft rot of Amorphophallus konjac, which is composed of the following components in parts by mass: 35-45 parts of organic fertilizer, 30-50 parts of inorganic fertilizer, 4-6 parts of Chinese herbal medicine powder, 9-11 parts of nutrient assistant and 5-7 parts of composite adhesive. The active components in the Chinese herbal medicine powder are utilized to achieve the goal of inhibiting Erwinia carotovora. The pesticide fertilizer has very simple steps in the control treatment process.
Owner:ZUNYI NORMAL COLLEGE

Germ-immune type inductive agent and application thereof

The invention discloses a germ-immune type inductive agent and application thereof and belongs to the technical field of plant immune induction. The germ-immune type inductive agent is characterized in that the germ-immune type inductive agent is prepared from uniformly mixing 34 percent of fructo-oligose, 30 percent of radix astragali polysaccharide, 16 percent of trichoderma, 12 percent of lecithin and 8 percent of bacillus subtilis according to the weight ratio, and 6% germ-immune type inductive agent water solution is sprayed for three times in the strawberry virus-free bottle seedling hardening process, wherein the time interval is 7 days. The germ-immune type inductive agent disclosed by the invention has the advantages that the resistance of strawberry virus-free seedlings to pathogenic bacteria is effectively improved, so that good congenital characters of the strawberry virus-free seedlings are guaranteed. The germ-immune type inductive agent has excellent immunity on xanthomonas campestris, pseudomonas pseudoacaligenes, bacteria erwinia and bacillus pumilus in natural planting and has weak immunity on bacillus and fungi.
Owner:湖北勤劳农夫生态农业股份有限公司

Gene modification based method for expressing exogenous drug through probiotic and application of method

InactiveCN108660148ATo achieve the purpose of treating tumor diseasesImprove securityTumor rejection antigen precursorsBacteriaEscherichia coliNutritional deficiency
The invention discloses a gene modification based method for expressing an exogenous drug through a probiotic and an application of the method, the homologous recombination and the one-step seamless cloning are used to knock out an indispensable gene dapA of escherichia coli Nissle1917 to obtain an escherichia coli nutritional deficiency strain Nissle1917deltadapA, the dapA gene is cloned to construct a complementary plasmid pMalc2x-dapA of the nutritional deficiency strain, the complementary plasmid pMalc2x-dapA is electrically shocked to convert into the strain Nissle1917deltadapA, an amicillin resistance gene ampR of a pMalc2x carrier is substituted through the homologous recombination to obtain a plasmid balance system without an antibiotics resistance marker, 12 amino polypeptide sequence genes of an amino terminal sall4 are synthesized in vitro at a sall4 amino terminal, a pelB signal peptide gene sequence of an erwinia carotovora pectinase is fused at the N end, a gene sequenceof a His protein tag is added at the C end, the gene sequences are closed into the complementary plasmid pMalc2x-dapA together to obtain an exogenous drug expression plasmid pMalc2x-dapA-sall4, the plasmid is imported into the escherichia coli nutritional deficiency strain Nissle1917deltadapA, the obtained strain effectively expresses the sall4 polypeptide, and the method has an obvious effect ontreating the liver cancer.
Owner:奇元科技(武汉)有限公司

Preparation method of L-asparaginase

The invention discloses a preparation method of L-asparaginase. The preparation method comprises the following steps of: carrying out wall breaking on Erwinia thalli by using an extracting solution containing lysozyme; and obtaining high-purity L-asparaginase through ion-exchange chromatography and affinity chromatography. The preparation method of the L-asparaginase is simple and easy to apply and has high efficiency, the yield can reach higher than 60 percent, and the purity of the prepared L-asparaginase can is higher than 99 percent and meets the requirement of the Chinese Pharmacopoeia (2005 Version). The preparation method has no pollution to the environment, is economical and environmenta friendly and can be applied to industrial production.
Owner:广州市微生物研究所

Bacillus subtilis BSn5 with bacteriostasis active to carrot soft rot Erwinia and bacteriostasis protein APn5

The present invention belongs to the field of agricultural microbiological technology, and discloses Bacillus subtilis BSn5 possessing bacteriostasis activity on carrot soft rot erwinia and the bacteriostatic protein APn5. Bacillus subtilis BSn5 in the preservation number of CCTCC No. M207124 is separated from the callus of bacteria infected konjaku. Bacillus subtilis BSn5 has bacteriostasis activity on carrot soft rot erwinia, and the bacteriostatic protein APn5 has molecular weight of 31.6 kDa.
Owner:HUAZHONG AGRI UNIV

Rapid separation method of antagonistic bacteria against pathogens of konjac soft rot disease

The invention discloses a rapid separation method of antagonistic bacteria against pathogens of konjac soft rot disease, which comprises the following steps: A) taking konjac tissues infected by the soft rot disease; B) inoculating the tissues at the interface of diseased and healthy tissues onto a nutrient agar culture medium after carrying out surface disinfection; C) streaking the bacteria grown out on the sides of the tissues, and selecting a single colony for purification and preservation; D) adopting a distinctive Erwinia crystal violet polypectin selective culture medium (CVP) to screen the pathogens of the konjac soft rot disease; E) adopting the point connection method to carry out primary screening of antagonistic bacteria; and F) adopting the oxford cup method to carry out secondary screening of the antagonistic bacteria. The method has simple operation and easy operation, and can rapidly and effectively screen out the antagonistic bacteria against the pathogens of the konjac soft rot disease and simultaneously provide a concept for rapid screening of the antagonistic bacteria against other crop diseases.
Owner:INST OF ECONOMIC CROP HUBEI ACADEMY OF AGRI SCI

Copper abietate and zinc thiazole-containing bactericidal composition

The invention discloses a copper abietate and zinc thiazole-containing bactericidal composition. Effective components, namely copper abietate and zinc thiazole, of the bactericidal composition are compounded, and the rest comprises auxiliary components, wherein the mass ratio of the effective components, namely copper abietate to zinc thiazole, in the pesticide composition is (1-50): (50-1); the mass percentage of the effective components, namely copper abietate and zinc thiazole, in the preparation is 1 to 80 percent, and the rest comprises pesticidally available and acceptable auxiliary components. The dosage form of the pesticide composition can be missible oil, a suspending agent, wettable powder, water dispersible granules, emulsion in water, granules and microcapsules, and the pesticide composition is mainly used for preventing and controlling rot of fruit trees, alternaria leaf spot, rice blast, soybean root rot, cucurbits fusarium wilt, cotton verticillium wilt, jujube rust, grapevine white rot, panaxpseudoginseng black spot, tea leaf tea gall, forest rot, citrus canker, bleeding disease, leaf cast, forest seedling blight, erwinia aroideae, pseudomonas lachrymans, bacterial rice leaf blight, apple ring spot viruses, fusarium asiaticum and the like.
Owner:QINGDAO AUDIS BIO TECH CO LTD

Compound bactericidal composition containing fludioxonil

The invention relates to a compound bactericidal composition containing fludioxonil and use thereof. The effective components of the composition are fludioxonil and hymexazol, the mass ratio of portions of fludioxonil and hymexazol is 20:1 to 1:50. The bactericidal composition has relatively strong synergistic action, widens disease prevention and treatment spectrum, can prevent germ from generating resistance or delay the development speed of resistance, prolongs the use life of the pesticide, and reduces the use cost and pesticide residue. The compound bactericidal composition can prevent and treat fusarium patch, rice seedling rot, pythium aphanidermatum, fusarium wilt, verticillium wilt, sclerotinia sclerotiorum, colletotrichum lagenarium, phytophthora blight, fusarium wilt, cladosporium cucumerinum, sclerotium erwinia carotovora, seedling blight, stem wilt and leaf blight, and is particularly suitable for preventing and treating crop soil diseases resulted from pathogen fungus such as fusarium graminearum schwabe, rhizoctinia, pythium aphanidermatum, seedling rot fusoma, phytophthora capsici and the like.
Owner:山东兆丰年生物科技有限公司

8-hydroxyquinoline compound as well as preparation method and application thereof in preventing and treating agricultural disease

The invention discloses a hydroxyquinoline compound as well as a preparation method and application thereof in preventing and treating agricultural diseases. Testing results show that the compound hasremarkable activity upon corn leaf fulvia fulvum, cotton oxysporum, potato rhizoctonia solani kuhn, didymella bryoniae, fusarium oxysporum, wheat gibberella, rice blast, botrytis cinerea, lycium barbarum anthracnose, cotton anthracnose, sclerotinia sclerotiorum, pepper phytophthora blight, potato late blight, rhizoctonia solani, melon bacterial fruit plaque bacteria, grape meloidogynosis bacteria, Chinese cabbage erwinia carotovora, kiwi fruit anabrosis bacteria, pseudomonas lachrymans, ralstorinia solanacearum, rice bacterial leaf blight and rice bacterial stripe bacteria. The hydroxyquinoline compound is simple in preparation process, cheap and easy in raw material obtaining, high in product purity, good in bioactivity and wide in sterilization spectrum and has the potential of being developed as new fungicides.
Owner:LANZHOU UNIVERSITY

Preparation method of lycopene

The invention discloses a method for preparing lycopene. The crtI gene of Erwinia h erbicola is amplified through the PCR technology and is connected with an expression vector pRKR5 containing strong promoters Puc to construct an expression plasmid pRKR5-crtI which is inducted into a mutant TC72 of photosynthetic bacteria Rhodobacter s phaeroides in the mode of conjugal transfer. Due to the high-efficiency expression of the promoters Puc under the anaerobic condition, the adjustment and control on oxygen concentration can induct engineering bacteria to accumulate red pigment. After HPLC and absorption spectral analysis, the pigment synthesized in the engineering bacteria is the lycopene, the biomass (dry weight) of the engineering bacteria is 2.36gDCW / L, and the lycopene content is 1.52mg / gDCW. The method which lays the preliminary foundation for realizing industrial production of lycopene has potential application value in the production practice.
Owner:CHONGQING UNIV

Chlorpyrifos degrading bacteria and application thereof

The invention discloses a chlorpyrifos degrading bacteria Erwiniaxishuaiensis SCU-B244<T> = CGMCCNo.1.12772<T> = KCTC42022<T> (Figure) (i). Through the separation from the cricket body surface, screening, physiological and biochemical identification, the bacteria is identified as gram negative and facultative aerobic bacteria, which has cream bacterium colony, and is oxidase negative and catalase positive; the cells mainly comprises fatty acids of C16:0, C16:1delta<9>, C18:1delta<9>, C11:0<3-OH> and C14:0<3-OH>, GC content in cells is 49.3%-49.5%; and the bacteria has alkaline phosphatase, esterase (C4), lipase (C8), acid phosphatase, beta-galactosidase and beta-glucosidase activities. The bacteria has one day degradation rate on chlorpyrifos of 44.64%, and can be widely used in the fields of development of chlopyrifos degrading enzyme and various types of biological engineering enzyme preparations. Figure instructions: the figure is photos of Erwinia xishuaiensis SCU-B244<T> under 30000 times scanning electron microscope.
Owner:SICHUAN UNIV