Gene modification based method for expressing exogenous drug through probiotic and application of method

A technology of genetic modification and probiotics, applied in the field of genetic engineering, can solve problems such as inability to maintain a physiological state, lack of kanamycin resistance genes, etc., and achieve the goal of reducing application costs, improving safety and high efficiency, and reducing toxic and side effects Effect

Inactive Publication Date: 2018-10-16
奇元科技(武汉)有限公司
View PDF5 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

CN200310112640.3 introduces a non-resistance screening DNA vaccine carrier and its construction method, using chromosome-plasmid balanced lethal system instead of antibiotic resistance gene as a selectable marker for DNA vaccine amplification, and constructing a new type of non-resistance screening DNA Compared with the plasmid pVAX1, the vaccine vector has deleted the kanamycin resistance gene and replaced it with the Salmonella typhimurium asd gene with a length of 1281bp, but it cannot maintain its own resistance without adding foreign substances and without antibiotic selection pressure. Physiological state, while the present invention can maintain the physiological state of the original strain itself, it also improves the safety performance and high efficiency in the application of the strain, and has broad prospects for application in the preparation of drugs for the treatment of liver cancer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene modification based method for expressing exogenous drug through probiotic and application of method
  • Gene modification based method for expressing exogenous drug through probiotic and application of method
  • Gene modification based method for expressing exogenous drug through probiotic and application of method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Embodiment 1: obtain the Nissle1917 bacterial strain of GFP mark

[0041] Such as figure 1 As shown, by designing primers, such as the nucleotide sequence shown in SEQ ID NO.1-2 of the sequence table: primer GFP-F: ATGACTATGATTACGGATTCTCTGGCCGTCGTATTACAACGTCGTGACTGTTTGCCCGCCAGTTGTTG, primer GFP-Re: CAGCTCCAGCCTACAAGGCTGGAGCTGCTTCTTAG, using the SAD1702 genome as a template, through the polymerase chain The reaction (PCR) obtained a 1359bp GFP gene fragment. Design primer simultaneously, as the nucleotide sequence shown in sequence table SEQ ID NO.3~4: primer Cm-F:AAGCAGCTCCAGCCTTGTAGGCTGGAGCTGCTTC, primer Cm-Re:TTATTTTTGACACCAGACCAACTGGTAATGGTAGCGACCGGCGCTCAGCTTCCTCCTTAGTTCCTATTCC, with pKD3 as template, PCR obtains 1082bp of chloramphenicol (Cm ) gene fragments, the two are linked together by overlap PCR. The conditions of the polymerase chain reaction are: 94°C for 2 minutes, 94°C for 20 seconds, 52°C for 30 seconds, 72°C for 1 minute and 15 seconds, 35 cycles, and ...

Embodiment 2

[0042] Example 2: Construction of Escherichia coli auxotrophic strain Nissle1917ΔdapA

[0043] The gene knockout method uses the lamda-Red recombination one-step knockout method. Operation process: clone the recombinant fragment, design primers, such as the nucleotide sequence shown in SEQ ID NO.5-6 of the sequence table: primer DapA-Km-For:TGTTCACGGGAAGTATTGTCGCGATTGTTACTCCGATGGATGTGGGCTGGAGCTGCTTC, primer DapA-Km-Re:TACAGCAAACCGGCATGCTTAAGCGCCGCTCTGACCGTCTCTCCTTAGTTCCTATTCC, which contains 40bp Knock out the upstream and downstream genes of the homology arm of the target gene dapA and the 20bp cloned resistance gene kan, upstream and downstream sequences, and use agarose gel to recover and purify the recombinant fragments. Escherichia coli Nissle1917 competent cells transformed with the recombinant plasmid pKD46 by electric shock were spread on LB plates containing 20 μg / ml Kan antibiotic and 20% arabinose. Pick a single colony on the resistant plate, use the detection prim...

Embodiment 3

[0044] Example 3: Construction and transformation of complementary plasmids for auxotrophic strains

[0045] Design primers, use the Nissle1917 genome as a template, and amplify the 869bp dapA gene fragment by PCR. The PCR reaction conditions are: 94°C, 2 minutes, 94°C, 20 seconds, 52°C, 30 seconds, 72°C, 1 minute, 32 pieces Cycle, PCR product is purified, obtain dapA gene fragment, design primer, nucleotide sequence as shown in sequence table SEQ ID NO.7~8: pMl-DapA-For:GCAGGTCGACTCTAGATTACAGCAACCGGCATGC, pMal-DapA-Re:CAAGGACCATAGCATATGTTCACGGGAAGTATTG, with pMalc2x The plasmid was used as a template, and the pMalc2xΔampR fragment without ampR was amplified by PCR. The two PCR products were mixed and ligated by Gibson cloning. Nissle 1917 competent cells of pKD46 were spread on DAP-free LB plate, cultured at 37°C for 14-16 hours, picked 5 colonies and inoculated in LB culture medium, cultivated for 5-6 hours, detected the bacteria liquid by PCR, The PCR product was detected ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene modification based method for expressing an exogenous drug through a probiotic and an application of the method, the homologous recombination and the one-step seamless cloning are used to knock out an indispensable gene dapA of escherichia coli Nissle1917 to obtain an escherichia coli nutritional deficiency strain Nissle1917deltadapA, the dapA gene is cloned to construct a complementary plasmid pMalc2x-dapA of the nutritional deficiency strain, the complementary plasmid pMalc2x-dapA is electrically shocked to convert into the strain Nissle1917deltadapA, an amicillin resistance gene ampR of a pMalc2x carrier is substituted through the homologous recombination to obtain a plasmid balance system without an antibiotics resistance marker, 12 amino polypeptide sequence genes of an amino terminal sall4 are synthesized in vitro at a sall4 amino terminal, a pelB signal peptide gene sequence of an erwinia carotovora pectinase is fused at the N end, a gene sequenceof a His protein tag is added at the C end, the gene sequences are closed into the complementary plasmid pMalc2x-dapA together to obtain an exogenous drug expression plasmid pMalc2x-dapA-sall4, the plasmid is imported into the escherichia coli nutritional deficiency strain Nissle1917deltadapA, the obtained strain effectively expresses the sall4 polypeptide, and the method has an obvious effect ontreating the liver cancer.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and relates to a method and application for expressing exogenous drugs based on genetically modified probiotics. Background technique [0002] The liver is the main site of metastatic tumors such as colon cancer, breast cancer, and pancreatic cancer. The metastatic spread of tumors can cause 90% of cancer deaths. However, due to the small size and large number of liver metastases, it poses a great challenge to clinical treatment. challenge. Due to the altered microenvironment at the tumor site, compromised immune barriers, and overnutrition in the decaying tumor center, microorganisms often colonize and multiply there. Although people have used bacteria to treat cancer in the past, they always injected high concentrations of bacteria directly into the blood system. This method lacks specificity and pertinence, and has severe side effects. The probiotic Escherichia coli Nissle1917 has the adva...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/70C12N15/90C12N1/21A61K39/00A61P35/00
CPCA61K39/0011A61K2039/523A61P35/00C07K14/4748C12N15/70C12N15/902
Inventor陈卫华刘智陈国忠任杨柳
Owner奇元科技(武汉)有限公司