57results about How to "Enable multiple detection" patented technology

The invention relates to mechanical part shape and position error detection equipment and particularly relates to a small mechanical part shape and position error detection device and a detection method thereof. The base of the detection device is equipped with a vibration disk which is connected to a material channel, and the material channel is supported by a material channel supporting rod installed at the top of the base and is corresponding to the feeding end of a conveying belt. Two sides of the conveying belt are equipped with limiting plates. A detection fixed frame is installed above the conveying belt and is internally equipped with a laser displacement sensor. The bottom of the detection fixed frame is equipped with an electromagnet, and a photoelectric switch corresponding to the electromagnet is arranged on the conveying belt. The material out end of the conveying belt is provided with a cylinder block, and the electromagnet, the conveying belt, the laser displacement sensor, the photoelectric switch and the cylinder block are connected with a control system. According to the small mechanical part shape and position error detection device and the detection method, the online detection of the multiple shape and position errors of a small regular part can be achieved, the manual intervention is not needed in the detection process, unqualified parts can be eliminated automatically, the automatic detection is realized, and the detection efficiency and accuracy are improved.

The invention provides a method, a probe and a kit for detecting multiple target nucleic acid sequences to be detected through a single tube. The method comprises the steps of designing specific upstream and downstream primers and a probe against each target nucleic acid sequence to be detected, and controlling a fluorescence product melting point Tm value of each target nucleic acid sequence to be detected, wherein the probe contains at least one RNA base; labeling a fluorescence group on a probe base close to one side of a 5' terminal of the probe on the left side of the RNA base; and labeling a quenching group on a probe base close to one side of a 3' terminal of the probe on the RNA base. According to the invention, through semi-nested amplification of reaction primers and the amplification of the probe and the primers after enzyme digestion of the RNA base(s), the detection specificity and the sensitivity are improved; through adoption of RNaseH enzyme digestion, the primers withfluorescence labels are obtained, and specific products are directly subjected to melting curve analysis, thus realizing excellent specificity.

The invention belongs to the technical field of electrochemical detection and in particular relates to an array type multi-electrochemical isothermal amplification chip for detecting bacteria and a preparation method of the array type multi-electrochemical isothermal amplification chip. The chip consists of a laser-etched indium tin oxide (ITO) glass electrode substrate and a polydimethylsiloxane microchip. The amplification chip is prepared by taking the ITO glass and the polydimethylsiloxane as materials through the laser etching and micromachining technology. The chip is ordered in space array arrangement, and simultaneous detection for multiple nucleic acid targets is realized by utilizing space discrimination of an amplification signal; each amplification pool respectively contains a set of three-electrode system: a working electrode, a counter electrode and a reference electrode and is connected with an outside multi-channel electrochemical workstation, so that loop-mediated isothermal amplification (LAMP) reaction is carried out, and real-time detection is performed; the data of a real-time curve graph is processed to obtain a quantitative analysis result. The chip is easy to manufacture and convenient to operate, large-scale preparation is easily realized, and an effective scheme is provided for realizing simultaneous quantitative determination for multiple clinical pathogens by using the LAMP method.

The invention provides a detection method and system for WEB application system content change. The detection method and system stores grasped website webpage content into a detection page storage repository with a page file as a unit and records the frequency that the website is detected; by utilizing the stored detection frequency and the existence of the grasped page file, whether the website is a new website and whether the webpage is a new page are judged; whether storage elements contained inside the page file are the same as storage elements contained in a webpage file stored in the past is judged, and if the detection result is that change occurs, the detection result is output. The detection method and system for WEB application system content change carries out all-around detection on the WEB application system content, and accurately positions the specific reason why the webpage content changes on the aspects of webpage feature library codes, webpage content elements and webpage dynamic or static content, thereby obtaining the accuracy of webpage detection and bringing convenience to the detection of WEB application system content change.

The invention discloses a microscopic image cell identification method based on multi-task learning. The method comprises the following steps: firstly, labeling an acquired microscopic image by adopting a multi-labeling mode; then segmenting the microscopic image containing the multiple labels to form a training set; training a pre-constructed cell identification model by utilizing the training set containing the multiple labels; and finally, carrying out cell identification on the microscopic image to be identified by utilizing the trained cell identification model to obtain the category andthe characteristic attribute of each cell in the microscopic image to be identified. Compared with the prior art, the method provided by the invention adopts a multi-labeling mode to label the microscopic image, so that the model obtained by training can realize multi-detection, and the multi-detection can ensure the accuracy of a final detection result.

The invention provides a rapid nucleic acid amplification system. Transfer of a nucleic acid amplification reaction solution in a reaction consumable among different temperature zones is performed bya rotating mode and rapid amplification of nucleic acid is realized; the technical problem that an existing nucleic acid amplification system is long in consumed time or the reaction consumable is difficult to realize is solved. The system provided by the invention comprises a disk-shaped or sector reaction consumable, a temperature control module and a rotary supporting assembly. A PCR (Polymerase Chain Reaction) reaction area close to the edge is arranged on the reaction consumable; the temperature control module comprises two or more groups of circumferentially-distributed PCR temperature zone control units and is used for controlling the temperature of the PCR reaction area on the reaction consumable. The reaction consumable is arranged on a supporting component of the rotary supporting assembly; the PCR reaction area is controlled by a rotary motor to transfer between different temperature zone control units and the rapid amplification of the nucleic acid is realized.

The invention discloses a kit for detecting helicobacter pylori drug resistance gene polymorphism by a multiplex fluorescence PCR melting curve method. The helicobacter pylori drug resistance gene comprises the following three genes: a 23S rRNA gene, a 16S rRNA gene and a gyr A gene, the kit comprises a nucleic acid extraction reagent and a nucleic acid amplification reagent, the nucleic acid extraction reagent comprises superparamagnetic silicon oxide nano magnetic beads, a lysis solution, a washing solution and an eluent; the nucleic acid amplification reagent comprises a primer pair and a probe which respectively correspond to the helicobacter pylori drug resistance gene 23S rRNA gene, the helicobacter pylori 16S rRNA gene, the gyr A gene and an internal standard gene human housekeepinggene beta-globin. According to the invention, three drug-resistant sites and one internal standard gene can be simultaneously detected in a single tube, so that the detection flux of a sample is improved; meanwhile, interference between multiple pairs of primer probes in a detection system is improved, and the sensitivity and specificity of reagent detection are effectively improved.

The invention provides a one-tube method with multiplex fluorescent PCR detection for human Influenza A and B and new Influenza A H1N1 virus. The method adopts the primers of which the sequence is shown in SEQ ID NO: 1-6, and also adopts the probes of which the sequence is shown in SEQ ID NO: 7-9. The invention also provides a kit for one-tube method with complex fluorescent PCR detection for human Influenza A and B and new Influenza A H1N1 virus. The kit comprises the primers and the probes. The invention adopts InfA / InfB / A (H1N1) specific primers and Taqman probes, and uses FAM / JOE / TAMRA multiplex fluorescein labels to realize the multiplex detection for the human Influenza A and B and new Influenza A H1N1 virus. The invention has the advantages of high specificity, high sensitivity, high speed, simple and convenient operation, low cost and the like, can be used as a multiple-detection reagent for scientific research and clinical application.

The invention discloses a multiple-connection probe amplification detection kit, primer and probe for simultaneously detecting the bluetongue viruses, the infectious bovine rhinotracheitis viruses, the bovine viral diarrhea viruses, the enzootic bovine leucosis viruses and the foot and mouth disease viruses. The multiple-connection probe is shown in sequence tables from SEQ ID NO:1 to SEQ ID NO:10. The primer is shown in sequence tables from SEQ ID NO:11 to SEQ ID NO:12. The primer, the probe and / or the multiple-connection probe amplification detection kit including the primer and the probe can detect the five vital cow disease pathogenies including the bluetongue viruses, the infectious bovine rhinotracheitis viruses, the bovine viral diarrhea viruses, the enzootic bovine leucosis viruses and the foot and mouth disease viruses at the same time, the detection time and cost are saved, and epidemic diseases can be diagnosed in time.

The invention discloses a method for real-time quantitative polymerase chain reaction (PCR) detection of bifidobacteria and Escherichia coli by using Taqman probes. The method comprises the following steps of: A) extracting bacterial genome DNA of the bifidobacteria and the Escherichia coli in a sample to be detected; B) synthesizing primers and the Taqman probes according to related sequences of the bifidobacteria and the Escherichia coli; and C) ensuring that the primers and the probes obtained in the step B) and other PCR reaction reagents form a reaction system for real-time quantitative PCR by the Taqman probes. The Taqman probes are labeled by double colors, by a double absolute quantitative PCR method, two kinds of intestinal bacteria in a sample can be accurately quantified at one time, the detection cost and detection time can be saved, and errors caused by repeated detection are reduced.

The invention discloses an in-situ multiplex nucleic acid detection method. The method highly integrates the fluorescence in situ hybridization technology with rolling circle amplification and probe coding technologies to realize highly multiplex in-situ detection of nucleic acid target sequences in samples. The in-situ multiplex nucleic acid detection method has the advantages that multiplex detection of target nucleic acids can be effectively realized, highly multiplex detection can be achieved, and the specificity is high.

The invention provides a padlock probe for detecting erwinia amylovora and Asian erwinia amylovora and a multiple detecting method, belonging to the fields of disease prevention and disease treatment of crops and quarantine of plants. A padlock probe sequence P-e.amy for detecting the erwinia amylovora is GACTTCGCAGGCGCCTTGCTCATTACTTPIP2ATCGGCCTGTAATCGGATCGACACGGTGTGTCGC. A padlock probe sequence P-e.pyr for detecting the Asian erwinia amylovora is TATGGCGTCCCCAAGGGGATTCGAACCCPIP2CCGACTCTAGGATCGTGGATCACTTCGTTACCGG. The method multiple detection is combined with a Macroaary technique on the basis of the probe to simultaneously detect the erwinia amylovora and the Asian erwinia amylovora and has strong specialty, sensitivity and stability; and and a rapid, sensitive and special method is provided for detecting the erwinia amylovora and the Asian erwinia amylovora. The figure shows the result of combining the padlock probe and the macroaary technique to simultaneously detect the erwinia amylovora and the Asian erwinia amylovora.

The invention provides a cell fixation solution, detection kit and method for human respiratory tract pathogen infection flow cytometry detection. The cell fixation solution is a PBS solution containing formaldehyde with the volume fraction of 0.1-1% and methyl alcohol with the volume fraction of 60-80%, and the pH of the cell fixation solution is 7.2-7.4. The kit comprises the cell fixation solution, a cell permeating agent and at least one kind of monoclonal antibodies of a human respiratory tract pathogen to be detected, each kind of monoclonal antibodies of the human respiratory tract pathogen to be detected is marked with fluorescein, and different human respiratory tract pathogens to be detected are provided with different fluoresceins. The detection process is automatic, labor cost is saved, the result is objective and accurate, single-sample multiple detection can be achieved, and the pathogen infection condition can be better reflected.

The invention discloses a method for detecting escherichia coli based on magnetic graphene oxide composite gold star @ gold-silver alloy nanoparticles, and belongs to the technical field of food safety detection. The method comprises the following steps: respectively preparing a magnetic graphene oxide nano material and a 4-ATP-labeled gold star @ gold-silver alloy Raman substrate material, respectively modifying a nucleic acid aptamer of target bacterium on the surface of the magnetic graphene oxide nano material and the 4-ATP-labeled gold star @ gold-silver alloy Raman substrate material, and when the target bacterium exists, gold star @ gold-silver alloy nano-particles are fixed on the magnetic graphene oxide nano-material through the combination of a surface nucleic acid aptamer and atarget bacterium. Unfixed gold star @ gold-silver alloy nano-particles are removed through magnetic separation. A Raman spectrometer is used for scanning, and a linear relation between the concentration of pathogenic bacteria and the intensity of 4-ATP Raman signals is established, and the quantitative detection of the escherichia coli is realized. According to the invention, rapid and high-sensitivity detection of pathogenic microorganisms is realized. The invention provides an effective method for rapid detection of harmful microorganisms in food and environment.

The invention belongs to high-throughput molecular detection of Fusarium graminearum on carbendazim medicament-resistant gene frequency, which can be used for monitoring the medicament resistance of the Fusarium graminearum and early warning medicament-resistant epiphytotic disease of the Fusarium graminearum. The invention provides medicament-resistant high-throughput detection technology constructed based on the fact that over 97 percent of Fusarium graminearum medicament-resistant genetype to carbendazim results from mutation of the 167th locus of beta2-microtubulin gene. The detection method mainly comprises the following three steps of: (1) respectively extracting known sensitive and medicament-resistant strains and genome DNA of samples to be detected; (2) performing specific real-time quantitative PCR reaction and establishing a standard curve; and (3) contrasting the standard curve to solve the medicament-resistant gene frequency in the detected samples. The method has the characteristics of high throughput, rapidness and accuracy. The sensitivity of detecting the medicament-resistant gene frequency is millionth to one hundred thousandth, and the accuracy rate is over 96 percent.

The invention relates to a short fragment nucleic acid chain detection method and a pre-amplification method. The detection method is characterized in that during reverse transcription, the 5' end ofa target sequence is lengthened through TSO sequence template conversion, the target sequence is identified through a reverse transcription prime, and the 3' end of the target sequence is lengthened;during nucleic acid amplification, 5' and 3' specific primes are designed for the reverse transcription prime, the 5' specific prime spans the connecting part of the TSO sequence and the target sequence, and the 3' specific prime spans the connecting part of the target sequence and the reverse transcription prime, so that a short fragment nucleic acid sequence can be accurately amplified and detected; during nucleic acid amplification, 5' and 3' universal primes are designed for the reverse transcription prime, the 5' universal prime is designed inside the TSO sequence, and the 3' universal prime is designed inside the reverse transcription prime, so that a plurality of short fragment nucleic acid sequence pre-amplification products can be obtained.

The invention relates to the technical field of gene engineering, in particular to a primer probe combination for detecting five pathogens of TORCH, which comprises five pairs of primers and five corresponding probes. The invention further provides a kit for detecting the five pathogens of TORCH. The kit comprises a primer probe combination for detecting the five pathogens of TORCH. The inventionfurther provides an application of the kit for detecting the five pathogens of TORCH in detection or auxiliary detection of non-diagnostic purposes of the five pathogens of TORCH. The kit for detecting the five pathogens of TORCH provided by the invention can be used for simultaneously detecting the five pathogens of TORCH, realizes multiple detection, is high in sensitivity, quick and convenient,and can realize batch detection of samples.

The invention relates to a multiple nucleic acid detection method, combination and kit. The method comprises the following steps of mixing a combination containing a first primer group and a first probe with a sample from a subject; amplifying a target sequence possibly existing in the sample; carrying out melting curve analysis on an amplified product in a corresponding detection channel; and judging whether one or more targets exist or not according to a result of the melting curve analysis.

The invention discloses a microRNA (Ribonucleic Acid) detection system and a microRNA detection method based on an exponential amplification reaction and Argonaute nuclease. The invention provides a microRNA (Ribonucleic Acid) detection system based on exponential amplification reaction and Argonaute nuclease, and the microRNA detection system comprises: (a) guide DNA (Deoxyribose Nucleic Acid), which is an amplification product obtained by amplifying a target object microRNA by adopting an exponential amplification reaction system; (b) an Argonaute nuclease, and a method for preparing the same; (c) the detection probe is provided with a fluorophore and a quenching group, and the detection probe comprises a region complementary to an amplification product obtained by amplifying the target microRNA by adopting the index amplification reaction system. According to the microRNA detection system provided by the invention, miRNA detection with single base specificity and high sensitivity as well as multiple miRNA detection and miRNA typing analysis are realized.

The invention discloses a quantitative detection method and a kit for rapid diagnosis of human respiratory pathogens. The kit is composed of: at least one human respiratory tract pathogen antibody capture microsphere, a PE-labeled detection antibody, a pathogen protein standard substance, a flow cytometry correction microsphere, a microsphere buffer solution, a cell lysis solution, a sample diluent and a cleaning solution; the kit is simple, convenient, rapid and automatic to operate, high in detection result sensitivity, wide in detection range and good in repeatability, quantitative detection of various pathogens in human respiratory tract epithelial cells and body fluid can be achieved, detection objects can be flexibly combined, and the infection condition of the pathogens can be reflected more truly.

The invention discloses an integrated nucleic acid analysis chip. The chip is provided with a vent hole, a reaction cavity, a waste liquid cavity and other cavities, and is also provided with a storage tube connection interface, a slide rail interface, a liquid flow pipeline, an exhaust pipeline and the like, and is provided with a plurality of pipeline ports, wherein the cavities are communicated with one pipeline port through respective pipelines; a storage tube is arranged on the chip through the interface to serve as a cavity; a slide rail and the chip are tightly fixed through the slide rail interface, and a conduction valve slides in the slide rail and is used for selective communication between the cavity and a piston pump; and the piston pump is hermetically connected with the conduction valve through a conduit. The integrated nucleic acid analysis chip can complete the complete steps of nucleic acid extraction, amplification and detection in the chip, can effectively avoid possible pollution, and can better remove reagents having an inhibiting effect on subsequent amplification, thereby avoiding the influence of the reagents on amplification and improving the efficiency and accuracy.

The invention provides a method for detecting a to-be-detected target nucleic acid sequence by using a fluorescence probe melting curve and a kit thereof. The method comprises the following steps: designing a specific upstream primer, a specific downstream primer and a probe for each target nucleic acid sequence to be detected, so as to control the melting point Tm value of an amplification product of each target nucleic acid sequence to be detected and a probe binding fragment, the melting point Tm values of fragments formed by combining amplification products of different target nucleic acid sequences to be detected in the same fluorescence labeling channel with the probe are different, and the difference can be distinguished by a detection instrument. Multiple detection of multiple target nucleic acid sequences to be detected and / or detection of SNP in target nucleic acid sequences are / is realized through Tm difference and / or different fluorescent labels between PCR products of different target nucleic acid sequences to be detected and a binding fragment containing a fluorescent group on the right side of an RNA basic group.

The invention discloses a multiple digital nucleic acid analysis device and analysis method based on a melting curve, and relates to the field of nucleic acid analysis. The device comprises a micro-fluidic chip, a flat plate PCR instrument, a fluorescence detection system and a processor, wherein the fluorescence detection system comprises an excitation light source, an optical filter and a camera. The multiple digital nucleic acid analysis method comprises the following steps: dispersing a PCR reaction system into a large number of reaction micro-units on a micro-fluidic chip, then performing digital PCR amplification on the reaction micro-units on a plate PCR instrument, and performing temperature control and fluorescence detection on an amplification product to obtain the melting curve and performing analysis. According to the invention, the nucleic acid amplification products in the micro-reaction units for digital nucleic acid detection are subjected to melting curve analysis, and the amplification product is distinguished and classified, so that multiple digital nucleic acid quantitative detection is realized. Through design of the nucleic acid amplification product, melting curves of different amplification products are different, so that the amplification products are distinguished.

The invention provides a specific selective amplification and multiplex PCR method and application, and relates to the technical field of biology. The specific selective amplification and multiplex PCR method comprises the following steps: by taking endonuclease IV as mediation, identifying a base removal site and cutting a specific primer to obtain an extendable primer, and applying the extendable primer to PCR amplification; tHF is introduced in the middle of the specific primer to serve as a base removal site, sequences on the two sides of THF are complementary with a template, the 3'end is closed, and the specific primer is free of free hydroxyl and cannot extend. The multiplex PCR method provided by the invention can be used for performing multiplex PCR amplification on a biological genome, performing multiplex target amplification of amplicon library establishment, simultaneously detecting multiple pathogens, preparing a kit for simultaneously detecting multiple pathogens, and the like. The key problems of interference, non-specific extension and the like among multiple PCR primers are well solved, multiple detection is realized, the sensitivity is high, rapidness and convenience are realized, and batch detection of samples can be realized.

The invention discloses a preparation method of a full-spectrum-region near-infrared up-and-down conversion material. The full-spectrum-region near-infrared up-and-down conversion material comprises amain body matrix material, namely sodium fluoride; a precursor is prepared in a reaction kettle by utilizing a microwave method; then a nano-material with controllable granularity is prepared in an inert gas environment through low-temperature sintering; mutual regulation and control of up-conversion and down-conversion characteristic responses can be realized through adjusting rare-earth elements and doping concentration; the material can emit down-conversion responses of 400 to 630 nm under the stimulation of a light source with the wavelength of 200 to 400 nm of an ultraviolet region; thematerial has near-infrared down-conversion radiation at 1030 nm and 1550 nm under the stimulation of a light source with the wavelength of 800 to 1200 nm of a near-infrared region; meanwhile, the material emits up-conversion emission of visible light with the wavelength of 530 to 600 nm under the stimulation of a light source with the wavelength of 900 to 1080 nm of the near-infrared region through regulating and controlling the concentration of a stimulator; the full-spectrum-region near-infrared up-and-down conversion material can be directly applied to biological monitoring, has a relatively good application direction in the field of biological imaging, and meanwhile, has a relatively good application prospect in the field of multiple anti-counterfeiting.

The invention discloses a method for detecting target nucleic acid based on cationic conjugated polymer and nuclease-assisted cyclic amplification. The method comprises the following steps: taking a reaction system containing nucleic acid, a reaction buffer solution, a DNA probe and nuclease, and incubating; adding azo-PPE (+), and standing for 5 min or longer; detecting fluorescence intensity; judging whether the nucleic acid contains target nucleic acid or not or the content of the target nucleic acid according to the fluorescence intensity; wherein the nucleotide sequences of the DNA probeand the target nucleic acid are the same or reversely complementary; the tail end of the DNA probe is subjected to fluorescence labeling; the nuclease is used for digesting one nucleic acid strand ofa double-stranded nucleic acid molecule formed by the DNA probe and the target nucleic acid so as to release the other nucleic acid strand. Experiments prove that the method provided by the inventioncan be used for simultaneously detecting various target nucleic acids, and is high in accuracy, high in sensitivity and good in specificity. The invention has important application value.

The invention relates to a multiple enrichment detection method of low-frequency mutation relevant to a non-small cell lung cancer target medicine. Four mutations of 2235_2249del-15 and 2236_2250del-15 which are highest in frequency in deletion mutations on an exon 19 of a human EGFR gene, a T790M mutation on an exon 20, and an L858R mutation on an exon 21 are used as targets, primers, blockers and TaqMan probes marking different fluorescence are respectively designed in accordance with each mutation site, an amplification curve is drawn through collecting fluorescence signals in the amplification course, the Cq value of the amplification curve and a threshold determined through a standard curve are compared, and whether samples have corresponding mutations or not is judged. The system disclosed by the invention is optimized in accordance with cfDNA, so that the system can realize amplification and detection on a target sequence under the situation that the formwork gragmentation degree is high and the wild type background is powerful. The method concurrently has the characteristics of being sensitive and multiple, the detection operations are convenient, quick and accurate, and the method has large application value.