Check patentability & draft patents in minutes with Patsnap Eureka AI!

Multiple digital nucleic acid analysis device and analysis method based on melting curve

A nucleic acid analysis and melting curve technology, applied in the field of nucleic acid analysis, can solve the problems of difficult multiple digital nucleic acid quantitative analysis endpoint fluorescence quantitative detection, low specificity of fluorescent dye lamps, and the number of fluorescent channels controlled.

Pending Publication Date: 2021-11-26
SHANGHAI JIAO TONG UNIV
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] 1. Due to the low specificity of fluorescent dye lamps in existing digital nucleic acid detection (digital PCR, etc.), it is difficult to perform multiple digital nucleic acid quantitative analysis and endpoint fluorescence quantitative detection;
[0008] 2. The multiple digital PCR quantitative method using hydrolyzed fluorescent probes is expensive, difficult to design probes, and limited by the number of fluorescent channels;
[0009] 3. The existing multiple digital PCR quantitative detection instruments with multiple fluorescent channels are expensive and the system is relatively complicated

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Multiple digital nucleic acid analysis device and analysis method based on melting curve
  • Multiple digital nucleic acid analysis device and analysis method based on melting curve
  • Multiple digital nucleic acid analysis device and analysis method based on melting curve

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Example 1 Multiple Digital Nucleic Acid Analysis Apparatus Based on Melt Curves and Its Working Principles.

[0053] The multi-digital nucleic acid analysis apparatus based on the melting curve is used for multiple PCR. The device includes a microfluidic chip containing 2240 micropores, a flat plate PCR and a fluorescence detection system, and the fluorescence module consists of a bracket, two excitation light sources, a filter, and a camera, and can be monitored by processor. The fluorescence signal of the micropores on the entire microfluidic chip performs changes in temperature. The principle of working is like figure 1 As shown, after the microfluidic chip is slidably added to the PCR reaction system, the tablet PCR is placed in the plate PCR, and then passes through the controller, the temperature control and real-time fluorescence signal acquisition is collected by the controller, and finally the melting curve is obtained. Melting Curve Analysis, Realizing Multiple Di...

Embodiment 2

[0054] Example 2 Quantitative detection of multiple PCRs using a multi-digital nucleic acid analysis device based on a melted curve of the present invention.

[0055] Specific steps are as follows:

[0056] The primers were designed with the primer, and the primer sequences were designed in combination with the five germs, ACINETOCCUSPNEUMONIAE, HaemophilusPneumoniae, Haemophilus Influenza, and Klebsiella Pneumoniae.

[0057] Staphylococcus aureus f: agtcacgtcgatcgaaca

[0058] Staphylococcus Aureus R: GaaActTgaccacgatccggg

[0059] Acinetobacter baumannii f: ggctggacatcatcaactgc

[0060] ACINETOBACTER baumannii r: gtcggcctgatctcgtatga

[0061] Streptococcus Pneumoniae F: gcacacTcaactGGAATCC

[0062] Streptococcus Pneumoniae R: atgcaaccgttcccaacaat

[0063] Haemophilus Influenza f: ctgggtgcgggctaaaagt

[0064] Haemophilus Influenza R: TcattaactGGGGCTTCGGT

[0065] Klebsiella Pneumoniae F: Acacaatccccgtgaac

[0066] Klebsiella Pneumoniae R: cccggttagatccatgtga

[0067] The melting ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
melting pointaaaaaaaaaa
Login to View More

Abstract

The invention discloses a multiple digital nucleic acid analysis device and analysis method based on a melting curve, and relates to the field of nucleic acid analysis. The device comprises a micro-fluidic chip, a flat plate PCR instrument, a fluorescence detection system and a processor, wherein the fluorescence detection system comprises an excitation light source, an optical filter and a camera. The multiple digital nucleic acid analysis method comprises the following steps: dispersing a PCR reaction system into a large number of reaction micro-units on a micro-fluidic chip, then performing digital PCR amplification on the reaction micro-units on a plate PCR instrument, and performing temperature control and fluorescence detection on an amplification product to obtain the melting curve and performing analysis. According to the invention, the nucleic acid amplification products in the micro-reaction units for digital nucleic acid detection are subjected to melting curve analysis, and the amplification product is distinguished and classified, so that multiple digital nucleic acid quantitative detection is realized. Through design of the nucleic acid amplification product, melting curves of different amplification products are different, so that the amplification products are distinguished.

Description

Technical field [0001] The present invention relates to the field of nucleic acid analysis, and more particularly to a multi-digital nucleic acid analysis apparatus and analysis method based on a melted curve. Background technique [0002] Digital PCR is a method of precise nucleic acid quantification. By assigning a standard PCR reaction into a large number of tiny reaction units such that each reaction unit contains or does not include a target molecule of one or more copies, after the amplification is completed, the fluorescent signal in the reaction unit of the template will be significantly enhanced. By setting the threshold, it is classified as a positive point, and the number of copies of the target molecule can be calculated by the Poisson distribution by the ratio and number of positive and negative reaction units. [0003] Digital PCR needs to be detected by end-point fluorescence, usually embedded fluorescent dyes, such as SybrGreen et al; or hydrolyzed probe. In the d...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12M1/38C12M1/34C12M1/00C12Q1/6851
CPCC12Q1/6851C12Q2531/113C12Q2537/143C12Q2565/629C12Q2563/159C12Q2563/107
Inventor 沈峰迂妍
Owner SHANGHAI JIAO TONG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More