Multiple digital nucleic acid analysis device and analysis method based on melting curve
A nucleic acid analysis and melting curve technology, applied in the field of nucleic acid analysis, can solve the problems of difficult multiple digital nucleic acid quantitative analysis endpoint fluorescence quantitative detection, low specificity of fluorescent dye lamps, and the number of fluorescent channels controlled.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0052] Example 1 Multiple Digital Nucleic Acid Analysis Apparatus Based on Melt Curves and Its Working Principles.
[0053] The multi-digital nucleic acid analysis apparatus based on the melting curve is used for multiple PCR. The device includes a microfluidic chip containing 2240 micropores, a flat plate PCR and a fluorescence detection system, and the fluorescence module consists of a bracket, two excitation light sources, a filter, and a camera, and can be monitored by processor. The fluorescence signal of the micropores on the entire microfluidic chip performs changes in temperature. The principle of working is like figure 1 As shown, after the microfluidic chip is slidably added to the PCR reaction system, the tablet PCR is placed in the plate PCR, and then passes through the controller, the temperature control and real-time fluorescence signal acquisition is collected by the controller, and finally the melting curve is obtained. Melting Curve Analysis, Realizing Multiple Di...
Embodiment 2
[0054] Example 2 Quantitative detection of multiple PCRs using a multi-digital nucleic acid analysis device based on a melted curve of the present invention.
[0055] Specific steps are as follows:
[0056] The primers were designed with the primer, and the primer sequences were designed in combination with the five germs, ACINETOCCUSPNEUMONIAE, HaemophilusPneumoniae, Haemophilus Influenza, and Klebsiella Pneumoniae.
[0057] Staphylococcus aureus f: agtcacgtcgatcgaaca
[0058] Staphylococcus Aureus R: GaaActTgaccacgatccggg
[0059] Acinetobacter baumannii f: ggctggacatcatcaactgc
[0060] ACINETOBACTER baumannii r: gtcggcctgatctcgtatga
[0061] Streptococcus Pneumoniae F: gcacacTcaactGGAATCC
[0062] Streptococcus Pneumoniae R: atgcaaccgttcccaacaat
[0063] Haemophilus Influenza f: ctgggtgcgggctaaaagt
[0064] Haemophilus Influenza R: TcattaactGGGGCTTCGGT
[0065] Klebsiella Pneumoniae F: Acacaatccccgtgaac
[0066] Klebsiella Pneumoniae R: cccggttagatccatgtga
[0067] The melting ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| melting point | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 



