Padlock probe for detecting erwinia amylovora and Asian erwinia amylovora and multiple detection method

A kind of technology of E. amylovora bacteria and probe, applied in the biological field, can solve the problems such as difficult to realize multiple detection, and achieve the effects of avoiding false positive phenomenon, strong specificity and reliable detection method

Inactive Publication Date: 2009-12-23
NANJING AGRICULTURAL UNIVERSITY
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0020] The purpose of the invention is to solve the problems in the prior art that the molecular detection methods of E. amylovora and E. amylovora are difficult to realize multiple detection, and provide Padlock detectors for detecting E. amylovora and E. amylovora respectively. Acupuncture and a molecular detection method for the simultaneous detection of these two pathogenic bacteria to detect E. amylovora and E. amylovora with high sensitivity and good specificity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Padlock probe for detecting erwinia amylovora and Asian erwinia amylovora and multiple detection method
  • Padlock probe for detecting erwinia amylovora and Asian erwinia amylovora and multiple detection method
  • Padlock probe for detecting erwinia amylovora and Asian erwinia amylovora and multiple detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1: A multiplex detection method using padlock probe combined with Macroaary technology for simultaneous detection of E. amylovora and E. amylovora.

[0040] The padlock probe sequence used to detect E. amylovora:

[0041] P-e.amy: GACTTCGCAGGCGCCTTGCTCATTACTTP I P 2 ATCGGCCTGTAATCGGATCG ACACGGTGTGTCGC

[0042] The padlock probe sequence used to detect E. amylovora:

[0043] P-e.pyr: TATGGCGTCCCCAAGGGGATTCGAACCCP I P 2 CCGACTCTAGGATCGTGGATC ACTTCGTTACCGG

[0044] (1) Disinfect the surface of the infected pear tree leaves and cut them into small sections, then soak them in sterilized water for 30 minutes, centrifuge to get the supernatant, and use the bacterial suspension as a template. Ligation reaction solution includes: 20mM Tris-HCL, pH 9.0, 25mM KCH 3 COO, 10mM Mg(CH 3 COO) 2 , 10mM DTT, 1mM NAD, 0.1% Triton X-100, 2.4U Taq DNA ligase, 1μl bacterial suspension, 100pm probes P-e.amy, P-e.pyr. The ligation reaction program is: pre-denaturation at ...

example 1

[0047] Example 1 detects Phytophthora amylovora and Phytophthora amylovora from the pear blade of artificial inoculation morbidity:

[0048] The padlock detection probes of the above-mentioned E. amylovora and E. asiatica amylovora and their multiple detection methods are used to detect artificially inoculated pear leaves. The methods include:

[0049] 1) Disinfect the surface of the infected pear leaves and chop them up, then soak them in sterilized water for 30 minutes, centrifuge to get the supernatant, and use the bacterial suspension as a template.

[0050] 2) Referring to the above technical scheme, use padlock detection probes P-e.amy and P-e.pyr in combination with Macroaary to detect samples. See the test results image 3 . It is proved that the above technical scheme can be applied to the actual detection of E. amylovora and E. amylovora.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a padlock probe for detecting erwinia amylovora and Asian erwinia amylovora and a multiple detecting method, belonging to the fields of disease prevention and disease treatment of crops and quarantine of plants. A padlock probe sequence P-e.amy for detecting the erwinia amylovora is GACTTCGCAGGCGCCTTGCTCATTACTTPIP2ATCGGCCTGTAATCGGATCGACACGGTGTGTCGC. A padlock probe sequence P-e.pyr for detecting the Asian erwinia amylovora is TATGGCGTCCCCAAGGGGATTCGAACCCPIP2CCGACTCTAGGATCGTGGATCACTTCGTTACCGG. The method multiple detection is combined with a Macroaary technique on the basis of the probe to simultaneously detect the erwinia amylovora and the Asian erwinia amylovora and has strong specialty, sensitivity and stability; and and a rapid, sensitive and special method is provided for detecting the erwinia amylovora and the Asian erwinia amylovora. The figure shows the result of combining the padlock probe and the macroaary technique to simultaneously detect the erwinia amylovora and the Asian erwinia amylovora.

Description

(1) Technical field [0001] The invention relates to a padlock probe for detecting Erwinia amylovora and Erwinia pyrifoliae and a multiple detection method for simultaneously detecting the two plant pathogenic bacteria, belonging to the field of biotechnology. Suitable for port inspection and quarantine, agricultural production, plant protection and other departments. (2) Background technology [0002] Erwinia amylovora (Burrill) Winslow et al. is the causative agent of fire blight in Rosaceae, Maloideae plants. The amylovora pathogen originates from North America, and the disease was discovered in New Zealand in 1920. In 1957, England reported the outbreak of pear fire blight. Since then, except Portugal, most European countries that plant susceptible host plants have reported the occurrence of pear fire blight. So far, amylovora has been widely distributed in 43 countries (Ven der Zwet 2002), but South America, most of Africa, and Asian countries (except Mediterranean cou...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68C12N15/11G01N21/64C12R1/18
Inventor胡白石田艳丽刘凤权王源超郑小波
OwnerNANJING AGRICULTURAL UNIVERSITY