Patents
Literature
PatSnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

38 results about "Fire blight" patented technology

Fire blight, also written fireblight, is a contagious disease affecting apples, pears, and some other members of the family Rosaceae. It is a serious concern to apple and pear producers. Under optimal conditions, it can destroy an entire orchard in a single growing season.

Formulation and method for treating plants to control or suppress a plant pathogen

The present invention provides formulations and methods for controlling or suppressing bacterial or fungal plant pathogens, including Erwina amylovora the bacteria that causes fire blight. A formulation for controlling of suppressing a plant pathogen may include at least one beneficial species of bacteria, at least one beneficial species of fungi, a nutrient, at least one compound that extends the length of time that the formulation remains effective. Typically the formulation is applied to the above ground structures of the plant including its leaves, flowers, stems, trunk, blossoms and fruit.
Owner:BROWER WILLIAM

Brevibacillus laterosporus strain and application thereof

ActiveCN104480046ANon-pathogenicStrong indoor inhibitionBiocideBacteriaBacteroidesFire blight
The invention discloses a Brevibacillus laterosporus strain N106-2 of which the collection number is CGMCC No.8482. The strain has strong indoor flat inhibiting actions on multiple plant pathogenic fungi (fussarium wilt of tomato, root rot of chili, gray mold of tomato, Rhizoctonia solani, black spot of cabbage, anthracnose of pear and black rot of pear) and plant pathogenic bacteria (bacterial wilt of tomato, fire blight of pear and streak of rice); and the strain can secrete proteinase, cellulase and surfactant antimicrobial related substances with hemolytic activity. The Brevibacillus laterosporus can be prepared into a biocontrol aqua; the biocontrol aqua has certain preventing and treating effects on fussarium wilt of tomato, fusarium rot of chili, anthracnose of pome and eyespot of pome. The Brevibacillus laterosporus N106-2 has the advantages of no toxicity, no pathogenicity and high safety for human and livestock, is environment-friendly, is a useful resource for development of microbial pesticides, and has potential application prospects.
Owner:JIANGSU ACADEMY OF AGRICULTURAL SCIENCES

Myxococcus stipitatus preying on plant pathogenic bacteria and application thereof in biological control of bacterial diseases

ActiveCN108559718AGood broad spectrum resistanceGood predation abilityBiocideBacteriaBiotechnologyBacteroides
The invention discloses myxococcus stipitatus preying on plant pathogenic bacteria and application thereof in biological control of bacterial diseases. Slime bacteria BS of antagonistic plant pathogenic bacteria is provided, and the deposit number is CCTCCNO. M2017496. The myxococcus stipitatus BS inhibits the growth of various plant pathogenic bacteria such as cabbage soft rot pathogen, calla soft rot pathogen, tomato bacterial wilt pathogen, potato black smut and pear fire blight by predation, and shows slime bacteria BS broad spectrum resistance to pathogenic bacteria. Pot experiments showthat the slime bacteria BS can effectively inhibit the infection of Pectobacterium carotovorum subsp. carotovorum on potatoes and calla, reduce the incidence of soft rot, and can be used for the biological control of the plant diseases caused by plant pathogenic bacteria.
Owner:NANJING AGRICULTURAL UNIVERSITY

Padlock probe for detecting erwinia amylovora and Asian erwinia amylovora and multiple detection method

The invention provides a padlock probe for detecting erwinia amylovora and Asian erwinia amylovora and a multiple detecting method, belonging to the fields of disease prevention and disease treatment of crops and quarantine of plants. A padlock probe sequence P-e.amy for detecting the erwinia amylovora is GACTTCGCAGGCGCCTTGCTCATTACTTPIP2ATCGGCCTGTAATCGGATCGACACGGTGTGTCGC. A padlock probe sequence P-e.pyr for detecting the Asian erwinia amylovora is TATGGCGTCCCCAAGGGGATTCGAACCCPIP2CCGACTCTAGGATCGTGGATCACTTCGTTACCGG. The method multiple detection is combined with a Macroaary technique on the basis of the probe to simultaneously detect the erwinia amylovora and the Asian erwinia amylovora and has strong specialty, sensitivity and stability; and and a rapid, sensitive and special method is provided for detecting the erwinia amylovora and the Asian erwinia amylovora. The figure shows the result of combining the padlock probe and the macroaary technique to simultaneously detect the erwinia amylovora and the Asian erwinia amylovora.
Owner:NANJING AGRICULTURAL UNIVERSITY

Streptomyces lydicus and application thereof to prevention and treatment of fire blight

The invention discloses streptomyces lydicus. The classification name of the streptomyces lydicus is streptomyces lydicus (streptomyces lydicus), the bacterial strain number of the streptomyces lydicus is M01, the streptomyces lydicus is preserved in the China General Microbiological Culture Collection Center, the preservation date is 29 November 2018, and the preservation number is CGMCC No.16840. The invention also discloses an application of the streptomyces lydicus to prevention and treatment of fire blight of plants. The streptomyces lydicus disclosed by the invention has remarkable antagonizing effects on erwinia amylovora (erwinia amylovora) as a pathogenic bacterium of the fire blight, and has favorable prevention and treatment effects on the fire blight of rosaceae plants especially industrial crops of pear trees, apple trees, cherry-apple trees and the like. Compared with chemical agricultural chemicals for prevention and treatment of plant diseases, the streptomyces lydicusdisclosed by the invention is more notable on effects, is pollution-free to environment, facilitates production of green and nuisance free products, is a biological prevention bacterial strain havinggreat application prospects, and can be used for preparing functional biological prevention microbial inoculum for preventing and treating the fire blight.
Owner:NANJING UNIV OF TECH +1

Bacillus velezensis and use thereof in preventing and treating diseases of bergamot pears

The present invention discloses bacillus velezensis and use thereof in preventing and treating diseases of bergamot pears and belongs to the technical field of biological prevention and treatment of plant diseases. A gjfn2 strain which is screened frombacteria of fruit and vegetable enzyme fermentation broth has a remarkable antibacterial effect on valsa mali var. pyri, erwinia amylovora and dickeya fangzhongdai, is identified as bacillus velezensis and preserved in China General Microbiological Culture Collection Center (CGMCC) on November 18, 2020 and has the preservation number of CGMCC No.21203. A bacillus velezensis gjfn2 fermentation broth and active metabolites in the fermentation broth have broad-spectrum resistance to the valsa mali var. pyri, erwinia amylovora and dickeya fangzhongdai, and have outstanding advantages of haivng high selectivity, being not prone to generating drug resistance, safe, efficient, environmentally friendly and the like, and having great potential inthe biological prevention and treatment of diseases of pear trees.
Owner:XINJIANG AGRI UNIV

Apple tree rootstock named 'G.935'

ActiveUSPP17063P3Angiosperms/flowering plantsFire blightMalus robusta
A new and distinct variety of apple tree rootstock Malus domestica×Malus robusta hybrid ‘G.935’ is described herein. The new variety is a dwarfing rootstock that is resistant to fire blight (Erwinia amylovora) and crown rot (Phytophthora cactorum). The ‘G.935’ rootstock is useful in that it can be propagated clonally and used as a rootstock or root system for apple trees as well as for interstems of apple trees.
Owner:US SEC AGRI +1

Apple tree rootstock named 'g.41'

ActiveUS20060174387P1High yield efficiencySmall fruit sizeAngiosperms/flowering plantsFire blightMalus robusta
A new and distinct variety of apple tree rootstock Malus domestica×Malus robusta hybrid ‘G.41’ is described herein. The new variety is a dwarfing rootstock that is resistant to fire blight (Erwinia amylovora) and crown rot (Phytophthora cactorum). The ‘G.41’ rootstock is useful in that it can be propagated clonally and used as a rootstock or root system for apple trees as well as for interstems of apple trees.
Owner:CORNELL RES FOUNDATION INC

Detection kit and method for Asia erwinia amylovora

The invention relates to a test kit of Asian erwinia amylovora, belonging to the category of preventing and treating diseases of crops as well as plant quarantine. The upstream primer is HrcC-F1:5'-GACGTTTGCACCTGGAAACCG-3', and the downstream primer is HrcC-R1:5'-GCGGTAGGTAATCAAGGCCAC-3'. The kit comprises 1mL of detecting solution, containing 50mmol.L Tris.Cl, 125mmol.L KCl, 2.5mmol.L MgCl, 10mMd NTPs, 0.25mmol / mL of upstream and downstream primers, 0.1mg.mLBSA, and 100 units of Taq DNA polymerase. Based on the primers, the test kit of Asian erwinia amylovora has higher specificity, sensitivity and stability, so as to provide a fast, sensitive and special technical method for testing the Asian erwinia amylovora. The products of special PCR of the Asian erwinia amylovora are shown in the figure.
Owner:NANJING AGRICULTURAL UNIVERSITY

2, 4-dioxoimidazoline cyclohexane sulfonamide compound, preparation method and application of 2, 4-dioxoimidazoline cyclohexane sulfonamide compound as fungicide and bactericide

The invention discloses a 2, 4-dioxoimidazoline cyclohexane sulfonamide compound, which has a structure as shown in the following general formula (1). In the formula, R is selected from any one of C1-C20 alkyl, substituted or unsubstituted benzyl, substituted or unsubstituted phenethyl, 2-thiopheneethyl, 2-pyridylethyl and morpholine-N-ethyl. The 2, 4-dioxoimidazoline cyclohexane sulfonamide compound provided by the invention has an inhibition effect on fungi such as botrytis cinerea, sclerotinia sclerotiorum, phytophthora capsici, rice sheath blight, rice blast and fusarium graminearum, and is used for preventing and treating diseases of the fungi; the compound has an inhibiting effect on bacteria such as cabbage soft rot, citrus ulcer, pepper scab, pear fire blight and tomato ulcer, andis used for preventing and treating diseases.
Owner:SHENYANG AGRI UNIV

Apple tree rootstock named 'g.935'

ActiveUS20060174386P1Induce precocityHigh yield efficiencyAngiosperms/flowering plantsFire blightMalus robusta
A new and distinct variety of apple tree rootstock Malus domestica×Malus robusta hybrid ‘G.935’ is described herein. The new variety is a dwarfing rootstock that is resistant to fire blight (Erwinia amylovora) and crown rot (Phytophthora cactorum). The ‘G.935’ rootstock is useful in that it can be propagated clonally and used as a rootstock or root system for apple trees as well as for interstems of apple trees.
Owner:US SEC AGRI +1

Rapid immunoassay test strip for phytophthora infestans and application thereof

InactiveCN111735954AShort detection timeImprove the efficiency of rapid screeningBiological testingImmunoassaysBiotechnologyCellulose
The invention discloses a rapid immunoassay test strip for phytophthora infestans and application thereof. The test strip comprises a bottom plate, wherein a water absorption pad, a detection pad, a gold label pad and a sample pad are sequentially adhered to one surface of the bottom plate from top to bottom; every two adjacent pads are connected in an overlapped mode at the joint, a nitrocellulose membrane serves as a base pad of the detection pad, a quality control line and a detection line are transversely arranged on the nitrocellulose membrane from top to bottom, the detection line is located below the quality control line, the detection line is coated with an anti-pyricularia grisea polyclonal antibody 0550, and the quality control line is coated with goat anti-mouse IgG. The gold label pad is sprayed with a nanogold labeled anti-pyricularia oryzae monoclonal antibody. The specificity is high, and no cross reaction is caused to pythium aphanidermatum, pear rust water, pear rot, pear anthracnose and the like of Asian pears; the sensitivity of the test strip can reach 1*10<5> cfu / mL, and the test strip can be used for rapid screening of pythium aphanidermatum in fields.
Owner:NANJING AGRICULTURAL UNIVERSITY

Apple tree rootstock named `G.41`

ActiveUSPP17139P3Angiosperms/flowering plantsFire blightMalus robusta
A new and distinct variety of apple tree rootstock Malus domestica×Malus robusta hybrid ‘G.41’ is described herein. The new variety is a dwarfing rootstock that is resistant to fire blight (Erwinia amylovora) and crown rot (Phytophthora cactorum). The ‘G.41’ rootstock is useful in that it can be propagated clonally and used as a rootstock or root system for apple trees as well as for interstems of apple trees.
Owner:CORNELL RES FOUNDATION INC

Method for quickly identifying disease resistance of inoculated in vitro branched to pear fire blight

The invention relates to the technical field of plant protection, and particularly discloses a method for quickly identifying disease resistance of inoculated in vitro branched to pear fire blight. The method comprises the following steps of (1) preparing erwinia amylovora inoculating liquid; (2) preparing in vitro branches; (3) performing inoculation; and (4) evaluating variety disease resistance. According to the identifying and evaluating method for the disease resistance of the pear fire blight, provided by the invention, pathogenesis symptoms and pathogeny quantifying through a molecularbiology technique are combined, so that the method is quick, simple, standard and practical, the result is accurate and reliable, and the method is suitable for performing quick identification and screening on disease resistance of bulk materials.
Owner:XINJIANG AGRI UNIV

Method for measuring pathogenicity of pear fire blight bacteria by means of in-vitro water culture approach for fragrant pear branches

The invention relates to the technical field of plant protection and particularly discloses a method for measuring the pathogenicity of pear fire blight bacteria by means of an in-vitro water cultureapproach for fragrant pear branches. The method comprises the following steps of (1) preparation of a pear fire blight bacterium inoculation solution; (2) preparation of in-vitro branches; (3) inoculation; (4) observation of an inoculation result and evaluation of the pathogenicity. The method is simple and feasible, the pathogenicity of pathogenic bacteria is stably expressed, the repeatability is high, and the result is reliable; the pathogenicity and pathogenicity intensity of the pear fire blight bacteria can be accurately reflected. In actual operation, the method can be carried out in batches and has the advantages of small occupied space, lower labor cost and shorter experimental cycle. Therefore, the method is suitable for application and popularization.
Owner:XINJIANG AGRI UNIV

Klebsiella sp. and use thereof in preventing and treating of fire blight of fruit trees

The present invention discloses a klebsiella sp. and use thereof in preventing and treating of fire blight of fruit trees, and belongs to the technical field of biological prevention and treatment ofplant diseases. A TN50 strain which has a strong competitive effect and a remarkable inhibition effect on growth of erwinia amylovor is screened from endophytic bacteria separated from healthy Korla pear branches, is identified as klebsiella sp. and preserved in China General Microbiological Culture Collection Center (CGMCC) on November 18, 2020, and has the preservation number of CGMCC No.21204.A klebsiella TN50 strain fermentation broth and active metabolites in the fermentation broth have good prevention and treatment effects on fire blight of kernel fruit trees such as rosaceae pears, apples, haws, etc., and the TN50 strain is a biocontrol potential strain with a high prevention effect, good environmental safety and development and application prospects.
Owner:XINJIANG AGRI UNIV

Application of polypeptide in preparation of preparation for preventing and treating plant diseases

The invention relates to the technical field of plant disease prevention and control, in particular to application of polypeptide to preparation of a preparation for preventing and treating plant diseases; the preparation is prepared by taking polypeptide as an active component and adding auxiliary materials or auxiliary components. The preparation disclosed by the invention has obvious prevention and treatment effects on plant diseases caused by Erwinia amylovora, and has outstanding prevention and treatment effects on fire blight of rosaceae plants, especially economic crops such as pears, apples, haws and malus spectabilis. Compared with the prior art, the polypeptide preparation has the effects of wide action range, high safety, no biotoxicity, no drug resistance, no stimulation and no hormone, and can effectively prevent and treat plant diseases.
Owner:江苏嘉肽生物技术有限公司

Fluorescent PCR (polymerase chain reaction) quick detection primer and kit for pear fire blight pathogenic bacteria

The invention relates to a real-time fluorescent PCR (polymerase chain reaction) quick detection primer and kit for pear fire blight pathogenic bacteria. The primer comprises a forward primer of which the sequence is SEQ ID NO:1 and a reverse primer of which the sequence is SEQ ID NO:2. In the invention, a specific conserved sequence is obtained through molecular biological analysis according to an ITS gene sequence of pear fire blight pathogenic bacteria, and a specific amplification primer thereof is designed. The conserved gene sequence is shared by different pear fire blight pathogenic bacterium strains to ensure the reliability in detection of pear fire blight pathogenic bacteria from different sources on a species level. Besides, the primer provided by the invention adopts fluorescence labeling; and compared with the common PCR technology, observation does not need to be performed through a gel electrophoresis method, thus realizing the integrated sealed detection in the detection process.
Owner:郑媛

Natural antibacterial and antiviral preparation as well as preparation method and application thereof

The invention belongs to the technical field of medicines, and discloses a natural antibacterial and antiviral preparation, and a preparation method and application thereof, the preparation method ofthe preparation comprises the following steps: 1) screening grapefruit seeds, crushing the grapefruit seeds to a certain particle size, adopting ethanol as an extracting agent, extracting in a stirring manner to obtain a crude extract, and filtering the crude extract to obtain a filtrate; recovering ethanol to obtain an extracting solution; and 2) adding glycerin into the extracting solution in the step 1), adding water for diluting by a certain multiple to obtain a diluent, and adding citric acid, sodium citrate and a compound biological enzyme into the diluent to obtain a mixed solution. According to the preparation disclosed by the invention, all the components cooperate with one another, firstly, capsules of the preparation are rapidly dissolved, then, cell dissolution is further promoted, pear fire blight germs are effectively inhibited, and meanwhile, the preparation can rapidly take effect on common bacteria and has a broad-spectrum antibacterial effect.
Owner:浙江亲水园生物科技有限公司

Apple tree named 'G.814'

The present invention relates to a new and distinct variety of apple tree named ‘G.814.’‘G.814’ is useful in that it can be propagated clonally and used as a rootstock or root system for apple trees as well as for interstems of apple trees. When used as a rootstock, ‘G.814’, is: dwarfing, induces scion precocity, is cold hardy, induces scion precocity, has a high yield efficiency, is tolerant to replant disease, and is resistant to: crown and root rot (Phytophthora cactorum), fire-blight (Erwinia amylovora), and powdery mildew. ‘G.814’ is susceptible to Apple Stem Grooving Virus (ASGV) and wooly apple aphid.
Owner:US SEC AGRI +1

Method for producing plant protection or plant-strengthening agent for fighting against bacterial and/or fungal plant diseases, in particular against fire blight

InactiveUS7704494B2BiocideDead animal preservationDiseaseFungal Structures
A method for producing plant protection or plant-strengthening agent for fighting against bacterial and / or fungal plant diseases, in particular against a fire blight consisting in adding capable to proliferate fungal structures into an acid medium for treating plants.
Owner:BIOPROTECT

Insecticide for preventing disease of fruit trees

The invention discloses an insecticide for preventing disease of fruit trees. The insecticide is prepared from the following raw materials: 10 to 18 parts of tobacco leaves, 15 to 20 parts of garlic,8 to 15 parts of castor leaves, 12 to 18 parts of radix sophorae flavescentis, 6 to 15 parts of Chinese prickly ash, 5 to 8 parts of polyisobutene, 30 to 40 parts of an ultraviolet absorbent, 1 to 5 parts of carbon powder, and 11 to 17 parts of hexane. The insecticide has high contact toxicity to aphid, red spiders and ants, also has a suffocating and stomach poisoning effect, and can prevent thegrub; main raw materials are natural plants, so that the insecticide is nontoxic to the human body, and environment-friendly, and has the advantages of simple processing, low processing cost, low rawmaterial acquisition cost, and wide popularization range; and by mixing the polyisobutene, ultraviolet absorbent, carbon powder, hexane and a mixed solution of a tobacco solution, a garlic solution, castor beans powder, radix sophorae flavescentis and Chinese prickly ash, the drug effect can be prevented from being influenced by the direct illumination of the sunlight ultraviolet, the agglomeration of the medicine can also be avoided, the diffusion is avoided, and the medicine effect is not influenced; the insecticide is sprayed onto tree leaves, so that the alternaria leaf spots, rust diseases and fire blight can be effectively prevented; and when the insecticide is buried at the roots, the black rot and root cancer can be prevented.
Owner:冯占亭

Biocontrol bacterium and application thereof in preventing and control of vine blight

ActiveCN109055265AEffectively prevent and control the blightPromote growthBiocidePlant growth regulatorsEcological environmentFire blight
The invention relates to biocontrol bacterium and application thereof in preventing and control of vine blight. The biocontrol bacterium CGMCC NO.15764 can be used for effectively preventing and controlling the vine blight of crops, especially can be used for obviously preventing and controlling the vine blight of watermelon and melon, can accelerate the growth of the watermelon and melon, and canbe applied to the preventing and controlling of the vine blight of the crops and the planting of the watermelon and melon. Compared with the chemical agent of the prior art, the biocontrol bacteriumhas the advantages that the poison to human and livestock is avoided, the pollution to environment is avoided, the residue is avoided, and the sustained development of ecological environment is realized.
Owner:NANJING AGRICULTURAL UNIVERSITY

A kind of natural antibacterial and antiviral preparation, preparation method and application thereof

The invention belongs to the technical field of medicine, and discloses a natural antibacterial and antiviral preparation, a preparation method and its application. The preparation method of the preparation includes the following steps: 1) screening pomelo seeds, crushing them to a certain particle size, and using ethanol as the extraction method Extract the agent by stirring to obtain a crude extract, filter the crude extract to obtain a filtrate; then recover the ethanol to obtain an extract; 2) add glycerin to the extract in step 1), and then add water to dilute A certain multiple is obtained to obtain a diluent, and citric acid, sodium citrate and complex biological enzymes are added to the diluent to obtain a mixed solution. The preparation of the present invention utilizes the synergy of various components to first rapidly dissolve the capsule, and then further promote cell dissolution to effectively inhibit the amylovora pathogen, and at the same time, it can quickly act against common bacteria and has a broad-spectrum antibacterial effect.
Owner:浙江亲水园生物科技有限公司

Nested PCR reagents and detection system for detecting pear pollen pear fire blight bacteria

PendingCN113337628AGuaranteed sterile safetyEffectively cut off the way of transmissionMicrobiological testing/measurementMicroorganism based processesBiotechnologyNucleotide
The invention discloses nested PCR reagents and a detection system for detecting pear pollen pear fire blight bacteria, the detection reagents comprise a first primer pair and a second primer pair; the nucleotide sequence of the upstream primer of the first primer pair is as shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer is as shown in SEQ ID NO. 2; and the nucleotide sequence of the upstream primer of the second primer pair is as shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer is as shown in the specification. According to the invention, the nested PCR system for high-sensitivity detection of the pear pollen branch blight bacteria is established, and the nested PCR molecular method is utilized to establish the high-sensitivity pear pollen blight bacteria detection system, so that the sterility and safety of the commercial pear pollen are ensured, and the path of propagation and diffusion of the bergamot pear branch blight bacteria through the pollen is cut off.
Owner:TARIM UNIV +1

Apple tree rootstock named 'G.222'

The present invention relates to a new and distinct variety of apple tree rootstock named ‘G.222.’ The ‘G.222’ apple tree rootstock is 45 to 55 percent of the size of a standard self-rooted seedling tree, induces precocity to the scion, encourages high yield efficiency, is resistant to fire blight and woolly apple aphid, is resistant to crown and root rots caused by Phytophthora cactorum, and is tolerant to replant disease complex.
Owner:UNITED STATES OF AMERICA +1

Application of Chickpea Extract in Controlling Crop Pathogenic Bacteria

ActiveCN111838198BPhytotoxicityBiocideDisinfectantsBiotechnologyClavibacter michiganensis
The invention discloses the application of chickpea extract in preventing and treating pathogenic bacteria of crops, and belongs to the field of agricultural technology. Specifically, the chickpea extract is biochanin A or / and genistein, and the extract is effective against soybean spot pathogen ( Xanthomonas axonopodis PV .glycines,Xag ), Phytophthora amylovora ( Erwinia amylovora, Ea ), Bacterial canker of tomato ( Clavibacter michiganensis, Cm ), Acidophage watermelon ( Acidovorax citrulli, Ac ) have inhibitory effect, and can be used to prepare pesticides for the control of pathogenic bacteria in crops.
Owner:NANTONG UNIVERSITY

Apple tree rootstock named ‘G.814’

ActiveUSPP27643P3Good precocity to the scionInduces early reproductive developmentAngiosperms/flowering plantsDiseaseFire blight
The present invention relates to a new and distinct variety of apple tree named ‘G.814’. ‘G.814’ is useful in that it can be propagated clonally and used as a rootstock or root system for apple trees as well as for interstems of apple trees. When used as a rootstock, ‘G.814’, is: dwarfing, induces scion precocity, is cold hardy, induces scion precocity, has a high yield efficiency, is tolerant to replant disease, and is resistant to: crown and root rot (Phytophthora cactorum), fire-blight (Erwinia amylovora), and powdery mildew. ‘G.814’ is susceptible to Apple Stem Grooving Virus (ASGV) and wooly apple aphid.
Owner:US SEC AGRI +1

Myxococcus petiole preying on plant pathogenic bacteria and its application in biological control of bacterial diseases

ActiveCN108559718BGood broad spectrum resistanceGood predation abilityBiocideBacteriaBiotechnologyMyxobacteria
The invention discloses a petiole myxococcus which preys on plant pathogenic bacteria and its application in biological control of bacterial diseases. A Myxobacterium BS strain antagonizing plant pathogenic bacteria, the preservation number is CCTCCNO.M2017496. Myxococcus petiole BS of the present invention inhibits the growth of various plant pathogenic bacteria such as cabbage soft rot fungus, calla lily soft rot fungus, tomato bacterial wilt, potato blackleg fungus and amylovora fungus by predating, showing Myxobacteria BS broad-spectrum antipathogenic bacterial capacity. Pot experiments show that myxobacteria BS can effectively inhibit the infection of potatoes and calla lilies by Pectobacterium carotovorum subsp. carotovorum, reduce the incidence of soft rot, and can be used for plant pathogenic bacteria biological control of plant diseases.
Owner:NANJING AGRICULTURAL UNIVERSITY