1063 results about "Loop-mediated isothermal amplification" patented technology

The invention relates to a technique for fast detecting food-borne pathogens based on a loop-mediated isothermal amplification, LAMP technique. A primer for detection of salmonella can augment the specific base sequence of a target gene which is the invA-GenBank (accession no. DQ644633) of the salmonella, and the primer is complementary to a part of or a complementary chain of the nucleic acid sequence on the 382-580bp loci on the target gene. The invention provides a primer unit having specificity to a specific gene fragment of the salmonella, and through detecting whether or not the detecting specimen in a reagent box of the primer unit contains the specific gene fragment of the salmonella, determines whether the salmonella exists in the specimen or not.

The invention relates to a technique for fast detecting food-borne pathogens based on a loop-mediated isothermal amplification, LAMP technique. A primer for detection of shigella can augment the specific base sequence of a target gene which is the ipaH-GenBank (accession no. M32063) of the shigella, and the primer is complementary to a part of or a complementary chain of the nucleic acid sequence on the 1095-1299bp loci on the target gene. The invention provides a primer unit having specificity to a specific gene fragment of the shigella, and through detecting whether or not the detecting specimen in a reagent box of the primer unit contains the specific gene fragment of the shigella, determines whether the shigella exists in the specimen or not.

The invention relates to a vibrio parahemolyticus detection kit. The vibrio parahemolyticus detection kit is characterized by comprising the following components: (1) an immune enrichment reaction system component, (2) a loop-mediated isothermal amplification (LAMP) system component and (3) a set of specific primers based on an LAMP technology of vibrio parahemolyticus tlh genes, wherein the specific primers comprise two outer primers F3 and B3, two inner primers FIP and BIP and two ring primers LF and LB. The detection method for the vibrio parahemolyticus detection kit comprises the following steps of: detecting the vibrio parahemolyticus by adopting a method of combining immune enrichment and the LAMP technology; preparing an immunomagnetic bead by adopting a vibrio parahemolyticus polyclonal antibody; preliminarily screening the vibrio parahemolyticus in an actual sample by adopting an immunology method; and designing an LAMP specific primer according to the species specificity gene of the vibrio parahemolyticus. According to the invention, molecular detection is carried out on a nucleic acid level, therefore, the condition of false positive or undetection of a simple immunology method or a molecular method is effectively avoided, and the invention is a new development direction of the quick detection of the vibrio parahemolyticus.

The invention relates to a reagent kit and a detecting method for using loop-mediated isothermal amplification (LAMP) technique to detect aeromonas caviae, which belongs to the pathogen diagnosis field. The main technical scheme of the invention comprises: utilizing the LAMP technique, designing four pairs of high specificity primers aiming at six zones of 16s and 23s ribosome RNA gene transcription spacer region, and achieving the purpose for detecting the aeromonas caviae with specificity. Compared with a traditional method, equipment and operational steps which are needed in the method are simple, the method has the advantages of rapidness and high specificity, and the detecting cost is lower, which is suitable for common clinics and field detections.

The invention relates to a method for detection Listeria monocytogenes with loop-mediated isothermal amplification-CdS nanoparticles labeling electrochemistry. The method is characterized in that the method comprises the following steps of: obtaining double-stranded target sequence of amplification reagent-Listeria monocytogenes to be detected by means of loop-mediated isothermal amplification reaction; pyrolyzing a double-stranded target sequence in water bath into a single-stranded target sequence, then self assembling and fixing at the surface of gold electrode, so that the target sequence modified electrode of the Listeria monocytogenes to be detected is obtained; afterwards, labeling the probe sequence coming from the Listeria monocytogenes by CdS nanoparticles to obtain a labeled probe sequence; carrying out molecular hybridization on the labeled probe sequence and the target sequence of the target sequence modified electrode, and carrying out electrochemical detection by simultaneity plating Hg anodic stripping method; detecting out cadmium ions corresponding to the species-specific genes (actA) of the detected Listeria monocytogenes. The method has the advantages of speediness, strong specificity, high sensitivity and convenient use.

The invention relates a technique for fast detecting food-borne pathogens based on a loop-mediated isothermal amplification, LAMP technique. A primer for diction of vibrio parahemolyticus can augment the specific base sequence of a target gene which is the tih-GenBank (accession no. AY578148) of the vibrio parahemolyticus, and the primer is complementary to a part of or a complementary chain fragment of the nucleic acid sequence on the 946-1140 loci on the target gene. The invention provides a primer having specificity to a specific gene fragment of the vibrio parahemolyticus, and through detecting whether or not the detecting specimen in a reagent box of the primer unit contains the specific gene fragment of the vibrio parahemolyticus, determines whether the vibrio parahemolyticus exists in the specimen or not.

Provided herein is a reagent preparation for loop-mediated isothermal amplification of nucleic acids comprising: at least one polymerase enzyme, a target-specific primer set, and dinucleotide triphosphates (dNTPs) in a single, dry format; wherein said reagent preparation is water soluble and stable above 4° C.

The invention discloses a loop-mediated isothermal amplification detection primer group, a detection method and a detection kit for enterobacter sakazakii. Aiming at ompA genes of the enterobacter sakazakii, in the invention, a specific detection primer group, a detection kit containing the detection primer group, and a detection method utilizing the detection kit are designed and selected, so that detection is carried out on samples to be detected, especially milk powder, thus determining whether the specific gene segments of the enterobacter sakazakii exist, and further determining whether the samples to be detected contains the enterobacter sakazakii. According to the invention, the detection kit and the detection method have the advantages of high sensitivity, strong specificity, short detection time, without a PCR (polymerase chain reaction) instrument and an electrophoresis apparatus, are simple for operation process, are especially suitable for a basic detection mechanism and food enterprises for self check, and have important meaning for fast detecting milk powder and ensuring the safety of the milk powder.

The invention discloses a reaction tube used in a loop-mediated isothermal amplification technique, wherein the reaction tube is composed of two parts of a tube body and a tube cover; the lower part of the inner cavity of the tube body is provided with a longitudinally outspread clapboard which separates the inner cavity of the tube body into two cavities of A and B; the cavity A and the cavity B are respectively provided with loop-mediated isothermal amplification reaction working solution or developing solution, the upper layers of the liquid in the two cavities are both sealed up by paraffin wax. Through the design of the clapboard and the paraffin wax, the reaction tube in the invention effectively separates the developing solution and the working solution, thus not only ensuring to relatively maintain complete closure in the storage and transportation process, but also having no need to open the tube cover to realize the developing reaction and greatly reduce the pollution of aerosol. The reaction tube of the invention ensures rapid and efficient detection of loop-mediated isothermal amplification, and has low cost and is beneficial for large-scale promotion.

The invention discloses an LAMP (loop-mediated isothermal amplification) primer composition used for detecting a pathogenic microorganism of the urogenital canal and a related application of the LAMP primer composition. The high-sensitivity high-accuracy LAMP primer composition used for detecting the pathogenic microorganism of the urogenital canal is provided, further, the LAMP micro-fluidic chip technique is applied to detecting the pathogenic microorganism of the sexual transmission urogenital canal, the characteristics of high throughput, rapidness, high sensitivity, and good specificity of a micro-fluidic chip are utilized to improve the detection speed, throughput and sensitivity in the detection of the pathogenic microorganism of the sexual transmission urogenital canal, so that the cost is greatly lowered, and the detection time is shortened.

The invention belongs to the technical field of nucleic acid isothermal amplification, and particularly relates to a microfluidic chip for multiple loop-mediated isothermal amplification (LAMP) detection and a preparation method thereof. The chip is made of a high polymer, and is prepared by a micro-electromechanical system (MEMS) method. The chip mainly comprises amplification pools which are spatially and sequentially arranged, capillary channels, and connecting pipelines, wherein the amplification pools realize the effective discrimination of multiple LAMP signals through the spatial discrimination of the signals; the capillary channels are used for preventing the intersection and mixing of LAMP primers, amplification products, byproducts and the like among different amplification pools; and the amplification pools and the capillary channels are communicated through the connecting pipelines, so that fluid steadily and uniformly flows into the amplification pools from the capillary channels. The chip is easy to manufacture and operate; and an effective scheme is provided for the realization of the synchronous clinical detection of various pathogens by an LAMP method.

The invention discloses a LAMP (loop-mediated isothermal amplification) detection kit for Vibrio vulnificus and a detection method using the same, and particularly relates to a group of primers for detecting Vibrio vulnificus, a kit containing the primers and a detection method using the same. The primers have oligonucleotide sequences shown as SEQ ID NOs.1-6 in a sequence table. The kit disclosed by the invention is high in sensitivity and specificity, low in cost and simple to operate.

The invention discloses a set of loop-mediated isothermal amplification technology-based plasmodium genus and species nucleic acid screening method and belongs to the field of biological detection. The method is performed by loop-mediated isothermal amplification (LAMP) technology, specific positions of target genes are amplified by using an LAMP technology platform through specific primers of plasmodium genera and specificity primers of plasmodium species, the plasmodium genera are screened or detected at a molecular level under assistance of positive and negative quality control and an internal control detection system, and plasmodium species screening or detection is performed on four kinds of plasmodia, namely Plasmodiumfalciparum, Plasmodiummalariae, Plasmodiumovale and Plasmodiumvivax which can make humans infected with malaria in plasmodium genus organisms. The invention has the characteristics that: the method is simple, economic and rapid, and has high sensitivity, high specificity and wide application prospect.

The invention discloses a loop-mediated isothermal amplification (LAMP) kit for rapidly detecting vibrio parahaemolyticus. The LAMP kit is composed of LAMP reaction liquid, a standard positive template and a negative quality control standard substance. The LAMP reaction liquid contains a Bst DNA polymerase big fragment, a primer, LAMP10*buffer, dNTPs solution, MgSO4 solution and glycine betaine. The primer is divided into a forward primer and a reverse primer. The LAMP kit has the advantages of being good in specificity, high in sensitivity, rapid and convenient, high in repeatability, capable of judging results by using eyes and the like, can conduct rapid qualitative detection on vibrio parahaemolyticus in industrial foods, and can replace continuously-used traditional culture method and serological diagnosis method.

The invention relates to an LAMP (Loop-mediated Isothermal Amplification) detection kit of pathogenic aeromonas hydrophila, having convenient use and rapid detection. The LAMP detection kit comprises a bacterium DNA extracting reagent and an LAMP reaction reagent, wherein the reaction reagent contains primers FIP with the sequence of GTTTCCCCCATCAGATCCGTGGTTTACGCCACCCAGTTTCTTG, BIP with the sequence of TCCGGCCTGTATACCTGTATCAGGTTAAACCAGGGTGTCATCGCT, F3 with the sequence of TGATGGCCACGAGACATCCA and B3 with the sequence of TGCTTGATCCCCTTGCTACT. The LAMP detection method of the pathogenic aeromonas hydrophila comprises the following steps of: (1) DNA (Deoxyribonucleic Acid) extraction; (2) LAMP amplification of the pathogenic aeromonas hydrophila; and (3) staining detection. The invention is suitable for detecting the pathogenic aeromonas hydrophila.

The invention discloses a kit used for rapid detection of enterobacter sakazakii in milk, and applications thereof, and belongs to the field of food safety technology. The kit comprises a loop-mediated isothermal amplification (LAMP) reaction system, Bst DNA polymerase, a probe and a colloidal gold test strip. The kit is capable of solving a problem that result interpretation of existing LAMP detection methods is not capable of realizing on-site detection; result interpretation method of the test strip of the kit is simple, no instrument is needed, and interpretation can be realized by the naked eye.

The invention discloses a rapid diagnostic kit based on a loop-mediated isothermal amplification technique for hepatitis A virus genes and a detection method thereof. The kit comprises two pairs of primers, Bst DNA polymerase, revertase, an RNase inhibitor, a stabilizing solution, a reaction solution, a chromogenic solution and a positive contrast solution, wherein the nucleotide sequences of thetwo pairs of primers are shown in SEQ ID NO: 1-4; and the eight solutions are respectively contained in containers. The kit and the detection method can detect the hepatitis A virus with high efficiency and high specificity, are based on the loop-mediated isothermal amplification technique, apply six segments, four primers and one constant temperature to complete an amplification reaction within less than one hour, and have the advantages of low detection cost, short time consumption, high yield, high specificity, significant chromogenic difference between a positive result and a negative result, high authentication rate, distinctness and reliability.

The invention discloses a preservation method of a loop-mediated isothermal amplification reaction reagent mixture. The preservation method realizes long-term preservation of the loop-mediated isothermal amplification reaction reagent mixture at normal temperature or room temperature by adopting the following steps: adding a specific drying protective agent in the loop-mediated isothermal amplification reaction reagent mixture; and then carrying out vacuum drying or quick air drying of the mixture at a temperature lower than 80 DEG C. The preservation method has the advantages of low cost, simple operation and stable persistent activity of dried loop-mediated isothermal amplification reaction reagent mixture at the normal temperature, and the like. Therefore, the preservation method can effectively promote the application of loop-mediated isothermal amplification technology in the fields of medical treatment, inspection and quarantine, and the like, as well as the popularization of loop-mediated isothermal amplification kits.

The present invention relates to a method to detect bibrio parahemolyticus belonging to the technical field of biology, which is characterized in that: DNA template is prepared by centrifugating pure bacterial culture, discarding supernatant fluid, adding 100MuL sterile water for water bathing, ice bathing, centrifugation, removal of supernatant fluid as standby for expansion of the template. In addition, the method adopts primer 5.0 software to design four primer sequences of LAMP primer for bibrio parahemolyticus tlh gene M36437. Besides, loop-mediated isothermal amplification of bibrio parahemolyticus is applied. In detail, it is necessary to prepare a 25uL reaction system and carry out incubation and inactivation. Outcome detection refers to that turbidity of the reaction system is observed with naked eyes. Compared with prior arts, the detecting method of the present invention has the advantages of convenience, reliability, high sensitivity, short time and lower cost as a simple conventional detecting method, particularly adapts to grass-roots inspection and quarantine authorities and breed aquatics and brings great significance to improve food sanitation and boost development of international food trade.

The invention discloses an RT-LAMP (loop-mediated isothermal amplification) rapid detection kit for cucumber green mottle mosaic virus (CGMMV) and a detection method. The method comprises the steps of extracting plant viruses RNA, detecting an RT-LAMP reaction and electrophoresis detection or fluorochrome, and determining whether a plant carries the viruses. An RT-LAMP primer is designed according to a coat protein gene conserved region of CGMMV, and an RT-LAMP technology is adopted to establish a detection technology which can rapidly and sensitively detect the cucurbitaceous plant CGMMV such as cucumbers, watermelons and calabashes with high specificity and an application method thereof in diagnosing disease. The detection method provided by the invention can utilize the rapid extraction RNA and conventional RNA extraction as an RNA template for an RT-LAMP experiment. The method is utilized to rapidly identify a CGMMV plant sample, the targeted quarantine inspection protective measure is adopted, and the loss caused by the disease is reduced.

The invention discloses a salmonella LAMP (loop-mediated isothermal amplification) detection method, and a special primer and kit thereof. The special primer is designed according to a salmonella specific conservative target sequence invA gene shown in sequence 1 in a sequence list, and is used for qualitatively detecting salmonella in a sample to be detected. The invention can realize the fast, convenient, efficient, specific and sensitive detection of salmonella under isothermal conditions without using complicated instruments, thereby providing a new technical platform for salmonella detection. The invention can be used for salmonella screening and detection in livestock farming and production units, grass-root medical health units and various disease prevention and control centers, has broad market prospects and great economic and social benefits, and is suitable for wide popularization and application.

The invention relates to a portable micro-fluidic chip LAMP (loop-mediated isothermal amplification) visible detector and a detection method thereof. The visible detector comprises a box cover and a box body, wherein the box cover and the box body are connected by virtue of a locking plate on the side face; a micro-fluidic chip, a temperature control device and a visible detection system are arranged in the box body; the temperature control device comprises a temperature controller and a heating metal block; the micro-fluidic chip is arranged on the heating metal block; a transparent stopper is arranged around the micro-fluidic chip and the heating metal block; a detachable cover plate is arranged on the transparent stopper; the visible detection system is arranged on the cover plate; and the visible detection system comprises a micro camera and a micro ultraviolet fluorescent lamp. The detection method of the visible detector comprises steps of manufacturing the micro-fluidic chip, injecting a primer and reaction fluid, conducting an isothermal reaction and reading a detection result. The invention further relates to an application of the visible detector. The technical scheme provided by the invention, in comparison with the prior art, achieves the instant detection of an LAMP reaction, so that user's time is effectively saved.

The invention relates to a novel method for detecting Yersinia pestis, the loop-mediated isothermal amplification LAMP is adopted. The invention substantially improves a loop-mediated isothermal amplification method to enhance the detecting specificity and sensitivity.

The invention provides a loop-mediated isothermal amplification (LAMP) method based on a TaqMan probe, and an LAMP primer and a kit special for the same. The loop-mediated isothermal amplification method based on the TaqMan probe, and the LAMP primer and the kit special for the same are used for detecting a target gene. According to the invention, the TaqMan probe is combined with the LAMP technology to solve the problem of nonspecific amplification fundamentally; the loop-mediated isothermal amplification method is capable of detecting the target gene quickly, conveniently and efficiently at high specificity and high sensitivity under the isothermal condition, thus providing a new technology platform for nucleic acid detection; therefore, the loop-mediated isothermal amplification method can be applied to screening and detecting pathogenic bacteria (such as superbacteria) for grass-roots medical treatment and public health units and various disease preventing and control centers, and has wide market prospect and high economic and social benefits; consequently, the loop-mediated isothermal amplification method is suitable for large-range popularization and application.

The invention relates to a cholera toxin virulence gene detection kit and a detection method thereof. The kit of the invention contains three pairs of primers which are designed by using vibrio cholera ctxA gene as target gene on the basis of the loop-mediated isothermal amplification technology, namely inner primers FIP / BIP, outer primers F3 / B3 and ring primers LF / LB and also contains Bst DNA polymerases, reaction solution, sample pretreatment solution, coloring liquid, stabilizing solution and positive control. The method for detecting the cholera toxin virulence gene comprises the following steps: extracting bacterial DNA, performing the loop-mediated isothermal amplification of the cholera toxin virulence gene and coloring for detection. The kit of the invention has high amplificationefficiency, specificity and sensitivity, low omission ratio and obvious coloring effect and is suitable for the rapid detection of toxigenic vibrio cholera.

The invention relates to an enterolobium cyclocarpum knot nematode loop-mediated isothermal amplification (LAMP) rapid detection method and applications. The method comprises the following steps: designing 5 LAMP primers: MEF3, MEB3, MEFIP, MEBIP and MELB in a sequence conversed domain according to an enterolobium cyclocarpum knot nematode ITS sequence of the clone sequencing; configuring a LAMP reaction system; detecting isothermal amplification and amplification product color developing of the enterolobium cyclocarpum knot nematode through extracting the DNA of the enterolobium cyclocarpum knot nematode, thus rapidly detecting the enterolobium cyclocarpum knot nematode. The detection method provided by the invention has strong specific, high sensitivity, low cost and simple operation, and has high application value in the aspects of spot rapid detection and the early-stage diagnosis of the enterolobium cyclocarpum knot nematode.

The invention discloses a method for constructing a double stem loop structure DNA template to detect nucleic acid based on a ligation reaction. The method includes the steps that ligase is used for connecting a probe containing a stem-loop structure and complemented with nucleic acid to be detected to form a double-stem-loop structure DNA template, the template can guide fast and efficient loop-mediated isothermal amplification reaction to achieve high-sensitivity nucleic acid detection, and meanwhile the method can specifically distinguish nucleic acid with single-base difference. It is provided for the first time that double stem loop structure DNA is constructed through the high-specificity ligation reaction, the specificity template is provided for the loop-mediated isothermal amplification reaction in the next step, fluorescence labeling is not needed in the method, cost is low, the precise heat cycle process in the PCR process is avoided, and fast amplification of the nucleic acid to be detected can be realized at constant temperature. The method can be used for quantitative analysis, methylation detection, SNP detection and the like on RNA or DNA and provides a new strategy for high-sensitivity nucleic acid analysis, early cancer diagnosis and other researches.

The invention discloses a group of primers and application thereof in quick detection of nosema bombycis. The primers have the nucleotide sequences as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4. Based on the primers disclosed by the invention, related reagents applied to quick detection of nosema bombycis by an LAMP (Loop-Mediated Isothermal Amplification) method can be prepared by combining a conventional technology in the field, can detect the nosema bombycis by the LAMP method quickly and accurately, are suitable for operation on a small amount of sample and simple to operate, and have important significance in practical application.

The invention relates to a method for detecting tobacco viruses by a reverse transcriptase loop-mediated isothermal amplification (RT-LAMP) technology, which comprises the steps of tobacco virus total ribonucleic acid (RNA) extraction, RT-LAMP reaction, electrophoresis detection and virus type determination, wherein tobacco viruses are selected from two or more than two kinds of viruses from cucumber mosaic viruses (CMV), potato viruses Y (PVY), tobacco etch viruses (TEV), tobacco mosaic viruses (TMV) and tobacco vein banding mosaic viruses (TVBMV). LAMP primers are designed according to a case protein gene conserved region of the tobacco viruses, and a fast, sensitive and high-specificity method is built for detecting various main tobacco viruses by the one-step RT-LAMP technology. A newmeasure is provided for the fast detection of the tobacco viruses.

The invention discloses a Salmonella LAMP (loop-mediated isothermal amplification) primer group and kit and a detection method, belonging to the field of a molecular biological detection method for food safety. The Salmonella LAMP primer group designed by the invention comprises a detection primer group and an internal standard primer group; and the detection kit comprises the Salmonella LAMP primer group, a DNA (deoxyribonucleic acid) polymerase, an LAMP reaction solution, a fluorescent nucleic acid dye, an internal standard, a positive control and a negative control. The detection method comprises the following steps: extracting a sample to be detected, and amplifying the sample template at 63-65 DEG C for 30-45 minutes. Thus, whether the sample to be detected contains Salmonella can be detected, and meanwhile, whether a false negative detection result exists can be judged according to whether the detection internal standard primer group is amplified. The invention has the advantages of high speed, high efficiency, simple operation process, high specificity, high sensitivity and the like, is suitable for on-site detection, can effectively prevent the occurrence of false negative, and is suitable for popularization and application.