78 results about "Pastoralism" patented technology

The present invention relates in general to the field of animal husbandry, and more specifically, to a livestock monitoring system utilizing an unmanned aerial vehicle (“UAV”) and methods of using such systems. The system and method of the present invention for monitoring the health and welfare of livestock comprises six primary components: (1) at least one UAV; (2) a plurality of cameras and sensors; (3) a transmitter; (4) a receiver; (5) a server connected to a computer system for receiving images, video, and data from the plurality of cameras and sensors; and (6) a display for viewing in real-time images, video and data obtained from the plurality of cameras and sensors for monitoring the condition of livestock on a farm or ranch. The purpose of the invention is to provide a convenient and cost-efficient system and method for monitoring the condition of livestock to obtain information in real-time about the behavioral and physiological states of individual animals.

The use of macroalgal, microalgal, and fungally-derived materials provide, in combination with higher-plant derived materials, complete feeds for animal husbandry. The products and methods of the invention provide nutritional feed formulations, that reduce or eliminate the need for animal-derived materials. The feeds are useful for terrestrial or aquatic animals, and comprise docosahexaenoic acid and eicosapentaenoic acid.

The invention relates to a method for mixedly sowing annual ryegrass and perennial grass, which is suitable for establishing artificial grassland in south, in particular to a method for establishing artificial grassland by introducing annual ryegrass onto perennial artificial grassland. The annual ryegrass and the perennial grass are mixedly sowed by a certain proportion. By utilizing the advantages of rapidly growing of the annual ryegrass, the cutting is performed at the right time, the grass yield in season is improved, and the height can be controlled by cutting. Therefore, the growth of the perennial grass can be ensured, the growth of the weeds is inhibited because of insufficient light, and then the weeds gradually disappear from the grass. The invention solves the problems of low grass yield of the artificial grassland established in the current year in south and heavy weeds, thereby being of great significance for popularizing artificial grassland growth in south and promoting the development of grassland agriculture in south.

The invention relates to an oat-common vetch mixed sowing method which is suitable for the alpine areas of the Tibetan plateau. The method is as follows: from the mid-May to the early June per year, seeds are sowed, the sowing depth of the seeds of oat and common vetch is 2-4cm; the seeding rate of the gramineous pasture oat is 150-165kg / hm<2>, the seeding rate of the leguminous pasture common vetch is 75-82.5kg / hm<2>, and oat and common vetch are sowed in a mixed sowing ratio of 2:1. By adopting the mixed sowing method, the yield of the pasture can be increased, the protein content of the pasture can be increased, the palatability of the pasture can be optimized, the soil structure can be improved, the soil fertility can be increased and the bottleneck that the leguminous pasture is lack in the alpine pasturing areas of the Tibetan plateau during the development of the animal industry can be effectively alleviated.

The invention discloses a salmonella LAMP (loop-mediated isothermal amplification) detection method, and a special primer and kit thereof. The special primer is designed according to a salmonella specific conservative target sequence invA gene shown in sequence 1 in a sequence list, and is used for qualitatively detecting salmonella in a sample to be detected. The invention can realize the fast, convenient, efficient, specific and sensitive detection of salmonella under isothermal conditions without using complicated instruments, thereby providing a new technical platform for salmonella detection. The invention can be used for salmonella screening and detection in livestock farming and production units, grass-root medical health units and various disease prevention and control centers, has broad market prospects and great economic and social benefits, and is suitable for wide popularization and application.

The invention belongs to the technical field of breeding industry devices, and particularly relates to an energy-saving water dispenser for stock farming breeding. The energy-saving water dispenser comprises a water tank (1), a tank bottom (2), a water inlet (3) and a water outlet (4), wherein the water inlet (3) and the water outlet (4) are formed in the walls of the two ends of the water tank (1) respectively. The energy-saving water dispenser is characterized in that a far infrared heater (5) is arranged below the tank bottom (2), a heat preservation layer (6) is arranged below the far infrared heater (5), a controller (7) is placed on a supporting frame (8) arranged above the tank bottom (2), a rotating shaft (9) arranged on the supporting frame (8) is connected with a cover plate (10), and a temperature sensor (11) and a ball cock (12) are arranged in the water tank (1). Compared with a water dispenser currently used in a breeding farm, the energy-saving water dispenser is simple in structure, can conveniently heat water in the water tank (1), and is suitable for being massively popularized and used.

The invention belongs to the technical field of animal husbandry, and specifically relates to a method for the ecological captive breeding of goats. According to the method for the ecological captive breeding of goats, a pasture planting base and a sports ground are established, wherein the pasture planting base is used for planting high-yield and high-quality pastures which are used as the feed sources of the captive goats, and the sports ground is used as a sport field for the goats; furthermore, the goat manure and urine in goat pens are collected to make organic fertilizer which is used for the planting fertilization of the pastures; one third of the pasture planting base is used for planting perennial pastures; and two thirds of the pasture planting base is used as an annual pasture planting area which is used for the crop rotation of cold-season and warm-season pastures. According to the method provided by the invention, the obvious conflict of land scramble between the breeding industry and the mountain planting industry is effectively solved and the mountain economic crops are not damaged by the grazed goats any more, so that the safe production is realized, the orderly development of the whole large-scale agriculture is promoted, sustainable development is obtained and eco-friendly development is realized.

A truck for shredding and mixing products for zootechnical use, of the type that comprises, on a chassis (11) with wheels (12) that is self-propelled or towed, a container (13) that is substantially shaped like an inverted frustum, is open in an upper region and contains shredding and mixing means (14) which comprise at least two adjacent rotating main screw feeders (15, 16), each having an external profile (17) that lies on a substantially conical imaginary surface and at which shredding cutters are mounted. Contrast cutters (20) substantially shaped like circular sectors are hinged to the internal wall of the container (13) by means of their respective vertices in a vertical arrangement in substantially radial positions and can be inserted and removed through appropriately provided slots. Auxiliary screw feeders (18, 19), suitable to avoid the formation of stagnation regions, are arranged between the main screw feeders (15, 16), in the regions adjacent to the walls of the container (13).

The invention provides an intelligent livestock system based on the Internet of Things, relates to the field of application sensors, LoRa networks, and artificial intelligence livestock, realizes theautomatic collection of livestock and pasture statuses, stores and analyzes data, and gives an intelligent solution for integrating the Internet of Things technology into the livestock industry. The intelligent livestock system comprises an intelligent livestock software system, a special soil moisture information collection climatological station for a pasture, a livestock wearable device, a visual individual identification module and a livestock wireless network based on an LoRa broadband technology. The livestock personnel, scientific research institutions and regulatory agencies can masterthe conditions of the pasture and livestock in real time for daily management; the linkage between ranchers, experts and supervision departments is realized to provide solutions and rapid support foremergency events; complete livestock bookbuilding is achieved, and a foundation is built for further integrating pastures, slaughter houses and retailer information and realizing whole-course qualitytracing; and a large-range epidemic disease outbreak is predicted and effectively controlled by combining a think tank and a big data analysis technology.

The invention relates to a large-scale farm sign abnormal bird detection method, which comprises the following steps: pre-processing the collected thermographic images for data annotation, then adopting an instance-based segmentation general framework (Mask RCNN) target detection and instance separation method for feature extraction, pixel alignment, target positioning, classification and mask separation for thermal imaging images, by controlling the target detection number of a single image, improving the detection accuracy rate in each image. The method is an attempt in the field of target detection of current thermal imaging images, breaks the limitations brought by the traditional methods, and uses the superior performance of deep learning in image feature processing to improve the robustness and accuracy of a model. The feasibility of the deep learning method in the field of thermal imaging image detection is verified. At the same time, the method can also be extended to the livestock and other fields, thus improving the level of intelligence in the breeding industry in China.

The invention relates to a livestock farm sterilization device used for stock farming. The livestock farm sterilization device is novel in structure and high in working efficiency; and operation is simple. The livestock farm sterilization device comprises a base plate, a left support, a first sliding rail, first sliding blocks, a first toothed bar, a second toothed bar, a bearing pedestal, first supporting rods, a first toothed wheel, a rotating shaft, annular sliding rails, a connection plate, second sliding blocks, and a second supporting rod; the right side of the top part of the base plate is symmetrically provided with the first supporting rods ; and the top end of each first supporting rod is provided with one of the annular sliding rails. The structure is novel; operation is simple; working efficiency is high; the livestock farm sterilization device can be used for spraying sanitizers uniformly in livestock farms, high efficiency sterilization is realized, and a travel switch is capable of simplifying device operation.

The invention relates to a stepped horizontal subsurface flow constructed wetland combined system and application thereof. The combined system is built along clinoform and comprises multiple stages of stepped horizontal subsurface flow constructed wetland units which are distributed in a stepped mode from top to bottom according to the slope gradient, and a pipe network unit through which all the stages of stepped horizontal subsurface flow constructed wetland units are communicated. The side face water inlet mode is adopted for the stepped horizontal subsurface flow constructed wetland units. Water flow in the stepped horizontal subsurface flow constructed wetland units horizontally flows in the length direction of the stepped horizontal subsurface flow constructed wetland units. Compared with the prior art, the limitation of terrains on application of constructed wetlands is broken through, slope space can be fully used, the structure is simple, construction is easy and convenient, cost is low, the stepped horizontal subsurface flow constructed wetland combined system and application can be widely applied to processing of various types of sewage such as domestic sewage, municipal sewage, industrial wastewater, animal husbandry sewage, agricultural surface resource pollution, surface flow and tail water of sewage treatment plants in slope areas such as mountainous regions, hills and water body banks, and the application range of constructed wetlands is greatly widened.

The invention mainly relates to a method for identifying authenticity of a medicago sativa seed and special primers thereof, in particular to a gene detection kit of medicago sativa and melilotus albus and a detection method thereof. The kit for identifying the authenticity of the medicago sativa seed is mainly characterized in that: the total volume of a medicago sativa PCR (Polymerase Chain Reaction) detection system is 20 mul; and the kit comprises 2*PCR Master, the special primer MsITS-F (5'-3'): TTTTTGAACGCAAGTTGCGC and the special primer MsITS-R (5'-3'): CAACCAACCACGAGACAGA and ddH2O. Detection result shows that the technology can be used for identifying the authenticity of the medicago sativa seed, has the characteristics of high sensitivity, high accuracy, high repeatability, quickness, convenience and the like, has broad application prospect in medicago sativa industrial promotion of China, can guarantee that the production of livestock husbandry of China is served by the medicago sativa well and lays a solid foundation for guaranteeing grain safety of China.

The present invention discloses an artificial method for breeding seeds of the Tibetan wild Baqing lyme grass; with the method, people collect the seeds of the wild Baqing lyme grass and break the dormancy of seeds; people choose the sowing soil for fertilizing, irrigation, spraying plant growing regulator and implement artificial auxiliary pollination until the field management after the seeds are harvested; the method solves the existent problem of artificial breeding of wild Baqing lyme grass seeds; with the method, the production and quality of the seeds of Baqing lyme grass can be promoted and the Baqing lyme grass can be further utilized in the plant restoration in degenerated pasture, ecological construction and pasture stockbreeding production on the Qinghai and Tibet plateau.

The invention relates to a successful cutting propagation method of desert caragana, which comprises the following steps of: selecting a strongly growing bush as a maternal plant, and respectively scissoring a twig, a hard branch and a taproot of the desert caragana for cutting; putting the twig of the desert caragana into 100ppm of growth regulator solution, wherein the soaking depth is 2-3 centimeters, and the soaking time is 6.5-10 hours; putting the hard branch into 500ppm of growth regulator solution, wherein the soaking depth is 2-3 centimeters, and the soaking time is 1-3 hours; soaking the cutting of the taproot in 50ppm of growth regulator solution for 18-20 hours; and selecting a position with flat land and good drainage for arranging a cutting bed, selecting sandy soil as a cutting ground mass, cutting at the depth of 4-5 centimeters, watering after cutting, setting up a shading net in time, watering once every five days, tearing off the shading net after one month, and counting the survival rate after three months. An experiment result indicates that the processing method can ensure the success of the cutting propagation of the desert caragana, and provide abundant germ plasm resources for ecological restoration and stockbreeding production in desert regions.

The invention relates to the technical field of livestock breeding, in particular to a green ecological breeding method for silky fowls. The method specifically includes the steps of selecting a sandy soil slope with woods for breeding under the woods, and adding decoction of safe and original ecological Chinese herbal medicine including buddleia officinalis, caesalpinia minax and licorice into pollution-free feed to prevent and cure diseases of silky fowl groups. Due to the fact that no feed additive is used, antibiotics and veterinary medicine are avoided, it is guaranteed that produced silky fowls are green products, a light buddleia officinali fragrance rises from silky fowl meat, and the quality is greatly improved. Meanwhile, the land resources are protected to the maximum degree, and green ecological breeding is achieved.

The invention discloses a method for planting oat in a spring wheat field vacant in summer and autumn. According to the method for planting oat in the spring wheat field vacant in summer and autumn, through a series of technical means such as soil preparation, irrigation, sun-curing, seed selection, sowing, field management and harvesting, the problems that due to the fact that the spring wheat field is vacant in summer and autumn, the land utilization rate is low, cultivated land waste is caused, the soil moisture status deteriorates, and conflict between grass and livestock is caused are solved, grain is grown in the spring wheat field in spring, grass is grown in the spring wheat field in summer and autumn, the light resource, heat resource and water resource are fully utilized, the multiple crop index and land equivalent are increased, the contradiction between people and land is relieved, the land utilization rate can be increased, the soil water content and soil nutrient content are increased, high-quality forage is provided for the development of animal husbandry, the yield of high-quality oat hay can be 600-800 kg / 667 m<2>, economical benefits can be increased, and compared with the prior art that multiple cropping is not conducted, the net income can be increased by 580-900 yuan per mu.

The present invention belongs to the technical field of ecological cultivation, and especially relates to a forest, goose and fish stereo ecological cultivation method. The stereo ecological cultivation method mainly comprises (1) land addressing requirement, (2) partition layout design, (3) cultivation density arrangement, and (4) cultivation operation and the like. According to the stereo ecological cultivation method, through organic combination, scientific collocation and advantage complementation of the planting industry, animal husbandry and aquaculture industry, nutrient substance is metabolized to cultivation waste water along with a chain of forest ( and supplementary feeding fodder), goose, goose manure, fish (and forest) and pond water layer by layer, egg goose cultivation period is shorted, goose egg quality is improved, good natural ecological circulation is achieved, land use efficiency is also improved, the purpose of pollutants discharge reduction is achieved, economic benefit is largely increased, the advantage of forest, goose and fish stereo cultivation is comprehensively embodied, and the whole industry chain is improved.

The invention relates to the technical field of livestock farming, and discloses a livestock farming water supply tank convenient to use. The livestock farming water supply tank convenient to use comprises a water supply tank body; a supporting frame is fixedly mounted on the right side of the top of the water supply tank body; a connecting rope is arranged at the bottom of the supporting frame in a surrounding manner; the bottom end of the connecting rod is arranged on a thermometer in a surrounding manner; the bottom end of the thermometer is positioned in the water supply tank body; an activated carbon adsorption plate is arranged in the water supply tank body; filtering nets are arranged in the water supply tank body and are positioned on the upper side and the lower side of the activated carbon adsorption plate. According to the livestock farming water supply tank convenient to use, a system is formed by a first hinge seat, a hydraulic telescopic rod and a second hinge seat and is matched with a system which is formed by a movable connecting seat and a supporting rod, so that the water supply tank body can be inclined at a certain angle to facilitate continuous drinking of livestock by stretching the hydraulic telescopic rod after the livestock drink for a period of time and the water level is reduced obviously; therefore, resources are saved; the livestock farming water supply tank is more convenient to use.

The invention discloses a method for producing western wheatgrass seeds. In the method, 0.9-2.1kg / hm<2> of effective components of a plant growth regulator PP333 is sprayed on leaf surface of the western wheatgrass for 2-3 times every 5-7 days from late stage in turning green to the prophase of jointing of the western wheatgrass, thus greatly reducing plant height, effectively avoiding plant lodging and substantially improving the output and quality of the seed, which ensures that extensive application of the western wheatgrass in excellent pasture variety in revegetation and ecological conservation of deteriorated grassland, grassland agriculture and production practice of pasture grass seeds. The method has simple production method, low cost and simple operation, can substantially improve the output of the western wheatgrass seeds and the seed quality to some extent, and have good popularization and application prospect.

The invention relates to the technical field of livestock and discloses a breeding hencoop capable of providing convenience for cleaning away feces. The hencoop includes a base, three breeding cages are fixedly installed on each of two sides of the top of the base, and three partition net plates are fixedly installed in each breeding cage and divide the interior of the breeding cage into a first breeding chamber, a second breeding chamber, a third breeding chamber and a storage chamber from top to bottom in sequence. According to the breeding hencoop capable of providing convenience for cleaning away the feces, through water outlet pipes, water collecting pipes and a water inlet pipe, the feces can be effectively cleaned away; the water inlet pipe is connected to an external water source,water is gathered and stored by the water collecting pipes and ejected out by the water outlet pipes, and since the water outlet pipes are arrayed at equal intervals, the feces in collecting grooves is effectively cleaned away; since the feces can be effectively diluted by the water, under cooperation with scraping plates for use, the feces is more effectively and conveniently cleaned away, the efficiency of cleaning away the feces is effectively improved, and the labor intensity is effectively reduced.

The invention discloses a method for interplanting clovers in sugarcane fields to realize high-efficient utilization of sugarcane field resources, make full use of space, save land cost and increase economic benefit per unit field area. Clovers and sugarcanes require different soil nutrients, which realizes nutrient complementation between clovers and sugarcanes. Clovers are leguminosae plants, fix nitrogen and provide sugarcanes with sufficient nutrients. In this way, fertilizer used can be reduced, cost is lowered, and chemical pollution is reduced. The sugarcanes provide shade for clovers, which allows clovers to better grow in southern China with strong sunlight. Excellent food source can be provided to stock farming in southern China.

The invention discloses a method for intercropping baby cabbage and forage grass oat. In particular, a baby cabbage and forage grass oat intercropping mode is adopted, so that field weeds growing at the seedling stage of baby cabbage can be restrained effectively, field closure of baby cabbage is reduced, the utilization ratios of the resources of light, temperature, water and soil are increased, and the yield of forage grass is increased. The method comprises the following steps: controlling inter-row weeds of the baby cabbage at the seedling stage of the baby cabbage by adopting forage grass oat, and preserving soil and water; selecting an upright forage grass oat variety having the characteristics of cutting resistance, high reproducibility and large leaf amount, cutting in time at the vegetative growth phase of oat, and controlling the stubble height to ensure regeneration of oat in order to avoid field closure of baby cabbage; harvesting the baby cabbage, scattering residual stems and leaves onto baby cabbage lines to realize straw turnover; after harvesting baby cabbage, applying urea in time to promote the growth of he oat, wherein the residual fertility of the baby cabbage lines can be effectively utilized by oat. By adopting the method, the problem of diseases of the baby cabbage caused by abnormal temperature in winter can be relieved, the spare seasons after the harvest of vegetables are effectively utilized, the popularization of the oat in winter fallow farmlands in southern areas is promoted, and forage grass supply in winter and spring in the herbivorous livestock in southern areas is ensured.

The invention relates to a cowshed cooling device and in particular relates to a cowshed cooling device for stock farming. The cowshed cooling device can quickly cool, shield sunlight and promote air circulation. The cowshed cooling device comprises a cowshed, a cylinder body, a water tank, a water inlet pipe, a first one-way valve, a piston, a push rod, a first motor, a connection rod, a cam, a movable plate, a first spring and a ventilating window, wherein the cowshed and the cylinder body are fixed on the ground; the cylinder body is arranged on the right of the cowshed; the water tank is installed on the ground and under the right-lower side of the cylinder body; the water inlet pipe is arranged between the right lower part of the water tank and the left lower part of the cylinder body; the first one-way valve is disposed in the water inlet pipe; the piston is disposed in the cylinder body; and a push rod is vertically arranged on the top of the piston. Effects of quick cooling, sunlight shield and air circulation can be achieved by the use of the cowshed cooling device.

The invention belongs to the field of livestock husbandry, and particularly relates to a pad and feed strains as well as a bioisolation combined non-resistant breeding method which is characterized by comprising the following three aspects of: (1) adding pad strains to the pad to prepare a fermentation bed; (2) adding feed strains to the feed; and (3) planting greening trees and Chinese medicinalherbs with disinfection effect to replace the isolation belts between adjacent breeding houses. By adopting the method, the breeding environment is obviously improved, the breeding income is increased, the breeding cost and breeding risk are reduced, and powerful guarantee is provided for obtaining high-quality non-resistant products.

The invention relates to a stock farming environment monitoring system based on a big data platform. The stock farming environment monitoring system based on the big data platform is characterized bycomprising a processor, a transmission network, a cloud computing platform, a user terminal, a detection and collection device group, an RFID reader, an animal terminal, a power module, a weight detection device, a camera, a drive circuit and a feeding and improving device, wherein the detection and collection device group comprises a drinking water level detection device, a humidity collection device, a temperature collection device, a CO2 detection device and a weight detection device, the feeding and improving device comprises a water supply device, a feed supply device, a humidifier, a heater, a ventilator and a refrigerator, and the animal terminal comprises an RFID electronic tag and a GPS. The stock farming environment monitoring system based on the big data platform has the advantages that the system is simple in structure, easy to set up and implement and capable of monitoring the living environment of the livestock and poultry in real time and reminding monitoring personnel timely; the system with the cloud computing platform can be used for storing a great quantity of information and downloading and checking the information by feeders conveniently anytime and anywhere.

The invention relates to a process for preparing a feed additive used in livestock and poultry raising industry, in particular to a method for manufacturing a yeast culture additive for livestock and poultry by utilizing crop stalks. The preparation method comprises the following steps: preparation of solid medium: according to the weight portion, crop stalks, starch 1, peanut meal and calcium chloride are evenly mixed to obtain a solid medium mixture; the solid medium mixture is evenly mixed with water according to a certain ratio, put in a sterilizer for sterilization for 30 minutes, and taken out for natural cooling; according to the weight of the solid medium, the yeast is added; the yeast and the solid medium are evenly stirred and subjected to fermentation and drying, and the drying matters are finished products. The invention contains abundant living yeast, amino acids, low molecular peptides and other active compositions, and can improve the producibility of livestock and poultry and improve the health condition of the livestock and poultry; moreover, the novel feed is developed by utilizing abundant stalk resources, which provides a new and effective path for the development of Chinese forage-saving stock raising industry, and the serious environmental pollution caused by the stalk burning is also avoided.

The invention relates to a breeding system for stock farming based on the internet of things. The breeding system comprises a cross beam, a water production mechanism, a breeding shed and a feeding mechanism. The water production mechanism comprises an air intake assembly, a filtering assembly, a condensation assembly and a water storage assembly which are sequentially communicated, wherein the air intake assembly comprises an air intake fan and a plurality of vent holes formed in the cross beam. In the breeding system for stock farming based on the internet of things, air collection is performed through the air intake fan, then layer-by-layer filtration is performed through filter layers in a filter element, and the reliability of air filtration is ensured; then, air enters a heat exchange assembly, air condensation is performed by a heat exchanger to produce condensed water, accordingly online water production of the system is achieved, and the practicability and intelligentization of the system are improved. Moreover, the water level can be accurately controlled through a liquid level detecting assembly in the feeding mechanism, and accordingly the reliability of the breeding system is ensured.

The invention relates to a multi-function mosquito and fly-catching lamp for livestock farms, and in particular relates to the technical field of mosquito eradication equipment of livestock husbandry. A handle (1) is buckled at the upper end of a top cap (2), and the lower end of the top cap (2) is provided with a mosquito-fly entering rack (9). The lower end of the mosquito-fly entering rack (9) is provided with a mosquito-fly collecting bucket (14), and the port of the mosquito-fly collecting bucket (14) is sheathed with a mosquito-fly sucking funnel (12). The lower end of the mosquito-fly sucking funnel (12) is provided with a pair of one-way door (13), and the bottom of the mosquito-fly collecting bucket (14) is provided with a suction fan (18). The outer side of the mosquito-fly collecting bucket (14) is sheathed with a rear cover body (15) and a front cover body (16).