Unlock instant, AI-driven research and patent intelligence for your innovation.

Enterolobium cyclocarpum knot nematode loop-mediated isothermal amplification (LAMP) rapid detection method and application

A technology for root-knot nematode and detection method, which is applied in the directions of biochemical equipment and methods, microbial determination/inspection, etc., to achieve the effects of strong specificity, simple operation steps and high sensitivity

Inactive Publication Date: 2011-09-07
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF0 Cites 20 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no relevant report on Meloidogyne elegans

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Enterolobium cyclocarpum knot nematode loop-mediated isothermal amplification (LAMP) rapid detection method and application
  • Enterolobium cyclocarpum knot nematode loop-mediated isothermal amplification (LAMP) rapid detection method and application
  • Enterolobium cyclocarpum knot nematode loop-mediated isothermal amplification (LAMP) rapid detection method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0090] Example 1 Extraction, rDNA-ITS Amplification and Sequence Analysis of Meloidogyne elegans DNA

[0091] 1.1 Extraction of Meloidogyne elegans DNA

[0092] Pick a single-headed root-knot nematode and place it in a container containing 10 μ lddH 2 Add 8 μl of LB (lysis buffer) solution and 2 μl of proteinase K solution to a 0.2ml centrifuge tube of O. After inching and centrifuging, put it into liquid nitrogen, then put it into a water bath at 3°C, and put it into liquid nitrogen after it melts. , repeat 6-7 times, and then freeze at -8°C for 30min. Then take out the centrifuge tube, incubate at 6°C for 90min, react at 9°C for 10min, and use it directly as a nematode DNA template for LAMP and PCR reactions.

[0093] 1.2 Amplification and sequence analysis of rDNA-ITS of Meloidogyne elegans

[0094] The general primers rDNA1 (5'-TTGATTACGTCCCTGCCCTTT-3') and rDNA2 (5'-TTTCACTCGCCGTTACTAAGG-3') of the ITS region were used to amplify the fragments of the ITS regions of two...

Embodiment 2

[0095] Example 2 Establishment of LAMP technique for detecting root-knot nematode Elephant ear

[0096] 2.1 LAMP primer design

[0097] According to the sequencing results of the ITS sequence of Meloidogyne elegans, the following LAMP primers were designed and screened, and the primers were synthesized by Shanghai Bioengineering Technology Service Co., Ltd. The primer sequences are as follows:

[0098] ①MF3: 5’-GGCTGTATATGTGGTGACAT-3’

[0099] ②MB3: 5’-AGTTCGCAAAACTTATCGC-3’

[0100] ③MFIP: 5'-GAAAAAAAGAGTGCTGGCGTCCGTTAGGACTAAATGAGTTT-AAGACT-3'

[0101] ④MBIP: 5'-AACAAAATTCCTAGCCTTTCCGGAGTTTGCTGCGTTTCTTCA-3'

[0102] ⑤ MELB: 5'- TGGATCACTAGGCTCGTGGATCG -3'

[0103] 2.2 LAMP reaction system configuration:

[0104] Primer mixture: outer primer MEF3 and MEB3 each 0.2 μmol / L, inner primer MEFIP and MEBIP each 1.6 μmol / L, loop primer MELB 0.4 μmol / L,

[0105] Reaction mixture: 10mmol / L dNTP, 20mmol / L Tris-HCl (pH 8.8), 10mmol / L KCl, 5mmol / LMgSO 4 , 10mmol / L (NH 4 ) 2 S...

Embodiment 3

[0107] Embodiment 3 LAMP method detects root-knot nematode Elephant ear in different geographical populations

[0108] Two kinds of root-knot nematodes collected in our laboratory were tested by LAMP. After mixing the above-mentioned primer mixture and reaction mixture evenly, 1 μl template DNA was added and carried out according to the reaction conditions in 2.3. After the reaction was completed, 2 μl was added to prepare After mixing a good developer, observe the color change (such as image 3 Shown in A in ), green fluorescence can be seen in the tube with DNA of Meloidogyne elegans, and the negative control is reddish brown. Get 2 μ l of the product and electrophoresis on 2% agarose gel, stain with EB, observe and take pictures under ultraviolet light (such as image 3 (shown in B), the characteristic ladder-shaped band of LAMP can be seen in lanes 1-2, and no amplification product was found in the negative control.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an enterolobium cyclocarpum knot nematode loop-mediated isothermal amplification (LAMP) rapid detection method and applications. The method comprises the following steps: designing 5 LAMP primers: MEF3, MEB3, MEFIP, MEBIP and MELB in a sequence conversed domain according to an enterolobium cyclocarpum knot nematode ITS sequence of the clone sequencing; configuring a LAMP reaction system; detecting isothermal amplification and amplification product color developing of the enterolobium cyclocarpum knot nematode through extracting the DNA of the enterolobium cyclocarpum knot nematode, thus rapidly detecting the enterolobium cyclocarpum knot nematode. The detection method provided by the invention has strong specific, high sensitivity, low cost and simple operation, and has high application value in the aspects of spot rapid detection and the early-stage diagnosis of the enterolobium cyclocarpum knot nematode.

Description

technical field [0001] The invention relates to a rapid detection method and application of LAMP for root-knot nematode elegans, belonging to the field of biotechnology. Background technique [0002] Root-knot nematode (Meloidogyne spp.) belongs to plant root obligate endoparasite, is the main pathogen that threatens agricultural production worldwide and is the object of plant quarantine in various countries in the world. There are more than 70 species of root-knot nematodes recorded so far, among which M.incognita, M.javanica and M.arenaria are due to their wide distribution and multi-host Sex is the most important kind. [0003] In my country, these three kinds of root-knot nematodes occur in most provinces (regions), infecting more than 100 kinds of crops, causing the host to reduce production by 15-25% all the year round, sometimes reaching more than 70% (Xu Jianhua et al. 1994), serious This severely restricts the production and export of greenhouse vegetables, fruit t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor 彭德良何旭峰彭焕
Owner INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI