Enterolobium cyclocarpum knot nematode loop-mediated isothermal amplification (LAMP) rapid detection method and application
A technology for root-knot nematode and detection method, which is applied in the directions of biochemical equipment and methods, microbial determination/inspection, etc., to achieve the effects of strong specificity, simple operation steps and high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0090] Example 1 Extraction, rDNA-ITS Amplification and Sequence Analysis of Meloidogyne elegans DNA
[0091] 1.1 Extraction of Meloidogyne elegans DNA
[0092] Pick a single-headed root-knot nematode and place it in a container containing 10 μ lddH 2 Add 8 μl of LB (lysis buffer) solution and 2 μl of proteinase K solution to a 0.2ml centrifuge tube of O. After inching and centrifuging, put it into liquid nitrogen, then put it into a water bath at 3°C, and put it into liquid nitrogen after it melts. , repeat 6-7 times, and then freeze at -8°C for 30min. Then take out the centrifuge tube, incubate at 6°C for 90min, react at 9°C for 10min, and use it directly as a nematode DNA template for LAMP and PCR reactions.
[0093] 1.2 Amplification and sequence analysis of rDNA-ITS of Meloidogyne elegans
[0094] The general primers rDNA1 (5'-TTGATTACGTCCCTGCCCTTT-3') and rDNA2 (5'-TTTCACTCGCCGTTACTAAGG-3') of the ITS region were used to amplify the fragments of the ITS regions of two...
Embodiment 2
[0095] Example 2 Establishment of LAMP technique for detecting root-knot nematode Elephant ear
[0096] 2.1 LAMP primer design
[0097] According to the sequencing results of the ITS sequence of Meloidogyne elegans, the following LAMP primers were designed and screened, and the primers were synthesized by Shanghai Bioengineering Technology Service Co., Ltd. The primer sequences are as follows:
[0098] ①MF3: 5’-GGCTGTATATGTGGTGACAT-3’
[0099] ②MB3: 5’-AGTTCGCAAAACTTATCGC-3’
[0100] ③MFIP: 5'-GAAAAAAAGAGTGCTGGCGTCCGTTAGGACTAAATGAGTTT-AAGACT-3'
[0101] ④MBIP: 5'-AACAAAATTCCTAGCCTTTCCGGAGTTTGCTGCGTTTCTTCA-3'
[0102] ⑤ MELB: 5'- TGGATCACTAGGCTCGTGGATCG -3'
[0103] 2.2 LAMP reaction system configuration:
[0104] Primer mixture: outer primer MEF3 and MEB3 each 0.2 μmol / L, inner primer MEFIP and MEBIP each 1.6 μmol / L, loop primer MELB 0.4 μmol / L,
[0105] Reaction mixture: 10mmol / L dNTP, 20mmol / L Tris-HCl (pH 8.8), 10mmol / L KCl, 5mmol / LMgSO 4 , 10mmol / L (NH 4 ) 2 S...
Embodiment 3
[0107] Embodiment 3 LAMP method detects root-knot nematode Elephant ear in different geographical populations
[0108] Two kinds of root-knot nematodes collected in our laboratory were tested by LAMP. After mixing the above-mentioned primer mixture and reaction mixture evenly, 1 μl template DNA was added and carried out according to the reaction conditions in 2.3. After the reaction was completed, 2 μl was added to prepare After mixing a good developer, observe the color change (such as image 3 Shown in A in ), green fluorescence can be seen in the tube with DNA of Meloidogyne elegans, and the negative control is reddish brown. Get 2 μ l of the product and electrophoresis on 2% agarose gel, stain with EB, observe and take pictures under ultraviolet light (such as image 3 (shown in B), the characteristic ladder-shaped band of LAMP can be seen in lanes 1-2, and no amplification product was found in the negative control.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 