Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

339 results about "Aeromonas hydrophila" patented technology

Aeromonas hydrophila is a heterotrophic, Gram-negative, rod-shaped bacterium mainly found in areas with a warm climate. This bacterium can be found in fresh or brackish water. It can survive in aerobic and anaerobic environments, and can digest materials such as gelatin and hemoglobin. A. hydrophila was isolated from humans and animals in the 1950s. It is the most well known of the species of Aeromonas. It is resistant to most common antibiotics and cold temperatures and is oxidase- and indole-positive.

Lactobacillus plantarum and application thereof

The invention discloses lactobacillus plantarum GLM101 and an application thereof in preparing a feed additive. The strain is preserved in the China General Microbiological Culture Collection Center (CGMCC) with the preservation number CGMCC No. 11156. The lactobacillus plantarum GLM101 has very strong inhibiting ability for escherichia coli, staphylococcus aureus, salmonella typhi, vibrio vulnificus and aeromonas hydrophila, and also has excellent acid-resisting and cholate-resisting abilities. The lactobacillus plantarum GLM101 can be used for adjusting the microecological balance inside the intestines of animals, has the action of enhancing the nonspecific immunity function to prevent diseases, and also can provide trophic factors, promote digestive absorption of nutrients, promote growth of animals, and improve the feed conversion ratio.
Owner:GUANGZHOU GLAM BIOTECH

Fourteen-food-borne pathogenic bacterium multiplex PCR detection primer set and kit

The invention discloses a fourteen-food-borne pathogenic bacterium multiplex PCR detection primer set and a kit. The detection primer set is composed of primer pairs for detecting salmonella, Shigella, Vibrio parahemolyticus, campylobacter jejuni, campylobacter coli, staphylococcus aureus, bacillus cereus, Listeria monocytogenes, yersinia enterocolitica, enterobacter sakazakii, Escherichia coli, vibrio cholerae, Escherichia coli O157, aeromonas hydrophila and internal positive control. A multiplex PCR detection method based on an ordinary PCR platform is built, multiplex PCR reactions are carried out on genomic DNA, extracted from a sample to be tested, of bacteria in the same reaction system through the primer pairs acquired through analysis and design, and whether the food-borne pathogenic bacteria are contained in the sample or not is judged through the electrophoretic analysis of reaction products.
Owner:北京卓诚惠生生物科技股份有限公司

Method for extracting chlorogenic acid from Eucommia leaves and use thereof

The invention discloses a method for extracting chlorogenic acid from folium cortex eucommiae. The invention also discloses an application of the chlorogenic acid in prevention substances of fish diseases. The method comprises the steps of grinding, enzyme treatment, ultrasonication, filtering, extraction, concentration, purification, and the like; the method has the advantages of simple and convenient technique operation, low cost, no hazardous solvent, high yield, being applicable to industrialized production, and the like; in addition, the chlorogenic acid has good bacteriostasis effect on pathogenic bacteria commonly seen in aquiculture, with a bacteriostasis effect on aeromonas hydrophila equal to that of antibacterials like antibiotics, can strengthen the immunity of the organism and has relatively strong prevention effect on bacterial diseases.
Owner:江苏省苏微微生物研究有限公司

LAMP (Loop-mediated Isothermal Amplification) detection kit and method of pathogenic aeromonas hydrophila

The invention relates to an LAMP (Loop-mediated Isothermal Amplification) detection kit of pathogenic aeromonas hydrophila, having convenient use and rapid detection. The LAMP detection kit comprises a bacterium DNA extracting reagent and an LAMP reaction reagent, wherein the reaction reagent contains primers FIP with the sequence of GTTTCCCCCATCAGATCCGTGGTTTACGCCACCCAGTTTCTTG, BIP with the sequence of TCCGGCCTGTATACCTGTATCAGGTTAAACCAGGGTGTCATCGCT, F3 with the sequence of TGATGGCCACGAGACATCCA and B3 with the sequence of TGCTTGATCCCCTTGCTACT. The LAMP detection method of the pathogenic aeromonas hydrophila comprises the following steps of: (1) DNA (Deoxyribonucleic Acid) extraction; (2) LAMP amplification of the pathogenic aeromonas hydrophila; and (3) staining detection. The invention is suitable for detecting the pathogenic aeromonas hydrophila.
Owner:ZHEJIANG INST OF FRESH WATER FISHERIES

Bacillus amyloliquefaciens strain as well as preparation method and application of strain powder preparation of bacillus amyloliquefaciens strain

The invention discloses a bacillus amyloliquefaciens strain as well as a preparation method and application of a strain powder preparation of the bacillus amyloliquefaciens strain, and belongs to the technical field of microorganisms. The bacillus amyloliquefaciens JSSW-LA, which is obtained through screening, is preserved in China Center for Type Culture Collection with preservation number of CCTCC NO: M2015602. The strain powder preparation of the bacillus amyloliquefaciens, which is prepared through freeze-dried culture activation, fermentation culture and strain powder preparation, is applicable to an additive of fishery breeding feed or a water quality improver of aquaculture; the bacillus amyloliquefaciens JSSW-LA provided by the invention is capable of effectively inhibiting the growth of A.sobria, A.hydrophila, A.caviae, aeromonas veronii and edwardsiella tarda, and an inhibitory effect on the A.sobria, A.hydrophila and A.caviae is more excellent than that on other pathogenic bacteria. Therefore, the JSSW-LA strain powder, applied to aquaculture, is capable of effectively preventing and controlling diseases in aquaculture animals caused by pathogenic bacteria, in particular bacterial bleeding disease, so as to protect the healthy growth of aquatic animals.
Owner:江苏省苏微微生物研究有限公司 +2

Reagent for detection of pathogenic hydrophila gingivalis and detection method thereof

The invention discloses a reagent for detecting pathogenic aeromonas hydrophila, which comprises the following solutions: 1 milliliter of 10xPCR buffer solution, 60 microliters of Pf solution, 60 microliters of Pr solution, 1 milliliter of 2xPCR water and 30 microliters of Taq enzyme. The invention also relates to a detection method which applies the reagent for detecting the pathogenic aeromonas hydrophila. The reagent has the characteristics of high sensitivity, strong specificity and easily obtained template materials, and the detection method has the characteristics of simple and convenient operation and quickness and time conservation.
Owner:INSPECTION & QUARANTINE TECH CENT OF FUJIAN ENTRY EXIT INSPECTION & QUARANTINE BUREAU

High-content liquid povidone-iodine

The invention relates to antisepsis and anti-inflammation medicaments, and particularly relates to high-content liquid povidone-iodine. The liquid povidone-iodine is prepared from the following raw materials in percentage by weight: 5.2-12.24 percent of iodine, 10-24 percent of polyvinylpyrrolidone, 2-4.8 percent of potassium iodide, 0.1-0.24 percent of potassium iodate, 15-36 percent of ethanol and the balance of water. The high-content liquid povidone-iodine is a reddish brown viscous liquid, is easily dissolved in water, has stable performance, strong sterilization efficacy and no irritation, is suitable for sterilization of operating parts and skin-mucosa or sterilization of aquatic water, can be used for preventing and treating bacteriosis of aquatic animals caused by vibrio, aeromonas hydrophila, edwardsiella tarda and the like and sterilizing the environment of livestock and poultry housings, plays a role in killing multiple bacteria, spores, viruses, fungi and the like, thus being a good iodine containing medical bactericide and epidemic prevention sanitizer.
Owner:SHENLONG APPL TECHN TAIYUAN CITY SHANXI PROV

PCR test kit for hygrophilous aeromonad and its test method

The PCR test kit for detecting hygrophilous aeromonad includes primer, dNTP, buffering solution and DNA polymerase, and its upstream primer is 5-CCAAGGGGTCTGTGGCGACA-3í» and downstream primer is 5í»-TTTCACCGGTAACAGGATTG-3í». The PCR test method includes providing sample template; mixing in PCR thin-wall tube dNTP, MgCl2, buffer, primer, DNA, polymerase, tested sample and ddH2O; amplifying the mixture in PCR instrument; electrophoresing the amplified product in electrophoresis equipment while recording result; and analysis and judgment. The PCR test kit is easy to produce and the test method has high sensitivity, short test period, high test precision reaching 10 aeromonad or 1 ng template DNA, and relatively low test cost.
Owner:福建省农业科学院生物技术中心

Bacillus amyloliquefaciens and its bacterial depressant and use

The invention relates to Bacillus amyloliquefaciens V4. The Bacillus amyloliquefaciens V4 is preserved in the China general microbiological culture collection center and has a preservation number of CGMCC NO. 10149. The Bacillus amyloliquefaciens V4 strain and / or microbial agent can produce bacteriocin for antagonizing vibrio pathogens and pathogenic aeromonas at seedling growing and culture temperatures of common culture water, inhibit vibrio vulnificus, vibrio natriegen, vibrio harveyi, black sea vibrio, aeromonas hydrophila and aeromonas salmonicida growth and breeding, effectively control aquatic animal infectious disease generation and propagating caused by vibrio pathogens and pathogenic aeromonas, reduce aquatic animal mortality and a forage coefficient and promote aquatic animal weight gain.
Owner:INST OF MICROBIOLOGY - CHINESE ACAD OF SCI

Immobilized microbial consortium useful for rapid and reliable BOD estimation

An immobilized microbial consortium is formulated which comprises of a synergistic mixture of isolated bacteria namely, Aeromonas hydrophila, Pseudomonas aeruginosa, Yersinia enterocolitica, Serratia liquefaciens, Pseudomonas fluoresces, Enterobacter cloaca, Klebsiella oxytoca, Citrobacter amalonaticus and Enterobacter sakazaki. The formulated microbial consortium is immobilized on charged nylon membrane. The said immobilized microbial consortium is attached to dissolved oxygen probe for the preparation of electrode assembly. The prepared electrode assembly is used for rapid and reliable BOD estimation. The prepared electrode assembly is used for monitoring of BOD load of synthetic samples such as Glucose-Glutamic acid (GGA) used as a reference standard in BOD analysis and industrial effluents; covering a range from low to high biodegradable organic matter.
Owner:COUNCIL OF SCI & IND RES

Bacillus velezensis, and micro-ecological preparation and preparation method thereof

The invention relates to a Bacillus velezensis, and a micro-ecological preparation and preparation method thereof. The Bacillus velezensis is preserved in China Center for Type Culture Collection, hasa strain preservation number of CCTCC NO: M 2019218, and is classified and named as Bacillus velezensis BvL03, and the Latin academic name is Bacillus velezensis BvL03. The micro-ecological preparation suitable for aquiculture prepared by the strain has broad-spectrum effect of inhibiting fish pathogenic bacteria through drug-delivery routes such as feed addition, water body sprinkling or intraperitoneal injection, and the protection rate reaches 85 percent. After acting on fish bodies, the preparation can effectively prevent fish pathogenic bacteria such as aeromonas hydrophila from infecting freshwater fishes such as grass carps and crucian carps, and particularly has the best protection effect on grass carps.
Owner:HUNAN NORMAL UNIVERSITY

Fish-sourced aeromonas hydrophila disease antagonistic strain and application thereof

The invention relates to a fish-sourced aeromonas hydrophila disease antagonistic strain and an application of the antagonistic strain and belongs to the field of aquaculture technology. A fish-sourced aeromonas hydrophila disease antagonistic strain is screened out, cultivated and added into a feed or a medicine as probiotics. The antagonistic strain is a novel antagonistic strain which is high in biological activity stability and high in specificity, is safe for cultured fish and environment, can be used as the probiotics strain for preventing and treating aeromonas hydrophila caused explosive hemorrhagic disease in large freshwater fish farming, and can be used as the main strain to prepare a microbial preparation.
Owner:FRESHWATER FISHERIES RES CENT OF CHINESE ACAD OF FISHERY SCI

Medicine for preventing fish bacterial enteritis

The invention discloses medicine for preventing fish bacterial enteritis, and relates to the field of aquaculture, in particular to Chinese and western compound medicine for preventing fish diseases. The medicine comprises the following components by weight parts: 10 to 20 parts of colistin sulfate, 30 to 50 parts of rhubarb, 40 to 60 parts of radix isatidis and 10 to 20 parts of garlicin. The medicine of the invention adopts a Chinese and western compound prescription, overcomes the problems that the fish suffers from bacterial enteritis in high-temperature seasons and the bacterial enteritis is easy to reoccur, has very good treatment effect to inflammatory bowel diseases caused by aeromonas hydrophila and other bacteria, and is characterized by significant therapic effect and no any toxic and side effect.
Owner:TIANJIN SHENGJI GRP CO LTD

Plant extract formula for inhibiting aeromonas hydrophila

The invention provides a plant extract formula for inhibiting aeromonas hydrophila, which belongs to the technical field of the development and the utilization of natural products. The formula comprises the following components in percentage by weight: 50 to 80 percent of Chinese gall, 10 to 30 percent of tea polyphenol and 5 to 15 percent of rhubarb extract. The plant extract compound formula prepared by the invention is formed by combining pure natural plant extracts, has the characteristics of significant antibacterial effect, no drug residues, no pollution to water body environments and the like, provides a new method for preventing and treating aquatic animal diseases caused by the aeromonas hydrophila, and can be used as Chinese medicament preparation and a feed additive.
Owner:上海国矗生物科技有限公司

Sanhuang supper micropowder as well as preparing method and application thereof

The invention relates to the field of fish medicine preparations, in particular to Sanhuang supper micropowder as well as a preparing method and applications thereof. The supper micropowder comprises in percentage by weight as follows: 25-35% of baical skullcap roots, 25-35% of amur cork tree bark, 25-35% of rhubarb and 5-10% of indigowoad leaves. The Sanhuang supper micropowder has effects of clearing heat, cooling blood, resisting viruses and detoxifying, plays powerful antibacterial, disinfection and antiviral roles in water bodies and pathogenic bacteria of aqueous animal (gills, body surfaces and the like) tissue and is particularly used for mainly treating bacterial enteritis caused by pseudomonas, vibrio, aeromonas hydrophila and Edwardsiella in the aqueous animals. Tests prove that the Sanhuang wall-breaking supper micropowder can improve and treat white excrement enteritis of penaeus vannamei boone and septicemia of Micropterus salmoides to a certain extent, can enhance the aeromonas hydrophlia infection resistance of the Micropterus salmoides and is a novel fish medicine for effectively protecting intestinal tracts and preventing bacterial enteritis in the aqueous animals, and the use amount can be significantly decreased by 2-3 times.
Owner:INST OF OCEANOLOGY - CHINESE ACAD OF SCI +1

Immobilized microbial consortium for the treatment of phenolic waste-water from petroleum refineries

InactiveUS6406882B1Wider surface areaEasy diffusion of oxygenWater contaminantsOn/in organic carrierBacteroidesFiber
An immobilized microbial consortium is formulated which comprises of a synergistic mixture of all the bacterial strains of Aeromonas hydrophila, Pseudomonas fluorescens, Pseudomonas aeruginosa, Bacillus circulans, Yersinia enterocolitica, Enterobacter cloaca and Bacillus brevis. The formulated microbial consortium is immobilized on a non-biodegradable and economically cheaper support. The said immobilized microbial consortium is used for the biodegradation of synthetic phenol as well as phenol present in petroleum refinery effluent. The results of biodegradation obtained with the microbial consortium immobilized on coconut fiber are compared with those obtained with microbial consortium immobilized on well known support. The coconut fiber used for immobilization proved to be a better support than a well known support such as calcium alginate.
Owner:COUNCIL OF SCI & IND RES

Compound plant extract feed additive and preparation method thereof

InactiveCN103564197AGood antibacterial activity in vitroLong-term use without residueFood processingAnimal feeding stuffSide effectFeed additive
The invention relates to the technical field of feed, in particular, to a compound plant extract feed additive and a preparation method thereof. The invention aims to provide a compound plant extract feed additive with a strong antibacterial effect for solving various defects such as existence of toxic and side effects caused by adding other synthetic drugs such as antibiotic in the feeds, and excellent effects are achieved. The technical scheme of the invention is to provide the compound plant extract feed additive, which comprises citrus essential oil, allicin, tangeritin, pine needle meal and pine flower essential oil. The compound plant extract feed additive has the following benefits: based on the traditional Chinese herbal medicine theoretical research and practice, 4 traditional Chinese herbal medicines and 5 extracts are chosen, the in-vitro antimicrobial activities thereof are measured, and plant extracts having restraining effect to aeromonas hydrophila are selected out to prepare compound preparation. The compound plant extract feed additive has the characteristics of excellent in-vitro antimicrobial activity, high efficiency, safety, no poison and no residue for long-time use.
Owner:FUJIAN ZHENGYUAN FEED

Multifunctional feed special for wood frog and polliwog

The invention relates to a multifunctional special feed for Tadpole of Rants chensinensis. The technical proposal adopted is that the feed consists of main materials and auxiliary materials; wherein, every ton of the main materials consists of 200 to 400kg of rice bran, 100 to 200kg of corn meal, 100 to 200kg of fish meal, 100 to 300kg of bean pulp powder, 100 to 200kg of meat meal, 50 to 100kg of wheat-middling and 20 to 70kg of wheat bran; every ton of the main materiala is added into the following auxiliary materials by weight: 200 to 800g of microbial inoculum agent, 200 to 500g of aquaculture vitamin complex, 200 to 500g of aquaculture compound mineral, 200 to 500g of antioxidant, 20 to 100g of inactivated aeromonas hydrophila vaccine and 20 to 50g of diethylstilbestrol. The preparation method is that firstly, the main materials are smashed, stirred; and then the auxiliary materials are added into the main materials and are stirred evenly, regulated in steam, granulated and cooled. The feed has the functions of sex induction and disease prevention for the Tadpole of Rants chensinensis.
Owner:LIAONING UNIVERSITY

Pathogenic aeromonas hydrophila assay kit

The invention relates to a pathogenic aeromonas hydrophila assay kit and belongs to the field of the detection of pathogenic microorganisms. A primer which is designed on the basis of a highly conserved interval of a standard strain J-1 strain 16S rDNA genome of the pathogenic aeromonas hydrophila is used for distinguishing and identifying strain characteristics of the pathogenic aeromonas hydrophila, and the amplified fragment is 685bp; and a second pair of primers which is designed according to specific proteinase aerolysin secreted by the strain is used for judging the pathogenicity of the aeromonas, and the fragment size is 301bp. The assay kit can rapidly and accurately judge the strain characteristics and pathogenicity of the strains to be tested. Comparison tests of the conventional biochemical identification method and pathogenicity identification method for experiment strains and clinical stains show that the coincidence rate of the kit is 100 percent. Evaluation tests for specificity, repeatability, sensitivity and retention period of the kit acquire ideal results.
Owner:NANJING AGRICULTURAL UNIVERSITY

Pediococcus pentosaceus G11 strain as well as screening and applications thereof

The invention relates to a pediococcus pentosaceus G11 strain as well as screening and applications of the pediococcus pentosaceus G11 strain. The pediococcus pentosaceus G11 strain is preserved in the China Center for Type Culture Collection, and is assigned with the accession number of CCTCC NO:2016248. The pediococcus pentosaceus G11 strain has tolerance to compound sulfamethoxazole and ceftazidime, has antibacterial activity for vibrio parahaemolyticus, aeromonas hydrophila, vibrio alginolyticus, staphylococcus aureus and beta streptococcus, has certain stress resistance and enzyme producing ability, is free of hemocyte solubility, and has no drug tolerance for most antibiotics; the dipping bath experiment proves that the pediococcus pentosaceus G11 strain is harmless to the host, can improve the immunity of the body, has wide application prospects, can be applied to probiotic preparations, and also can be prepared into bacterial powder which is then added into a feed as a feed additive, further, the growth of pathogenic bacteria in the bodies of the animals is inhibited, so that the death rate of animals is reduced, and the pediococcus pentosaceus G11 strain is a probiotic brain worthy of development.
Owner:SHANTOU UNIV

Method for preparing pathogenicity hydrosphere unit cell bacterium killed vaccine

The invention discloses a method for preparing pathogenicity aeromonas hydrophila bacteria inactivating vaccine, which comprises the following steps: firstly, inoculating the pathogenicity aeromonas hydrophila bacteria separated from the brown paralichthys olivaceus with abdominal dropsy through PCR detecting to the common LB culture medium to be cultured so as to reach a certain density; secondly, inactivating the bacteria by using formaldehyde solution; thirdly, collecting the thalli by using centrifugal culture and then diluting the thalli by using physiological saline so as to get the pathogenicity aeromonas hydrophila bacteria inactivating vaccine. The preparing method is rapid, simple and convenient in operation, and easy in batch preparing; the gotten vaccine is a pure biological agent which does not has any toxic and side effect and does not cause pollution to the meat quality of the paralichthys olivaceus and the surrounding water. The immunity protecting rate reaches 80 percent by using the vaccine prepared by the method to inoculate brown paralichthys olivaceus so as to radically curb the spreading of the pathogeny. The invention provides new approach for preventing and curing the epidemic abdominal dropsy of brown paralichthys olivaceus.
Owner:HEBEI NORMAL UNIV

Method for preparing powdered egg yolk coating agent containing anti-aeromonas hydrophila yolk immunoglobulin

The present invention discloses preparation process of enveloped hydrophilic aeromonad resisting immunoglobulin yolk powder preparation. The preparation process includes collecting yolk liquid of hydrophilic aeromonad resisting yolk egg of titer in 1 to 640 and over, mixing beta-cyclodextrin and water through stirring to obtain beta-cyclodextrin aqua, adding the yolk liquid slowly into the beta-cyclodextrin aqua with the volume ratio between the yolk liquid and water being 2.8-5.6, mixing with starch with water content lower than 8 % through stirring to obtain mixture, pelletizing the mixture in 60 mesh screen, drying in a horizontal drier and sieving in a 80 mesh sieve. The enveloped preparation product has high bioactivity of immunoglobulin yolk, slow releasing characteristic, less influence of pepsin and good taste.
Owner:ZHEJIANG UNIV

Broad-spectrum antibacterial Bacillus amyloliquefaciens strain and application thereof

The invention discloses a broad-spectrum antibacterial Bacillus amyloliquefaciens strain and application thereof, and belongs to the technical field of microbes. The strain is named as Bacillus amyloliquefaciens JFL21, and is collected in the Guangdong Microbial Culture Collection Center on November 5, 2018, with the collection number of GDMCC NO: 60473. The Bacillus amyloliquefaciens JFL21 is cultured under a simple culture condition, is easy to preserve and strong in stress resistance, is easily produced industrially, and has good development and application prospects; a fermented supernatant thereof has broad-spectrum antibacterial activity for 19 common foodborne pathogens and aquatic pathogens, has extremely stable bacteriostatic performance for Listeria monocytogenes and Aeromonas hydrophila, can be further developed as a probiotic, a biological preservative or an antibacterial medicine, and is applied to food preservation or prevention of aquaculture diseases, so that use of antibiotics is reduced to a certain extent, and an application prospect is broad.
Owner:SOUTH CHINA AGRI UNIV

Lactobacillus zeae LZ3 and application thereof in aquaculture

The invention discloses a Lactobacillus zeae LZ3. The preservation number of the above strain is CCTCC NO:M2015652, and the Lactobacillus zeae LZ3 has Aeromonas hydrophila growth or breeding inhibition ability. The strain can be used as an Aeromonas hydrophila antagonistic microorganism to prepare a bacteriostasis preparation which can be applied to the aquaculture in order to prevent harms of the Aeromonas hydrophila to cultured aquatic products; and the strain can be used to grade ammonia nitrogen, nitrite and other harmful substances in aquaculture water as a probiotic preparation in order to improve the culture water quality.
Owner:姜光明 +2

Composite microecological feed additive capable of increasing freshwater fish growth rate and application of composite microecological feed additive

InactiveCN104686838AStrengthen space-occupying and antibacterial functionsPromote growthAnimal feeding stuffFungicideVibrio alginolyticus
The invention provides a composite microecological feed additive capable of increasing the freshwater fish growth rate and application of the composite microecological feed additive. The additive comprises the following components: aspergillus niger solid fermentation compound enzyme, bacillus subtilis, bacillus cereus, cellulose, xylanase, neutral protease and phytase. The composite microecological feed additive disclosed by the invention is added with the solid fermentation compound enzyme, so that the utilization rate of the freshwater fish to baits is effectively increased, the growth of fishes is promoted, the breeding of pathogenic bacteria including aeromonas hydrophila, vibrio alginolyticus and the like in a water body can be inhibited due to the addition of fungicides, the occurrence possibility of diseases of saprolegniasis, white skin diseases, bacillary enteritis and the like is reduced; compared with similar additives, the additive disclosed by the invention has the advantages of being safe, high in efficiency, special, free of residues, free of side effects and the like; the composite microecological feed additive can be used for improving and keeping the good growth state of the freshwater fish and effectively increasing the freshwater fish growth rate.
Owner:QINGDAO GENYUAN BIOLOGICAL TECH GRP

Preparation method for aeromonas hydrophila outer membrane protein gene prokaryotic expression protein

The invention belongs to the technical field of biology, and particularly relates to a preparation method for aeromonas hydrophila outer membrane protein gene prokaryotic expression protein. The method comprises the following steps that the protein clones an outer membrane protein gene segment into a prokaryotic expression vector pET-30a to obtain a recombinant expression vector, the recombinant expression vector is converted into Escherichia coli to obtain recombinant Escherichia coli, the recombinant Escherichia coli is inoculated to an Amp-resistant LB plate to be cultured for OD600 for 0.6 h, IPTG is added to reach the final concentration being 1.0 mmol / l for inducible expression, and the aeromonas hydrophila outer membrane protein gene prokaryotic expression protein is obtained after purification is performed. According to the method, the aeromonas hydrophila outer membrane protein gene prokaryotic expression protein is successfully constructed, the aeromonas hydrophila outer membrane protein gene prokaryotic expression protein can be used as a vaccine capable of protecting fish, the immune effects of the aeromonas hydrophila outer membrane protein gene prokaryotic expression protein pompA for channel catfish under different FIA effects are compared and researched, and a foundation is laid for further researching the pompA and researching whether the pompA can be used as the candidate component of the genetic engineering subunit vaccine or not.
Owner:郑宗林 +1

Aeromonas hydrophila inactivated vaccine and preparation thereof

InactiveCN101642567AOutbreak Prevention and ControlEpidemic prevention and controlAntibacterial agentsBacterial antigen ingredientsVirulent characteristicsAeromonas hydrophila
The invention relates to a fish vaccine and a preparation method thereof, in particular to an aeromonas hydrophila inactivated vaccine and the preparation thereof. The aeromonas hydrophila inactivatedvaccine is prepared by the following concrete steps: separating out a pathogen from a sick fish, determining the pathogen as an aeromonas hydrophila through morphology, virulence factors, biochemicalreaction and gene sequencing; rejuvenating the strain, selecting an optimum condition for cultivation; then selecting the optimum condition for inactivation to prepare the aeromonas hydrophila inactivated vaccine, and conforming the aeromonas hydrophila inactivated vaccine to be certificated through sterility test and security test. The inactivated vaccine is prepared from a pathogenic bacterialstrain separated from a sick fish body, has a simple operating method, strong pertinency, strong protective function, good immunological effect and low cost of the used material, and is suitable for mass production. The invention provides a practical method for preventing and curing the bacteremic septicemia of carps.
Owner:张秀军 +2

Muricauda olearia and application thereof

The invention provides Muricauda olearia. Muricauda oleariah is a quorum sensing quenching strain capable of inhibiting the secretion of pathogenic bacteria virulence factors, and the preservation number of Muricauda olearia LMM001 strain is CGMCC No. 8972. The invention also provides an AHL degrading enzyme MomL protein separated from the LMM001 strain, wherein the amino acid sequence of the MomL protein is SEQ ID NO: 1. The Muricauda olearia LMM001 strain disclosed by the invention can block the QS pathway of pathogenic bacteria by small molecule QS repressor, AHL lactonase MomL, AHL acyltransferase and other ways, and reduce the secretion of pathogenic bacteria virulence factors; the LMM001 strain has no toxic and side effects on zebrafish and can improve the resistance of zebrafish to the infection of Aeromonas hydrophila; AHL lactonase can greatly reduce the secretion of virulence factors such as Pseudomonas aeruginosa extracellular protease and pyocyanine and can reduce the synthesis of Chromobacterium violaceum and violacein.
Owner:OCEAN UNIV OF CHINA

Traditional Chinese medicine for controlling aeromonas hydrophila disease of aquatic animals and utilizing method thereof

The invention provides a traditional Chinese medicine for controlling the aeromonas hydrophila disease of aquatic animals. The traditional Chinese medicine includes Chinese medicinal preparations I and II processed from Chinese medicinal herbs, wherein the Chinese medicinal preparation I comprises gallnuts and baical skullcap root with a mass ratio of 1:(47-125), and the Chinese medicinal preparation II comprises dandelions, baical skullcap root and honeysuckles with a mass ratio of (14.8-27.6):(51.7-55.6):(20.7-29.6); and all components are measured in terms of extracts for preparing the traditional Chinese medicine. The utilizing method of the traditional Chinese medicine is characterized in that a splashing administration manner is adopted in the seedling culturing stage of the aquatic animals, and a feed-blended oral administration manner is adopted in the commodity cultivation stage of the aquatic animals. Compared with the prior art, the two Chinese medicinal preparations provided in the invention are complementary in pharmacology, can be used for effectively improving the immunity of the aquatic animals, and have obvious inhibiting effects on the pathogenic aeromonas hydrophila. The two Chinese medicinal preparations are alternately used to prevent the pathogenic aeromonas hydrophila from variation to result in medicine resistance, so that the incidence of the aeromonas hydrophila disease of the aquatic animals can be effectively decreased and the cultivation survival rate can be further increased.
Owner:ZHEJIANG OCEAN UNIV

Aeromonas hydrophila micro-capsular oral vaccine

The invention relates to an aeromonas hydrophila micro-capsular oral vaccine, which belongs to the technical field of biological pharmacy. The aeromonas hydrophila micro-capsular oral vaccine is prepared by using sodium alga acid and chitosan as wall materials, using the inactivated bacteria of aeromonas hydrophila as a core material and by using improved atomization and ion crosslinking technology. When the aeromonas hydrophila sodium alga acid-chitosan micro-capsular oral vaccine is used for immunizing a mouse and crucian, the phagocytosis activities of macrophages, the conversion efficiency of the splenic lymphocytes and the expression amount of cell factors such as IFN-gamma and Il-4 of the mouse and the crucian can be improved obviously. The relative protection rate of the vaccine for the crucian is 39.3 percent. A microcapsule is stable in a simulated gastrointestinal environment and shows high burst release and slow release; and the bacterial antigenicity of the microcapsule is well maintained and the vaccine has high safety and high storage stability.
Owner:NANJING AGRICULTURAL UNIVERSITY
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More