Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

69results about How to "Stable identification" patented technology

SSR (Simple Sequence Repeat) core primer group developed based on whole genome sequence of foxtail millet and application of SSR core primer group

The invention discloses an SSR (Simple Sequence Repeat) core primer group developed based on whole genome sequence of foxtail millet and an application of the SSR core primer group, and belongs to the technical field of molecular biology. The core primer group comprises 30 pairs of primers, wherein nucleotide sequences are represented by SEQ ID NO. 1-60. The primer has advantages of clear electrophoretic band and rich polymorphism, and is uniformly distributed and stable in amplification. The invention also provides the application of the SSR core primer group in identifying the genetic diversity and variety of the foxtail millet. The primer group can be used for precisely and quickly identifying the variety of the foxtail millet and precisely reflecting a genetic relationship among the varieties of the foxtail millet.
Owner:CROP RES INST SHANDONG ACAD OF AGRI SCI

Method and apparatus for reviewing defects by detecting images having voltage contrast

In a traditional method for automatically obtaining high-magnification images of defects by using an electron microscope for defect-reviewing of a semiconductor wafer, high-magnification images of a voltage contrast changing part are obtained in the case of defects generating voltage contrast change, this made difficult to observe defects themselves generating voltage contrast change. In the present invention, based on energy of secondary electron to be detected, after obtaining two types of images, namely an image making voltage contrast conspicuous easily, and an image not making it easily, and acquiring a shape change area adjacent to a voltage contrast change area based on this area as a defect location, a high-magnification image can automatically be obtained.
Owner:HITACHI HIGH-TECH CORP

Pathogenic aeromonas hydrophila assay kit

The invention relates to a pathogenic aeromonas hydrophila assay kit and belongs to the field of the detection of pathogenic microorganisms. A primer which is designed on the basis of a highly conserved interval of a standard strain J-1 strain 16S rDNA genome of the pathogenic aeromonas hydrophila is used for distinguishing and identifying strain characteristics of the pathogenic aeromonas hydrophila, and the amplified fragment is 685bp; and a second pair of primers which is designed according to specific proteinase aerolysin secreted by the strain is used for judging the pathogenicity of the aeromonas, and the fragment size is 301bp. The assay kit can rapidly and accurately judge the strain characteristics and pathogenicity of the strains to be tested. Comparison tests of the conventional biochemical identification method and pathogenicity identification method for experiment strains and clinical stains show that the coincidence rate of the kit is 100 percent. Evaluation tests for specificity, repeatability, sensitivity and retention period of the kit acquire ideal results.
Owner:NANJING AGRICULTURAL UNIVERSITY

Transgenic maize event LP007-2 and detection method thereof

The present invention provides a nucleic acid sequence comprising one or more selected from the group consisting of sequences SEQ ID NO: 1-7 and complementary sequences thereof, said nucleic acid sequence being derived from a plant, seed or cell comprising the corn event LP007-2, a representative sample of the seed comprising said event having been preserved with preservation number CCTCC NO: P202015. The transgenic maize event LP007-2 of the invention is resistant to ingestion impairment of lepidoptera pests and tolerant to phytotoxic effects of agricultural herbicides containing glyphosate. The corn plant with double traits has the following advantages: economic loss caused by lepidoptera pests is avoided; an agricultural herbicide containing glyphosate can be applied to corn crops; the corn yield is not reduced; and the breeding efficiency is enhanced, and the molecular marker can be used for tracking transgenic insertion fragments in a breeding population and a progeny thereof. Meanwhile, the detection method provided by the invention can be used for rapidly, accurately and stably identifying the existence of the plant material derived from the transgenic maize event LP007-2.
Owner:LONGPING BIOTECHNOLOGY (HAINAN) CO LTD

Transgenic maize event LP007-1 and detection method thereof

The present invention provides a nucleic acid sequence comprising one or more selected from the group consisting of sequences SEQ ID NO: 1-7 and complementary sequences thereof, said nucleic acid sequence being derived from a plant, seed or cell comprising the corn event LP007-1, a representative sample of the seed comprising said event having been preserved with preservation number CCTCC NO: P202014. The transgenic maize event LP007-1 of the invention is resistant to ingestion impairment of lepidoptera pests and tolerant to phytotoxic effects of agricultural herbicides containing glyphosate. The corn plant with double characters has the following advantages: economic loss caused by lepidoptera pests is avoided; an agricultural herbicide containing glyphosate can be applied to corn crops; the corn yield is not reduced; and the breeding efficiency is enhanced, and the molecular marker can be used for tracking transgenic insertion fragments in a breeding population and a progeny thereof. Meanwhile, the detection method provided by the invention can be used for rapidly, accurately and stably identifying the existence of the plant material derived from the transgenic maize event LP007-1.
Owner:LONGPING BIOTECHNOLOGY (HAINAN) CO LTD

Transgenic maize event LP007-7 and detection method thereof

The present invention provides a nucleic acid sequence comprising one or more selected from the group consisting of sequences SEQ ID NO: 1-7 and complementary sequences thereof, said nucleic acid sequence being derived from a plant, seed or cell comprising the maize event LP007-7, a representative sample of the seed comprising said event having been preserved with preservation number CCTCC NO: P202020. The transgenic maize event LP007-7 of the invention is resistant to ingestion impairment of lepidoptera pests and tolerant to phytotoxic effects of agricultural herbicides containing glyphosate. The corn plant with double characters has the following advantages: economic loss caused by lepidoptera pests is avoided; an agricultural herbicide containing glyphosate can be applied to corn crops; the corn yield is not reduced; and the breeding efficiency is enhanced, and the molecular marker can be used for tracking transgenic insertion fragments in a breeding population and a progeny thereof. Meanwhile, the detection method provided by the invention can be used for rapidly, accurately and stably identifying the existence of the plant material derived from the transgenic maize event LP007-7.
Owner:LONGPING BIOTECHNOLOGY (HAINAN) CO LTD

Miniaturized Radio-Frequency Identification Tag and Microstrip Patch Antenna Thereof

A miniaturized Radio Frequency Identification (RFID) tag and a microstrip patch antenna thereof are provided. The miniaturized RFID tag (100) includes: a chip (33), substrate (20) and a microstrip patch antenna, wherein the microstrip patch antenna is attached to a surface of the substrate (20) and comprises a power supply part (31) and a radiation part (30) connected with each other. The power supply part (31) is connected with the chip (33) through a microstrip line. Two sides of the radiation part (30) are provided with at least one slit (32) which has the length of one-half wavelength and enables the tag product to be used normally within a range of shorter than one-half normal wavelength. A maximum point and a minimum point are generated in the radiation part (30) simultaneously, so the tag can be used normally without influencing the performance, even when the tag is in contact with any metal surface. The tag can be miniaturized at the same time
Owner:XERAFY SINGAPORE PTE LTD

Transgenic maize event LP007-4 and detection method thereof

The present invention provides a nucleic acid sequence comprising one or more selected from the group consisting of sequences SEQ ID NO: 1-7 and complementary sequences thereof, said nucleic acid sequence being derived from a plant, seed or cell comprising the corn event LP007-4, a representative sample of the seed comprising said event having been preserved with preservation number CCTCC NO: P202017. The transgenic maize event LP007-4 of the invention is resistant to ingestion impairment of lepidoptera pests and tolerant to phytotoxic effects of agricultural herbicides containing glyphosate. The corn plant with double characters has the following advantages: economic loss caused by lepidoptera pests is avoided; an agricultural herbicide containing glyphosate can be applied to corn crops; the corn yield is not reduced; and the breeding efficiency is enhanced, and the molecular marker can be used for tracking transgenic insertion fragments in a breeding population and a progeny thereof. Meanwhile, the detection method provided by the invention can be used for rapidly, accurately and stably identifying the existence of the plant material derived from the transgenic maize event LP007-4.
Owner:LONGPING BIOTECHNOLOGY (HAINAN) CO LTD

Nucleic acid sequence and method for detecting herbicide-tolerant soybean plant dbn9004

The present invention relates to a nucleic acid sequence for detecting herbicide-tolerant soybean plant DBN9004 and a detection method thereof, wherein the nucleic acid sequence of the soybean plant comprises SEQ ID NO: 1 or its complementary sequence, or SEQ ID NO: 2 or its complementary sequence complementary sequence. The transgenic soybean event DBN9004 of the present invention has good tolerance to glyphosate herbicide and glufosinate-ammonium herbicide, has no effect on the yield, and the detection method can accurately and quickly identify whether the biological sample contains the DNA of the transgenic soybean event DBN9004 molecular.
Owner:BEIJING DABEINONG BIOTECHNOLOGY CO LTD

Transgenic Zea mays L. event LP007-5 and detection method thereof

The invention provides a nucleic acid sequence. The nucleic acid sequence comprises one or more of sequences SEQ ID NO: 1-7 and complementary sequences thereof, the nucleic acid sequence is derived from a plant, seed or cell comprising a Zea mays L. event LP007-5, and a representative sample of the seed comprising the event is preserved with the preservation number CCTCC NO: P202018. The transgenic Zea mays L. event LP007-5 is resistant to an ingestion impairment of a lepidoptera pest and tolerant to a phytotoxic effect of an agricultural herbicide containing glyphosate. A Zea mays L. plant with double characters has the following advantages that economic loss caused by the lepidoptera pest is avoided; the agricultural herbicide containing the glyphosate can be applied to a Zea mays L. crop; the Zea mays L. yield is not reduced; and the breeding efficiency is improved, and a molecular marker can be used for tracking a transgenic insertion fragment in a breeding population and a progeny thereof. Meanwhile, a detection method can be used for rapidly, accurately and stably identifying the existence of a plant material derived from the transgenic Zea mays L. event LP007-5.
Owner:LONGPING BIOTECHNOLOGY (HAINAN) CO LTD

Transgenic maize event LP007-3 and detection method thereof

The present invention provides a nucleic acid sequence comprising one or more selected from the group consisting of sequences SEQ ID NO: 1-7 and complementary sequences thereof, the nucleic acid sequence is derived from a plant, seed or cell comprising the corn event LP007-3, and a representative sample of the seed comprising said event is preserved with preservation number CCTCC NO: P202016. The transgenic maize event LP007-3 of the invention is resistant to ingestion impairment of lepidoptera pests and tolerant to phytotoxic effects of agricultural herbicides containing glyphosate. The corn plant with double characters has the following advantages: economic loss caused by lepidoptera pests is avoided; an agricultural herbicide containing glyphosate can be applied to corn crops; the corn yield is not reduced; and the breeding efficiency is enhanced, and the molecular marker can be used for tracking transgenic insertion fragments in a breeding population and a progeny thereof. Meanwhile, the detection method provided by the invention can be used for rapidly, accurately and stably identifying the existence of the plant material derived from the transgenic maize event LP007-3.
Owner:LONGPING BIOTECHNOLOGY (HAINAN) CO LTD

Malus plant whole genome InDel marker genotype database and application thereof to germplasm resource specificity identification

The invention provides a malus plant whole genome InDel marker genotype database and application thereof to germplasm resource specificity identification, and belongs to the technical field of molecular biology. A construction method for the genotype database includes the following steps: performing genotyping on InDel markers of apple germplasm resource genome DNA samples by using a primer pair and multiple PCR; recording by taking genotype of InDel markers corresponding to each malus germplasm resource as a row; and summarizing all germplasm resource records to obtain the malus plant whole genome InDel marker genotype database. The database provided by the invention can simply, conveniently, efficiently and stably identify the specificity of malus germplasm, overcomes the limitation thatDUS test is easily influenced by the environment, and provides a powerful tool for apple new variety protection and germplasm resource management.
Owner:CHINA AGRI UNIV

Primer group and method for identifying dendrobium huoshanense and dendrobium officinale product based on Real-time ARMS-qPCR

The invention discloses a primer group and method for identifying dendrobium huoshanense and a dendrobium officinale product based on Real-time ARMS-qPCR. The primer group comprises two pairs of pre-amplification primers and two pairs of ARMS specific primers. The identifying method comprises the steps of DNA extraction of a to-be-detected sample, pre-amplification and amplification of the Real-time ARMS-qPCR. The primer group for identifying the dendrobium huoshanense based on the Real-time ARMS-qPCR can be amplified effectively, and according to the primer group, the method that Real-time Quantitative PCR is combined based on the ARMS technology is adopted so that the dendrobium huoshanense and the dendrobium officinale product of the dendrobium huoshanense can be identified rapidly and precisely, and the built method for identifying the dendrobium huoshanense and the dendrobium officinale product of the dendrobium huoshanense is accurate, sensitive, rapid, stable and repeatable.
Owner:NANJING NORMAL UNIVERSITY

Transgenic Zea mays L. event LP007-6 and detection method thereof

The invention provides a nucleic acid sequence. The nucleic acid sequence comprises one or more of sequences SEQ ID NO: 1-7 and complementary sequences thereof, the nucleic acid sequence is derived from a plant, seed or cell comprising a Zea mays L. event LP007-6, and a representative sample of the seed comprising the event is preserved with preservation number CCTCC NO: P202019. The transgenic Zea mays L. event LP007-6 is resistant to an ingestion impairment of a lepidoptera pest and tolerant to a phytotoxic effect of an agricultural herbicide containing glyphosate. A Zea mays L. plant with double characters has the following advantages that economic loss caused by the lepidoptera pest is avoided; the agricultural herbicide containing the glyphosate can be applied to a Zea mays L. crop; the Zea mays L. yield is not reduced; and the breeding efficiency is improved, and a molecular marker can be used for tracking a transgenic insertion fragment in a breeding population and a progeny thereof. Meanwhile, a detection method can be used for rapidly, accurately and stably identifying the existence of a plant material derived from the transgenic Zea mays L. event LP007-6.
Owner:LONGPING BIOTECHNOLOGY (HAINAN) CO LTD

Primer group, kit and method for identifying types of desmodium styracifolium

The invention provides a primer group, a kit and a method for identifying types of desmodium styracifolium. The primer group consists of a first primer, a second primer, a third primer, a fourth primer, a fifth primer, a sixth primer and a seventh primer, wherein the nucleotide sequences of the first primer, the second primer, the third primer, the fourth primer, the fifth primer, the sixth primer and the seventh primer are respectively shown as SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7. The primer group has one or more of the following advantages: the universality is strong, the accuracy is high, the objectivity is strong and the stability is high.
Owner:WUHAN KANGLE PHARMA

EST-SSR primer group for identifying dendrobium officinale Kimura et migo and dendrobium falconeri hook, preparation method of EST-SSR primer group and application of EST-SSR primer group in species identification

ActiveCN106086168AConvenient researchReflect genetic variationMicrobiological testing/measurementDNA/RNA fragmentationDendrobium falconeriFunctional genes
The invention discloses an EST-SSR primer group for identifying dendrobium officinale Kimura et migo and dendrobium falconeri hook. The primer group is characterized by consisting of five pairs of primers; and specifically, sequence lists of the primers are shown as follows: DN13 F:ATTTGATTGGTTCTGCTCATCC R:TTCTTGTTCTCTTCCAGCTTCC, DN58 F:CTAATGCAGGTTCTCCTCACCT R:GTTCAGCTCATCTCCTTGGATT, DN65 F:GATAAGGGGAAGGAGGAGAAGA R:AATCTATGCCAATCACTCCACA, DN67 F:GCACACATCCACTCACCCT R:GGGTATAGAGAGAAATGCTGCG and DN99 F:GGCACAGGTACTAGCAACAACA R:AGGTGATGGCAAAGTTCCAA. The primer group has the advantages of reducing biases or errors of strip interpretation, and simultaneously reflecting group or individual genetic variation and bringing about benefits for researches on functional genes.
Owner:江西新灵倍康食品发展有限公司

Sex identification method for juvenile fish of hybrid pelteobagrus fulvidraco (richardson)

The invention discloses a sex identification method for juvenile fish of hybrid pelteobagrus fulvidraco (richardson) [pelteobagrus fulvidraco (richardson) (male)* pelteobagrus vachelli (richardson) (female)]. The hybrid pelteobagrus fulvidraco (richardson) having an individual body length of above 3 cm is identified by utilization of a method of living-body gonad squashing, acetocarmine staining and ethanol crystal violet staining, and the accuracy of the method is verified by a paraffin section of the gonad tissue. The sex identification method is suitable for sex identification for juvenile fish of common pelteobagrus fulvidraco (richardson) and of "all-male No.1" pelteobagrus fulvidraco (richardson). By the sex identification method, sex identification of one juvenile fish can be completed in 3 min, and 100 fishes can be identified by cooperation of two persons for 2 h. The sex identification method has characteristics of high efficiency, economy, rapidness, accuracy and stability. The sex identification method has important application value for male fry cultivation of the pelteobagrus fulvidraco (richardson) and the hybrid pelteobagrus fulvidraco (richardson) thereof, and can be applied for rapid sex identification of a pelteobagrus fulvidraco (richardson) commodity summer fry.
Owner:NANJING NORMAL UNIVERSITY

Specific molecular marker of deletion mutation of base at site of eIF(iso) 4E.c of Chinese cabbage and application thereof

The invention discloses a specific codominant acid sphingomyelinase (ASM) marker at a site of a Chinese cabbage, and the specific codominant ASM marker at the site of the Chinese cabbage is directly related to identification of a wild type and a base deletion mutant at the eIF(iso) 4E.c of the Chinese cabbage. A marker related to detection of the site of the wild type is named as ASM-W, the size of a segment is 128bp, as shown in SEQ ID No.1. A marker related to detection of the corresponding site of the base deletion mutant is named as ASM-m, and the size of a segment is 124bp, as shown in SEQ ID No.2. According to a specific molecular marker of the deletion mutation of a base at the site of eIF(iso) 4E.c of the Chinese cabbage and application of the specific molecular marker, the homologous cloning technology is utilized to find a mutant at the side of eIF(iso) 4E.c, and the specific molecular marker used for indentifying the site is developed. The specific molecular marker can be utilized for accurate selection of genotypes of backcrossing descendants. At the same time, the specific molecular marker can also be used for sorting out Chinese cabbage germplasm resources to seek for mutant materials which are more abundant in genetic background.
Owner:VEGETABLE RES INST OF SHANDONG ACADEMY OF AGRI SCI

Bolt model automatic detection device and control method

The invention discloses a bolt model automatic detection device and a control method. The bolt model automatic detection device comprises a bolt conveying device, a visual detection system and a boltpushing mechanism; the bolt conveying device sequentially conveys bolts through a belt line; the visual detection system is used for collecting image information of the bolts conveyed by the belt lineand distinguishing qualified products from unqualified products of the bolts according to the image information; the bolt pushing mechanism is used for pushing the qualified products and / or the unqualified products of the bolts conveyed by the belt line out of the belt line; and when a result of distinguishing the bolts on the belt line by the visual detection system is that the bolts are the qualified products or the unqualified products, a pushing instruction is sent to the bolt pushing mechanism, and the qualified products and / or the unqualified products are pushed out of the belt line bythe bolt pushing mechanism. The bolt model automatic detection device can automatically detect bolt models, and improves the bolt detection efficiency and the bolt detection accuracy.
Owner:GREE ELECTRICAL APPLIANCE WUHU +1

Construction method of wheat variety identification model

The invention discloses a construction method of a wheat variety identification model. The method comprises the following steps of 1, acquiring a test sample, and acquiring the image information of the test sample; 2, collecting the spectral information data, morphological characteristic data, texture characteristic data and color characteristic data; 3, distributing the data to obtain a trainingset and a prediction set; 4, screening an optimal modeling method; and 5, screening the optimal input layer data to obtain the wheat variety identification model. The method of the invention providesa more accurate method for wheat variety identification, realizes the rapid, lossless, effective and stable identification of wheat varieties, provides guarantee for wheat harvesting and storage management, processing and the like, protects the interests of farmers, and guarantees the national grain safety.
Owner:INST OF AGRO FOOD SCI & TECH CHINESE ACADEMY OF AGRI SCI

Dendrobium chrysotoxum SSR molecular marker primer composition and application thereof

The invention provides a dendrobium chrysotoxum SSR molecular marker primer composition and application thereof, and belongs to the technical field of molecular biology. According to the invention, 25 pairs of SSR molecular marker primers with good amplification effect and high polymorphism are developed and screened from a dendrobium chrysotoxum transcriptome sequence, the genetic diversity and genetic relationship of dendrobium chrysotoxum groups can be analyzed by adopting the SSR molecular marker primers, and germplasm identification and genetic relationship analysis can also be carried out on dendrobium chrysotoxum clones or varieties; and the method has the advantages of high efficiency, accuracy, practicability, no seasonal influence and the like, and lays a foundation for subsequent dendrobium chrysotoxum germplasm resource management, breeding, genetic protection, genetic diversity analysis among groups and in the groups and the like.
Owner:ENVIRONMENTAL HORTICULTURE RES INST OF GUANGDONG ACADEMY OF AGRI SCI

SSR (Simple Sequence Repeat) core primer group developed based on whole genome sequence of foxtail millet and application of SSR core primer group

The invention discloses an SSR (Simple Sequence Repeat) core primer group developed based on whole genome sequence of foxtail millet and an application of the SSR core primer group, and belongs to the technical field of molecular biology. The core primer group comprises 30 pairs of primers, wherein nucleotide sequences are represented by SEQ ID NO. 1-60. The primer has advantages of clear electrophoretic band and rich polymorphism, and is uniformly distributed and stable in amplification. The invention also provides the application of the SSR core primer group in identifying the genetic diversity and variety of the foxtail millet. The primer group can be used for precisely and quickly identifying the variety of the foxtail millet and precisely reflecting a genetic relationship among the varieties of the foxtail millet.
Owner:CROP RES INST SHANDONG ACAD OF AGRI SCI

Molecular marker for identifying sex of haliotis discus hannai and primer thereof

InactiveCN113215279AReduce identification errorGender result is accurateMicrobiological testing/measurementDNA/RNA fragmentationPhysiologyGenetics
The invention discloses a molecular marker for identifying sex of haliotis discus hannai and a primer thereof. According to the molecular marker, when SNP of 522 bp, 528 bp and 532 bp of SEQ ID NO: 1 are homozygous, the genetic sex is female; and when SNP of 522 bp, 528 bp and 532 bp of SEQ ID NO: 1 are heterozygous, the genetic sex is male. The genetic sex molecular marker has advantages of being applicable to the whole life history, wider in applicable material range and the like.
Owner:JIMEI UNIV

Miniaturized radio-frequency identification tag and microstrip patch antenna thereof

A miniaturized Radio Frequency Identification (RFID) tag and a microstrip patch antenna thereof are provided. The miniaturized RFID tag includes: a chip, substrate and a microstrip patch antenna. The microstrip patch antenna is attached to a surface of the substrate and includes a power supply part and a radiation part connected with each other. The power supply part is connected with the chip through a microstrip line. Two sides of the radiation part are provided with at least one slit which has the length of one-half wavelength and enables the tag product to be used normally within a range of shorter than one-half normal wavelength. A maximum point and a minimum point are generated in the radiation part simultaneously, so the tag can be used normally without influencing the performance, even when the tag is in contact with any metal surface. The tag can be miniaturized at the same time.
Owner:XERAFY SINGAPORE PTE LTD

Analysis method and system for identifying heat treatment degree and doping of liquid milk

The invention relates to the technical field of food safety detection, in particular to an analysis method and system for identifying the heat treatment degree and doping of liquid milk, and the method comprises three steps of sample pretreatment, mass spectrometry and data analysis. According to the invention, a machine learning technology and mass spectrometric detection are combined to establish a milk identification method and system with different heating degrees. In this way, a model is established by utilizing a machine learning algorithm according to the difference of polypeptide composition and content change of milk of different heated types in mass spectrum information, and information of a heat-sensitive peptide fragment is obtained. Then the model is continuously trained and optimized, a powerful prediction model is screened out, and therefore efficient, stable and accurate identification is achieved. The identification method and system are scientific and effective. The method established by the invention has the advantages of simplicity and convenience in operation, low organic solvent consumption, high throughput, high prediction accuracy and the like.
Owner:SHANDONG ANALYSIS & TEST CENT

Method for producing carrot hybrid seed and appraising purity

InactiveCN1781357APromote hybrid generationReduce riskPlant genotype modificationHybrid seedHeterosis
The method of producing carrot hybrid and appraising its purity utilizes carrot variety Huanghei 9303 with yellow character as female parent and normal green carrot variety as male parent. After the hybrid is seeded in field or in room, the seedling with yellow leaf is pseudo hybrid and the seedling with green leaf is true hybrid. The present invention opens one new way for utilization of heterosis of carrot and promotes the first filial generation production of carrot variety. The present invention has stable yellowing character, reliable appraisal of pseudo hybrid, shortened purity appraisal period and lowered purity appraisal cost.
Owner:CHINA AGRI UNIV

Method for constructing liquid chromatography fingerprint spectrum of abrus cantoniensis hance amide components

ActiveCN111024875AEfficient implementation of quality analysisQuality improvementComponent separationMedicinal herbsPharmaceutical Substances
The invention belongs to the technical field of medicine quality control, and particularly relates to a construction method of a liquid chromatography fingerprint spectrum of an abrus cantoniensis hance amide component. The fingerprint spectrum of the abrus cantoniensis hance amide component is obtained through a high performance liquid chromatograph. The method has the characteristics of being stable in identification, good in precision and reproducibility, high in separation degree, easy to operate and the like. In the fingerprint spectrum of the abrus cantoniensis hance amide component, thepeaks are uniformly distributed, and the common peak characteristic advantage is more obvious. The quality condition of the abrus cantoniensis hance amide component can be monitored from the overallappearance characteristic of chromatography. The method can be applied to identification, quality analysis and evaluation of the abrus cantoniensis hance amide component and can also be applied to identification, quality evaluation and control of abrus cantoniensis hance medicinal materials and related preparations and products containing amide extracts.
Owner:GUANGDONG PHARMA UNIV

Combined identification method for UUV hydrodynamic parameters based on variance compensating Kalman method and limited memory least square method

The invention discloses a combined identification method for UUV hydrodynamic parameters based on a variance compensating Kalman method and a limited memory least square method, and relates to the combined identification method for the UUV hydrodynamic parameters. In order to solve the problems of poor stability and low identification result accuracy existing in the conventional hydrodynamic parameter identification method, the method comprises the steps of carrying out the depth-keeping planer face movement and vertical face movement of the UUV and collecting the observation data; preliminarily identifying the observation data by the variance compensating Kalman method to acquire the preliminary identification parameter values; making the parameter values as the initial values of the limited memory least square method to carry our secondary identification on the acquired observation data to obtain the UUV hydrodynamic parameters; implementing the spiral diving or spiral rising simulation movement according to the hydrodynamic parameters, comparing the obtained track with an actual sailing track of the UUV and verifying the obtained track, and using the accurate parameters after the verification as the UUV hydrodynamic parameters. The method is used for determining the movement equation model of the UUV.
Owner:HARBIN ENG UNIV

HPLC method for detecting saponin in panax notoginseng leaves

The invention relates to an HPLC method for detecting saponin in panax notoginseng leaves, and belongs to the technical field of medicine. The method comprises the following steps of: preparing a testsample solution, preparing a reference substance solution, determining chromatographic conditions, measuring chromatographic peaks, and the like. The HPLC method can accurately measure the contents of seven saponin monomers, including ginsenosides Rb1, Rc, Rb2 and Rb3, notoginsenosides Fa and Fe and gypenoside XVII in panax notoginseng leaves in a short time, meets the related standards of Pharmacopoeia of People's Republic of China in precision, stability, repeatability, minimum detection limit and sample recovery rate, and is rapid, simple, stable and reliable and easy to popularize and apply.
Owner:YUNNAN AGRICULTURAL UNIVERSITY