256 results about "Juvenile fish" patented technology

The invention provides a sick juvenile fish identification method based on an improved YOLOv10 model, and the method comprises the steps: collecting a fish image in a water area as a to-be-detected image, and carrying out the preprocessing of the to-be-detected image, and obtaining an image data set; the method comprises the following steps: constructing a YOLOv10-UDFishNet model; the image data set is input into the YOLOv10-UFFishNet model, the YOLOv10-UFFishNet model is trained through the image data set, and the trained YOLOv10-UFFishNet model is obtained; and inputting a fish image in a water area to be detected into the trained YOLOv10-UFFishNet model to obtain a fish detection result and position information of a fish individual target. According to the method, the sick juvenile fish in the turbid underwater environment can be accurately and efficiently identified.

The invention relates to the technical field of water conservancy project fish protection, in particular to a safe and efficient fish descending device and a descending operation method.The safe and efficient fish descending device comprises a descending tower, a descending fishway is arranged on the descending tower, and the descending tower communicates with an upstream river channel and a downstream river channel through a fish luring pond and a buffering fishway; an upstream dispatching area controlled by a gate is arranged on the upstream and used for attracting juvenile fishes and sending the juvenile fishes into a downstream fishway; the spiral descending fishway is arranged, the occupied area needed by a fish descending channel is greatly reduced, and the spiral descending fishway is suitable for various intermountain high dam environments lacking of construction of the descending channel; meanwhile, by arranging the buffer pool and the buffer fishway, the impact on the fishes during descending can be greatly relieved, and the survival rate of the fishes is increased; after the juvenile fishes are attracted into the fish luring pond through the fish luring mechanism, the juvenile fishes can be quickly conveyed to the downstream river channel through the downstream fishway by using the upstream and downstream water head difference as power, the downstream efficiency is high while the maintenance cost is kept low, and the device is suitable for wide application and popularization.

The invention discloses a sebastes schlegeli testis cell line as well as a construction method and application thereof, and belongs to the technical field of marine fish cell culture. Primary culture and subculture are carried out on sebastes schlegeli juvenile fish testis tissues, so that the sebastes schlegeli testis cell line capable of being continuously subcultured in vitro for a long time is established. The sebastes schlegeli testis cell line established by the invention is in a fibroblast shape, has a good growth curve, and has relatively strong multiplication capacity. The lentiviral vector can significantly express the stromal cell marker gene temp2, can transfect the cell line, and can be subsequently applied to research of gonad development related functional genes. At present, the cell line has been subjected to in-vitro continuous passage for more than 60 generations, can be subjected to cryopreservation, and is high in recovery survival rate. Establishment of the cell line provides a stable and excellent experimental material for research of fish gonad development genes.

The invention provides an artificial grouper breeding method suitable for high latitude areas, and relates to the technical field of grouper culture, the method specifically comprises the following steps: S1, transportation and treatment of grouper fertilized eggs; s2, breeding grouper seedlings in the high-latitude region; s3, preparing and transporting the juvenile fish from the high-latitude area to the low-latitude area; and S4, carrying the juvenile fish back to the low-latitude region, and carrying out adaptive culture. According to the technical scheme, after the fertilized eggs of the groupers in the low-latitude area are conveyed to the high-latitude area for fry breeding, the groupers are bred in the low-latitude area, negative effects of pathogenic microorganisms and water bodies on the groupers under the natural habitat are effectively avoided, and the occurrence of diseases of the grouper fries is effectively prevented; and the quality and yield of grouper culture are improved.

The utility model discloses a demersal roe hatching device, which relates to the technical field of roe hatching and comprises a hatching container, a hatching sieve bed, a weeping pipe and an overflow pipe, the overflow pipe and the hatching sieve bed are arranged in the hatching container, the top of the hatching container is open, the weeping pipe is arranged above the hatching container and communicated with a water inlet pipe, and a sieve is laid in the hatching sieve bed. Meshes of the screen mesh are smaller than the diameter of the fertilized eggs, so that the fertilized eggs can be flatly laid on the screen mesh before incubation, and the incubation screen bed is at least 10cm lower than an overflow port of the overflow pipe. The fertilized eggs can be flatly laid on the screen in the hatching screen bed in the middle layer of the water body, it is guaranteed that each fertilized egg can obtain sufficient dissolved oxygen supply of the water body, the development requirement is met, hatched fries can fall into the bottom of the hatching container from the screen in time, and the hatching efficiency is improved. Dead eggs and egg shells can be effectively prevented from being infected with water mildew to harm development of other normal fertilized eggs, the work intensity of manually picking up the dead eggs in a traditional hatching mode is reduced, and the hatching rate of the fertilized eggs and the survival rate of juvenile fishes are increased.

The utility model relates to the technical field of juvenile fish stage running water culture of Dongstellate astrostroma, and discloses a juvenile fish stage running water culture device of Dongstellate astrostroma, which comprises a culture box and a filtering device arranged in the culture box, a cross-shaped fixing plate is arranged in the middle of the culture box, and the filtering device is arranged in the culture box. A partition plate device is connected between the cross-shaped fixing plate and the breeding box, a conical separator is installed on the outer side of the partition plate device, a water pipe is installed at the top of the breeding box, and one end of the water pipe extends into the bottom of the breeding box while the other end is aligned with the surface of the filtering device; according to the utility model, the juvenile fishes of the Dongquan astrostroma are separated, so that fries growing to different degrees of the juvenile fishes of the Dongquan astrostroma are separated, the attacking behaviors among the juvenile fishes of the Dongquan astrostroma are reduced, the density of the juvenile fishes of the Dongquan astrostroma in the breeding box is reduced, and the pollution in the breeding box is prevented; and meanwhile, the filtering system of the culture box cannot suck the juvenile fish of the Dongstellate star into the interior, so that the juvenile fish of the Dongstellate star is prevented from being clamped into the filtering system to cause loss.

The invention provides an AI-based trachinotus ovatus juvenile fish culture water parasite prediction and prevention method and system, and the method comprises the steps: collecting multi-source data from a culture water body through a sensor array, including a nucleic acid signal, a fish school behavior track and an environment parameter sequence, and obtaining an original data set; unifying the data format and the acquisition frequency according to the original data set by adopting a time sequence alignment method, and obtaining an aligned feature flow; aiming at the aligned feature flow, applying a convolutional neural network to extract a space-time pattern of a nucleic acid signal and an abnormal index of a fish school behavior, and determining an extracted feature set; if the abnormal index in the extracted feature set exceeds a preset threshold value, a causal association between environmental parameters and parasitic risks is classified through a support vector machine, and a preliminary risk level is judged; simulating a water body change scene according to the comprehensive causal model to obtain a predicted trajectory of parasite propagation; and determining a quantitative score of the parasite risk and generating a prevention and control instruction sequence by comparing the predicted trajectory with the real-time monitoring data.

The invention discloses a Pelteobagrus vachelli population dynamic monitoring system and method, particularly relates to the technical field of fishery resource monitoring, and aims to solve the problems of inaccurate juvenile fish survival rate evaluation and poor monitoring timeliness in a benthic hidden environment in the prior art. The method comprises the following steps: arranging a benthic penetration type sonar array to synchronously collect a water body reflection signal and a benthic environment sample, and extracting juvenile fish specific gene fragments by combining an environment DNA (Deoxyribose Nucleic Acid) enrichment technology to generate concentration distribution data; screening juvenile fish distribution data by using an acoustic reflection signal and body length correlation model, and positioning an active hot spot area through space-time overlapping analysis; deploying a directional sound wave excitation device to obtain escape trajectory data, and calculating a survival rate in combination with a density attenuation model; finally, multi-source data and topographic features are fused to generate a real-time population dynamic monitoring result, and high-precision and non-intrusive monitoring of the juvenile fish population in the hidden environment is realized.

The invention relates to a method for improving body color and growth of young lutjanus erythropterus, which comprises the following steps of: breeding the young lutjanus erythropterus in an indoor breeding barrel, feeding the young lutjanus erythropterus with feed in the period, feeding the young lutjanus erythropterus once in the morning and afternoon every day, changing water and cleaning the bottom every day, and carrying out breeding under the following conditions: i) continuously aerating in the breeding barrel by using a nano air stone, the concentration of dissolved oxygen is 6.5-7.4 mg / L, ii) the pH value of water in the culture barrel is 7.5-8.4, iii) the water temperature and salinity in the culture barrel are kept relatively unchanged and are 27.3-33.2 DEG C and 25-31 per mill, and iv) the culture barrel is covered with black-out cloth, the illumination condition of culture is set as a blue light source, and the light intensity from the edge to the center of the culture barrel is 250-1500lux; and v) the breeding period is more than 45 days. According to the method, the proper light environment is created for the lutjanus erythropterus according to the preference of lutjanus erythropterus to the light environment, the growth and survival rate of the lutjanus erythropterus can be improved, the brightness and redness value of the lutjanus erythropterus body color can be improved, lutjanus erythropterus seedlings which grow fast, are good in condition and are high in survival are obtained, and the economic benefits of breeding enterprises are improved.

A juvenile fish cultivation apparatus and method, relating to the technical field of aquaculture. The juvenile fish cultivation apparatus comprises a cultivation tank (1), a visual identification apparatus (3), a translation mechanism, and a feeder capable of timed activation. A cultivation pond (2) is provided in the cultivation tank (1); the cultivation pond (2) is divided into three feeding areas by means of partition plates (9); isolation holes (11) and a fish pass gate (10) capable of opening and closing are provided on each partition plate (9); and fish guiding devices (5) are provided in the feeding areas located on both sides. The feeder is translated by means of the translation mechanism; the translation direction is perpendicular to the arrangement direction of the feeding areas; and the feeder can swing reciprocatingly for feeding. The visual identification apparatus (3) comprises a visual module and a control module; when the visual module detects that a juvenile fish in the middle feeding area has grown to a preset large-size, the fish pass gate (10) opens and the fish guiding devices (5) are started; and when there is no juvenile fish in the middle feeding area, the fish pass gate (10) closes and the fish guiding devices (5) are turned off. Regular and dosed feeding can be achieved, inconvenient feeding caused by aggregated bait is avoided, and a safe growth environment with sufficient feed is provided for small-sized juvenile fishes, thereby reducing the size disparity among juvenile fishes.

The invention provides a breeding method of hypoxia-resistant golden tiger hybrid spots, which comprises the following steps: carrying out artificial insemination on a female parent of epinephelus coioides and a male parent of epinephelus coioides to obtain fertilized eggs, carrying out 2.8-3.2 mg / L hypoxia screening on the female parent for more than three generations, and ensuring that the suffocation point is less than or equal to 0.9 mg / L. Performing staged low-oxygen incubation on the fertilized eggs, gradually reducing dissolved oxygen in an embryonic period, a protointestinal period and a membrane emergence period, performing specific sound wave stimulation in an opening period of larva fish, performing low-oxygen-resistant phenotype screening in a larva period, performing intermittent low-oxygen intensive training in a juvenile fish period, applying water flow stimulation before training, and performing low-oxygen-resistant phenotype screening in a membrane emergence period; during the period, a fortified feed containing gamma-aminobutyric acid, heme iron and other components is fed. According to the method, through multi-link collaborative innovation, the hypoxia resistance of the Jinhu hybrid spots is effectively improved, the survival rate of a target group under 2.5 mg / L dissolved oxygen reaches 93%, the suffocation point is reduced to 0.75 mg / L, meanwhile, gill filament development and growth are promoted, and an efficient technical scheme is provided for aquatic product breeding.

The invention provides an automatic bait casting system for training and breeding juvenile plectropomus leopardus, which comprises a basic data module connected with an automatic bait training device and used for acquiring original data of a breeding pond and extracting feeding basic data; the dynamic association module is used for carrying out multi-level cross association modeling, causal inference association, sub-mode mining and classification adaptation to obtain an ingestion-turbidity dynamic association model and outputting an ingestion-turbidity relationship; the hunger index module is used for constructing a hunger index model and outputting the hunger index of each culture pond; the feeding strategy module is used for calculating the next feeding interval, the strip-shaped bait-live bait proportion, the actual time point of next feeding and the bait amount per hour and judging whether extra meal or increase of the next feeding interval is needed or not to obtain a self-adaptive feeding strategy; and the feeding driving module is used for controlling the running action of the automatic bait training device. Scientific feeding can be achieved, the feeding survival rate, the growth rate and the bait training effect are remarkably improved, feed waste is reduced, and intelligent and automatic management of the whole process is achieved.

The invention relates to a method for evaluating toxicity of spiroxamine by using zebra fish and application of the method, and belongs to the technical field of toxicity detection. According to the method, spiroxamine culture solutions with different concentrations are prepared for culturing zebrafish embryos, embryonic development detection and juvenile fish behavior testing are carried out, embryonic development detection includes hatching rate, heart rate and body length, and juvenile fish behavior testing includes spontaneous movement testing, vortex escape testing, swimming behavior testing, reflex behavior testing and color stimulation testing. According to the method provided by the invention, the toxic effect of spiroxamine on zebra fish embryos and juvenile fishes is systematically and comprehensively evaluated, the intuition and accuracy of spiroxamine toxicity detection are improved, and the method can be applied to evaluating the toxicity of environmental samples containing spiroxamine.

The invention discloses a red fluorescent silicon nanodot as well as a preparation method and application thereof. The method comprises the following steps: S1, weighing sulforhodamine 101, adding ultrapure water for dissolving, then adding N-(2-aminoethyl)-3-aminopropyltrimethoxysilane, uniformly stirring, transferring the obtained mixture into a reaction kettle, and heating for reaction; and S2, after the reaction is finished, cooling to room temperature, purifying the obtained product by using a silica gel chromatographic column, eluting by using an eluent, collecting the eluent, and finally, freeze-drying to obtain the red fluorescent silicon nanodots. Compared with common blue-green fluorescence, red fluorescence emission has deeper tissue penetrability and background fluorescence interference resistance; the silicon nanodot provided by the invention not only has excellent light stability and high quantum yield, but also has characteristics similar to lipophilic cations, and can specifically target mitochondria in living cells; in addition, the silicon nanodots also show excellent imaging ability in zebrafish embryos and juvenile fish bodies.

The invention relates to an application of extracellular beta-glucan derived from aureobasidium melanogenum in preparation of a training immunity inducer. By establishing a mouse bone marrow derived macrophages (BMDMs) and zebra fish juvenile fish training immune activation evaluation model, the immunocompetence of extracellular beta-glucan (eBG) derived from aureobasidium melanogenum is evaluated, and it is found that the extracellular beta-glucan has a more remarkable training immune activation effect compared with beta-glucan (cBG) derived from cell walls, and the immunocompetence of the extracellular beta-glucan (eBG) derived from aureobasidium melanogenum is improved. It is proved that the extracellular beta-glucan (eBG) from the melanin-producing aureobasidium is an excellent training immunity inducer and has a good application prospect in the fields of feed addition of bred animals and disease immune prevention and control.

The invention provides an artificial propagation method of Sinilabeo wuyi, and belongs to the technical field of aquatic animal breeding. The artificial propagation method of the Sinilabeo wuyi comprises the steps of parent fish classification, parent fish rearing, artificial spawning induction, natural insemination, artificial insemination, fertilized egg incubation, fry rearing, juvenile fish rearing and the like. The oxytocic is reasonable in compatibility, the injection time of the oxytocic is accurate, the oxytocic rate, the fertilization rate and the hatching rate are increased, and damage to parent fishes is small. According to the method, feeding methods in different stages of fry breeding are also defined, the survival rate of the sinilabeo wuyi fry breeding stage is increased, and a technical support is laid for artificial breeding of the endangered species sinilabeo wuyi.

The invention discloses a zebra fish spermatogonial stem cell separation and transplantation method, and belongs to the technical field of fish germline stem cell separation. The method comprises the following steps: washing complete sexual glands of zebra fish testis by adopting penicillin / streptomycin double-antibody-containing PBS (Phosphate Buffer Solution), physically shearing, digesting and dissociating, and filtering by a screen, so as to obtain zebra fish testis cell suspension; performing density gradient centrifugation to obtain zebra fish spermatogonial stem cells; dyeing, marking, centrifuging, washing, re-suspending, and carrying out micro-injection transplantation to enter the back of the abdominal cavity of the acceptor zebrafish juvenile fish. According to different physical properties of different cells, spermatogonial stem cells are separated, purified and transplanted from zebra fish testis cell suspension by adopting a density gradient centrifugation method, and migration and proliferation processes of donor germ cells can be observed in receptor fish after fluorescence labeling. And a new technical path is provided for fish germplasm resource preservation, endangered fish protection, economic cultured fish yield increase and new variety cultivation.

The invention discloses a method for efficiently trapping young tilapia mossambica. The method is mainly composed of specially-made baits and an improved ground cage. The bait is prepared from the following components: 20% of silkworm chrysalis meal, 20% of acete chinensis meal, 20% of earthworm powder, 12% of wheat germ powder, 11% of lamellar algae powder, 10% of snowflake powder, 5% of vital gluten and 2% of vanillin. The content of animal-derived protein in the bait is increased, so that strong fishy smell can be quickly diffused after the bait enters water; and the flaky algae powder, the snowflake powder and the wheat germ powder can form a suspended atomization belt around the bait, so that the bait is continuously peeled off, and the fish luring and retaining effects are better. The vanillin is added, so that the bait emits sweet milk fragrance, and surrounding tilapia mossambica can be effectively attracted. The following improvements are made on the ground cage: an anti-escape design is added; a bait bag is hung near the fish inlet; the space of a fish collecting area is expanded, so that the capturing efficiency is improved.

The invention discloses a method for separating and transplanting spermatogonial stem cells of Chinese sturgeons, and belongs to the technical field of separation of germline stem cells of fishes. The separation method comprises the following steps: washing Chinese sturgeon testis tissues with an L-15 culture medium containing penicillin / streptomycin double antibodies, and carrying out physical shearing, digestive enzyme enzymolysis and screen filtration to obtain a Chinese sturgeon testis cell suspension; performing percoll density gradient centrifugation to obtain high-purity spermatogonial stem cells of the Chinese sturgeons; and dyeing, washing, resuspending and carrying out micro-injection transplantation to enter the gonad primordium reproductive ridge part of the juvenile acceptor fish. According to the physical characteristics of the spermatogonial stem cells of the Chinese sturgeons, the spermatogonial stem cells with high purity are obtained by adopting percoll density gradient centrifugation, and the purpose of abdomen borrowing reproduction is achieved by adopting a microinjection mode, so that the preservation of germ cells of endangered fishes and the reconstruction of artificial populations are realized; and a new technical approach is provided for protecting genetic resources of the Chinese sturgeons and breaking through artificial propagation bottlenecks.

The utility model discloses an incubation fish tank with a filtering function, which comprises a tank body, a fish culture area and an incubation area are arranged in the tank body, a separating partition plate is arranged in the incubation area to divide the incubation area into a female fish area and a roe area which are distributed up and down, and a plurality of through holes for roes to pass through are arranged on the separating partition plate. The female fish area and the roe area are communicated with the fish culture area, isolation plates for blocking the female fish area, the fish culture area, the roe area and the fish culture area are detachably arranged in the tank body, after female fishes in the female fish area lay eggs, roes enter the roe area through the through holes to be hatched into juvenile fishes, the isolation plates are taken out after the juvenile fishes reach the length, and the female fishes and the juvenile fishes enter the fish culture area through the channels. Compared with the prior art, the fish hatching device has the advantages that after fish eggs are hatched into small fishes, the small fishes and adult fishes do not need to be separated specially, female fishes and juvenile fishes in the hatching area can enter the fish culture area only by pulling out the isolation plate after the small fishes grow up, and operation is easy and convenient.

The invention belongs to the field of electronic information and aquaculture fry, and particularly relates to a method for early domestication of siniperca chuatsi juveniles based on an artificial intelligence technology and a matched special feed for domestication of the siniperca chuatsi juveniles. When the siniperca chuatsi juveniles grow to 1 cm, domesticating the siniperca chuatsi juveniles with special puffed pellet feed under the assistance of an artificial intelligence technology. The artificial intelligence technology strictly monitors the water quality condition, the feeding behavior and the fry health condition in the domestication stage, the domestication progress of mandarin fish is more accurately controlled, and the special feed for mandarin fish juvenile domestication is complete in formula, good in palatability and higher in nutritive value and metabolism efficiency. According to the method, artificial intelligence is applied to the mandarin fish domestication process for the first time, early domestication of the mandarin fish juveniles is achieved for the first time, the time for starting domestication of the mandarin fish is advanced from 5-7 cm to 1 cm, and the time for receiving artificial feed by the mandarin fish is advanced from 10 cm or above to 2-3 cm. The controllability of baits in the mandarin fish fry breeding period is improved, meanwhile, the bait cost is saved, and technical support is provided for mandarin fish feed controllable breeding.

The invention relates to the technical field of biological medicines, and particularly discloses a recombinant adenovirus vaccine for viral nervous necrosis of fish as well as a preparation method and application of the recombinant adenovirus vaccine. The method for preparing the viral nervous necrosis disease recombinant adenovirus vaccine by utilizing the replication-defective recombinant adenovirus vector comprises the following specific steps: cloning nervous necrosis virus CP gene, constructing a Pshuttle-CMV-ECMV vector with a target gene, obtaining recombinant adenovirus plasmids, screening to obtain recombinant adenovirus and preparing the recombinant adenovirus vaccine. The prepared recombinant adenovirus vaccine for the viral nervous necrosis of the fish can be used for immunizing and preventing NNV virus infection in a juvenile fish stage in a soaking manner, the stability of the vaccine is good, and animal safety tests prove that the vaccine is safe, effective and convenient and simple in clinical use, and has a relatively good market application prospect.

The invention provides a full-indoor artificial breeding method for plectropomus leopardus, and belongs to the technical field of artificial breeding of marine fishes. The full-indoor artificial breeding method for the plectropomus leopardus comprises the steps of earlier-stage incubation of fertilized eggs, incubation in an indoor breeding pond, breeding in an indoor flowing water pond, breeding in an indoor circulating water pond and the like. By regulating and controlling illumination, the irritability of the fries is greatly reduced, the ecological conditions of the fries are effectively optimized, and the health condition and adaptability of the fries are improved. Meanwhile, different types and different total amounts of biological bait combinations are fed in the larva stage, the juvenile stage and the fish stage of the plectropomus leopardus, transition is made in each bait transfer period, enteritis caused by excessive intake of larvae and juveniles and too little intake caused by inadaptation of bait transfer are effectively reduced, and the problem that the survival rate is low in the bait transfer period can be effectively solved.

Neonatal congenital digestive tract obstruction is digestive system structural deformity caused by various factors in the fetal development process, the invention provides a method for establishing a zebra fish model for neonatal congenital digestive tract obstruction, a gRNA target sequence is designed on an amino acid structural domain of a zebra fish ZIC3 gene, the specific sequence of sgRNA is GCGCCATAAGGTTCCGTACGAGG-3 or GCCCCGGACCATGGTGTGGGG, and a primer is synthesized; the ZIC3 mutation zebrafish juvenile fish grows to 6-7 days, and the zebrafish with the effective mutation type in embryo detection is obtained through multi-step detection.

The invention belongs to the technical field of micro-fluidic chips, and particularly relates to an interference-free zebra fish micro-fluidic chip and an application method thereof. The micro-fluidic chip comprises a channel assembly, a limiting opening and a containing channel; the channel assembly is connected with one side of the limiting opening; the accommodating channel is connected with the other side of the limiting opening; wherein the channel assembly is configured to be capable of carrying out self-adaptive adjustment on the height and the width according to the size of the zebra fish. According to the non-invasive monitoring method realized based on the non-interference zebra fish micro-fluidic chip, stress reaction to the zebra fish in the process of fixing the zebra fish through manual operation is avoided, the use of anesthetic is avoided, the physiological state of the zebra fish is not influenced, the accuracy and the objectivity of experimental data are ensured, and the monitoring accuracy is improved. The micro-fluidic chip can be used for adapting to juvenile zebrafish with different development time, or can be used for observation and shooting recording of other fish fingerlings, and the universality of the micro-fluidic chip is improved.

The invention belongs to the technical field of aquatic genetic breeding, and particularly relates to a grass carp disease-resistant character genome breeding method and related application thereof. According to the method, filial generation juvenile fish families produced by non-family grass carp parents from different geographical sources are used for constructing an anti-hemorrhagic disease reference group, the disease-resistant SNP site provided by the invention is used for calculating a genome estimation breeding value of a candidate group, and individuals with high breeding value are relatively high in disease resistance and can be used for breeding disease-resistant improved varieties of grass carp.

The invention discloses a large-size seawater fry factory-like grading cultivation system, and relates to the technical field of aquaculture. The system comprises a first-stage culture pond, a second-stage culture pond and a third-stage culture pond. The first-stage culture pond is connected with the second-stage culture pond through a conveying pipeline, and the second-stage culture pond is arranged in the third-stage pond. The first-stage tank is provided with an independent first circulating water filtering device and a monitoring unit, and the second-stage tank and the third-stage tank share a second circulating water filtering and monitoring unit. Each monitoring unit integrates growth detection, environment regulation and control and disease early warning functions. The first-stage pond is used for cultivating newly hatched larvae, and the larvae are automatically transferred to the second-stage pond through a conveying pipeline when developing to a juvenile fish stage; the second-stage pond and the third-stage pond jointly form a polyculture environment, and when the juvenile fish reaches the target specification, a cage door is opened, and the juvenile fish is transferred into the third-stage pond. According to the system, through grading environment control and an automatic transfer mechanism, efficient breeding of fish fries from larva fish to large-scale fish fries is achieved, and the problems of uneven growth, low sorting efficiency and the like in traditional fish fry breeding are solved.

The invention discloses a method for regulating and controlling meat quality of weever by changing feeding environment salinity, and relates to the technical field of fish culture, the method comprises the following steps: step 1, selecting feeding objects and feeding environment: selecting juvenile weever which is robust in physique and uniform in specification as experimental objects, and equally dividing the selected experimental objects into two groups, one group is an experimental group, and the other group is a control group; 2, measuring the water quality of the culture ponds: detecting the salinity and other parameters of the culture ponds by using a water quality testing tool, and ensuring that the initial parameters of the two groups of culture ponds are consistent; 3, selectively adding salt specially used for the culture pond or introducing high-salinity natural seawater in proportion; and 4, calculating the addition amount. According to the method, the salinity of the water body after the weever passes through the fry stage is larger than that of the water body in the fry stage, so that the muscle fiber density of the weever is reduced, the hardness and chewiness of fish meat are reduced, the fish meat is tender, juicy and good in taste, and the effect of regulating and controlling the meat quality of the weever is achieved.

The invention relates to a sea cucumber peptide with an anti-PD (Parkinson's Disease) effect, a computer simulation screening method, a synthesis method and application thereof in treatment of Parkinson's Disease, belongs to the field of active peptide screening and application, and solves the problem that the screened and synthesized sea cucumber peptide has the anti-PD effect, and has the technical key points that the sea cucumber peptide is prepared, and the sea cucumber active peptide is screened and synthesized from the sea cucumber peptide. The amino acid sequence of the sea cucumber active peptide is Gln-Trp-Phe-Asp-Trp, and the sea cucumber active peptide mixture has the effects that the prepared sea cucumber active peptide mixture can improve the behavioral level of a mouse induced by Rot, reduce the loss of dopaminergic neurons of nigra, improve the survival rate of SH-SY5Y cells induced by the Rot and improve the survival rate of the SH-SY5Y cells induced by the Rot. The active sea cucumber peptide screened by computer simulation analysis and in-vitro activity experiments on the basis of peptidomics analysis can improve the behavioral level of Rot-induced juvenile zebrafish of 7-day-old zebrafish, alleviates the pathological process of PD by reducing the endogenous ROS content of Rot-induced SH-SY5Y cells and alleviating mitochondrial membrane potential damage, and has a relatively good anti-PD effect.

The invention discloses a method for cultivating red nine-spined perch fry with a high survival rate, and relates to the technical field of marine fish breeding. The cultivation method comprises the following steps: (1) regulating the light source environment: using a blue light source with a wavelength range of 420-450nm to irradiate the red nine-spined perch fry for 60-75 days during the growth process; (2) transforming the bottom environment: laying a layer of artificial materials on the bottom of the water, introducing a water body with a salinity of 30-35‰ as a breeding water body, and using an oxygen pump for aeration throughout the day; (3) feeding A feed and B feed alternately: first feed A feed for 8-10 days, then feed A feed for 8-10 days, and feed alternately until the juvenile stage; A feed is prepared by adding oxalis to the basic feed, and B feed is prepared by adding loperamide to the basic feed. By means of the three parallel measures of regulating the light source + bottom transformation + alternating feeding, it is beneficial to improve the survival rate of red nine-spined perch fry, thereby improving the economic benefits.