110 results about "Membrane Protein Gene" patented technology

A method to prepare viruses with a mutant membrane protein gene, and viruses obtained by the method, are provided.

The invention discloses a loop-mediated isothermal amplification kit for detecting Zika viruses and a using method of the kit. The kit is characterized by consisting of a Zika virus envelop protein (E) gene loop-mediated isothermal amplification primer mixed solution, a loop-mediated isothermal amplification reaction pre-mixed solution, a Zika virus E gene positive quality control and a Zika virus E gene negative quality control, and the kit is applicable to the rapid detection of the Zika viruses. The Zika virus E gene loop-mediated isothermal amplification primer group comprises a pair of outer primers (5'-3' sequences are shown as: AAGCACTGGCTGGTTCAC and TCCAGAGCTCCAGCAAGG), a pair of inner primers (5'-3' sequences are shown as: GTGGAGTTCCGGTGTCTGCCAAGGAGTGGTTCCACGACAT and AGAGTTCAAGGACGCACATGCCTGCTCCTTCTTGACTCCCTA) and a pair of loop primers (5'-3' sequences are shown as: CAGCGTGCCAAGGTAATGGA and AAAAGGCAAACTGTCGTGGT). The using method of the kit is characterized in that the real-time rapid diagnosis of the Zika viruses can be achieved by virtue of an isothermal amplification fluorescent detection system. The method is strong in specificity and high in sensitivity; therefore, a convenient and rapid way is provided for the prevention and control of the Zika viruses and for conducing trend investigation and analysis.

The invention discloses a double-reporter-gene skeleton vector. Double reporter genes of the double-reporter-gene skeleton vector are selected from luciferase and fluorescein, the fluorescein reportergene is preferably an mGFP gene, and the luciferase reporter gene is preferably a Fluc gene. A double-reporter-gene four-plasmid pseudovirus packaging system comprises the double-reporter-gene skeleton vector and three eukaryotic expression packaging plasmids which are respectively integrated with a slow virus gag-pol gene, a slow virus rev gene and an envelope protein gene containing a target virus. A packaged COVID-19 pseudovirus comprises the double-reporter-gene four-plasmid pseudovirus packaging system and a host cell, wherein the host cell is preferably selected from 293T-hACE2 cells. According to the invention, SARS-CoV-2 is specifically implemented, the pseudovirus with single-cycle infection and higher safety can be rapidly packaged, and the vector and the system can be used forresearching coronaviruses such as SARS-Cov2 and the like, provide a powerful screening tool for evaluation of antiviral preparations and vaccines, and have wide application value.

The invention relates to a polyclonal antibody against an outer membrane protein of Candidatus liberobacter asiaticum, and a preparation method and application thereof. The polyclonal antibody is characterized by being prepared through injecting target proteins acquired by prokaryotic expression and used as an immunogen into a rabbit, and can effectively detect Candidatus liberobacter asiaticum existing in citrus by separately and specifically combining with the N terminal and C terminal of the outer membrane protein of Candidatus liberobacter asiaticum. According to the invention, plenty of high-purity target proteins are acquired by carrying out prokaryotic expression on the outer membrane protein genes of Candidatus liberobacter asiaticum, and the target proteins are used as the immunogen and injected into the rabbit, thus preparing and purifying the polyclonal antibody against the outer membrane protein. The titer assay and enzyme-linked immune experiments show that the prepared antibody has high titer and high specificity, and can be used for detecting field samples infected by Candidatus liberobacter asiaticum, thus laying a good foundation for the further development of colloidal gold immunochromatography assay test strips used for the field rapid detection of Candidatus liberobacter asiaticum.

The invention provides a fowl leucovirus subgroup J specific antigenic polypeptide and an application thereof. The sequences of antigenic polypeptide are SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 or deriving sequences of the sequences above. Besides, the antigenic polypeptide is coded by genes in gp 85 section of envelope protein gene (env) of a virus, and has strong specificity, good hydrophily, good reactivity and high purity. In addition, the antigenic polypeptide is used for preparing an indirect ELISA detection kit which can conduct specific detection on an ALV-J antibody, wherein the detection kit comprises one or more of enzyme labeled plates of ALV-J specific antigenic polypeptide above and related reagents, and the enzyme labeled plates and the reagents coat the detection kit. During the detection of ALV-J antibody, the kit has high specificity and low cost, is beneficial to popularization, and the effects are obviously superior to those of conventional kits and imported kits. The ALV-J specific antigenic polypeptide and the ELISA detection kit prepared by the antigenic polypeptide are applicable to evaluation of results of infection or purification of the ALV-J antibody; the ALV-J specific antigenic polypeptide is applicable to preparation of antibody of specific ALV-J.

The present invention relates to a method for expressing each of peptide antibiotics P5 3 and Anal3 35 having amphiphilicity and showing antibacterial, antifungal and anticancer activities 61, 63, 65, 67, 69, 71, on the microbial surface, using a vector containing outer membrane protein genes (pgsBCA) that are derived from Bacillus sp. strains and involved in the synthesis of poly-gamma-glutamate. Moreover, the present invention relates to lactic acid-forming bacteria having each of the peptide antibiotics P5 15 and Anal3 43 expressed on their surface, and the use thereof. According to the present invention, the peptide antibiotics can be expressed on the surface of various microorganisms transformed with the surface expression vectors. The inventive method for the surface expression of the peptide antibiotics allows the peptide antibiotics to be mass-produced without a purification process. Thus, the inventive method has very high industrial applicability. Further, the present invention can be applied to other peptide antibiotics besides P5 3 and Anal3 35.

The invention belongs to the technical field of biology, and particularly relates to a preparation method for aeromonas hydrophila outer membrane protein gene prokaryotic expression protein. The method comprises the following steps that the protein clones an outer membrane protein gene segment into a prokaryotic expression vector pET-30a to obtain a recombinant expression vector, the recombinant expression vector is converted into Escherichia coli to obtain recombinant Escherichia coli, the recombinant Escherichia coli is inoculated to an Amp-resistant LB plate to be cultured for OD600 for 0.6 h, IPTG is added to reach the final concentration being 1.0 mmol / l for inducible expression, and the aeromonas hydrophila outer membrane protein gene prokaryotic expression protein is obtained after purification is performed. According to the method, the aeromonas hydrophila outer membrane protein gene prokaryotic expression protein is successfully constructed, the aeromonas hydrophila outer membrane protein gene prokaryotic expression protein can be used as a vaccine capable of protecting fish, the immune effects of the aeromonas hydrophila outer membrane protein gene prokaryotic expression protein pompA for channel catfish under different FIA effects are compared and researched, and a foundation is laid for further researching the pompA and researching whether the pompA can be used as the candidate component of the genetic engineering subunit vaccine or not.

The invention provides a recombinant magnetospirillum gryphiswaldense and a construction method thereof. The construction method comprises the following steps: firstly, constructing a magnetotactic bacterium mutant strain loosing magnetosome membrane protein gene, then performing gene fusion to the magnetosome membrane protein gene and a functional protein gene, connecting onto pMD18-T Simple Vector, converting into E. coli DH5alpha competent cells, and constructing to obtain recombinant plasmid. The recombinant magnetospirillum gryphiswaldense constructed by adopting the method can be used for synthesizing magnetosome with the surface displayed with functional protein, the magnetosome can be easily connected with an antibody, even nucleic acid, saccharides, lipids and non-antibody proteins and other functional proteins to form a magnetic complex with specific functions, and the complex not only can be used for magnetic separation, but also can be assembled into a magnetic material or a member with a specific structure.

The invention discloses multiple PCR detection primers of escherichia coli, pseudomonas aeruginosa and staphylococcus aureus, a kit and a detection method. Specific primers are designed by means of combined utilization of escherichia coli alkaline phosphatase gene, pseudomonas aeruginosa outer membrance proteins gene and staphylococcus aureus heat-resistant nuclease gene sequences, multiple PCR detection is conducted on a sample by means of the specific primers according to the method, and specific detection of the escherichia coli, the pseudomonas aeruginosa and the staphylococcus aureus in the sample can be achieved at a time; the detection time is short, operation is easy and convenient, the detection efficiency can be effectively improved, the requirement of rapid detection is met, the sensitivity is high, the specificity is high, and the multiple PCR detection primers of the escherichia coli, the pseudomonas aeruginosa and the staphylococcus aureus, the kit and the detection method can be applied to microbiological detection work of cosmetics.

The invention provides a quick detection method and a fluorescent PCR (polymerase chain reaction) detection kit invented according to the typical biochemical characteristics of sucrose, arabinose, mannose, oxidase, haircuts, salt-free peptone water and the like of the vibrio cholerae. The invention designs primers and TaqMan probes according to the outer-membrane protein gene (ompW), the toxin expression regulation protein gene (toxR) and the hemolysin gene (hlyA), wherein the vibrio cholerae outer-membrane protein gene is used as a characteristic gene for identifying the vibrio cholerae, andthe toxin expression regulation protein gene and the hemolysin gene are used for discriminating toxin genes carried by the vibrio cholerae. The fluorescent detection method for detecting the vibrio cholerae and related toxin genes thereof is provided based on the three genes. According to the detection method, strains are primarily screened through biochemical reaction, the strains with positive results are confirmed by fluorescent quantitative PCR, and the strains with positive ompW genes are vibrio cholerae. The vibrio cholerae and related toxin genes thereof can be quickly, accurately and specifically detected by the biochemical reaction and fluorescent quantitative PCR.

The invention relates to a V. alginolyticus outer-membrane protein W gene, process for preparing the same and uses. The invention provides a novel V.alginolyticus OmpW gene, and the use of V.alginolyticus and Vibrio vulnficus OmpW protein and coded sequence, which comprises, linking purified nucleic acid sequence encoding protein active polypeptides having V.alginolyticus OmpW to expression regulation sequence, forming V.alginolyticus OmpW protein expression carrier, transferring the expression carrier into host cells, forming the recombination cells of the V.alginolyticus Omp protein, culturing the recombination cells and separating.

In summary of this disclosure, the present invention provides a method of nucleic acid, including DNA, immunization of a host, including humans, against disease caused by infection by a strain of Chlamydia, specifically C. pneumoniae, employing a vector, containing a nucleotide sequence encoding an 98 kDa outer membrane protein of a strain of Chlamydia pneumoniae and a promoter to effect expression of the 98 kDa outer membrane protein gene in the host. Modifications are possible within the scope of this invention.

The invention belongs to the biological technical field, and particularly relates to aeromonas hydrophila outer membrane protein gene prokaryotic expression protein and an application thereof. An outer membrane protein gene segment is cloned into a prokaryotic expression vector pET-30a by the protein, a recombinant expression vector is obtained, the recombinant expression vector is converted into escherichia coli to obtain recombinant escherichia coli, the recombinant escherichia coli is inoculated into an Amp resistant LB panel to be subjected to cultivating until OD 600 reaches 0.6, IPTG is added, the final concentration reaches 1.0 mmol / L, inducible expression is carried out, and after purification is conducted, the aeromonas hydrophila outer membrane protein gene prokaryotic expression protein is obtained. The aeromonas hydrophila outer membrane protein gene prokaryotic expression protein is obtained successfully, the aeromonas hydrophila outer membrane protein gene prokaryotic expression protein can serve as vaccine which has the protecting effect on fishes, the immune effects on channel catfish by the aeromonas hydrophila outer membrane protein gene prokaryotic expression protein pompA under the different FIA effects are compared and researched, and the basis is provided for the further research whether ompA can serve as a candidate ingredient of genetic engineering subunit vaccine or not.

The invention discloses a recombinant protein containing an SARS virus N antigen and a baculovirus displaying an N protein. The recombinant protein SP-N-TM is formed by connecting an N- end of the N protein of an SARS virus with a signal peptide SP of a baculovirus envelope protein GP64, and connecting a C- end with a transmembrane domain TM of the baculovirus envelope protein GP64. The recombinant baculovirus having the surface displaying the SARS antigen N protein is the recombinant baculovirus obtained by the steps of inserting a cording gene of the SP-N-TM into a donor plasmid, carrying out homologous recombination with a genome of a shuttle vector Bacmid through transposition to obtain a recombinant baculovirus genome, then transfecting a bombyx mori cell with the recombinant baculovirus genome, and packaging in the cell to obtain the recombinant baculovirus. The recombinant baculovirus allows an N protein gene of the SARS virus to be fused with a bombyx mori baculovirus envelope protein GP64 gene, realizes display of the N protein on the surface of a viral capsid, and has good immunogenicity and large application value.

The invention provides a bartonella henselae PCR identification method. Specific primers are designed according to a sequence hypervariable region of a bartonella henselae outer membrane protein gene BH13010 and specific amplification is performed by using tested sample DNA or bacterial cultures as a template. If a specific band can be obtained by amplification, bartonella henselae is identified.The sequences of the primers in the method are shown as SEQIDNo.6 and 7. The invention has advantages of good specificity of primers, high accuracy of identification method, simple operation, low requirement of equipments and low cost.

The invention discloses a method for improving the formation of a citrobacter werkmanii biofilm and provides a method for improving the biofilm forming ability of a strain by knocking out an outer membrane protein ompA gene of citrobacter werkmanii. A knockout vector is constructed by using a plasmid pYG4, and an ompA gene is knocked out by using a gene homologous recombination principle, so thatdelta ompA is obtained. The delta ompA character is analyzed through crystal violet staining and other methods, and the result shows that compared with wild citrobacter werkmanii, the biofilm formingability of delta ompA is improved by four times or above, and the drug resistance of delta ompA to isothiazolinone bactericides is also correspondingly improved. According to the ompA knockout strainconstructed by the invention, the formation amount and the drug resistance level of a citrobacter welchii biofilm can be effectively improved, so that the application scenarios and ranges of citrobacter werkmanii for heavy metal ion adsorption, construction of cell protein synthesis factories and the like are broadened.

The invention provides a gene chip used for detecting the common pathogens of sexually transmitted diseases and a kit used for detection, wherein, the gene chip includes a solid phase vector and an oligonucleotide probe fixed on the solid phase vector; the oligonucleotide probe mainly comprises a DNA segment or a complementary DNA segment thereof which is selected from Diplococcus gonorrhoeae, Ureaplasma urealyticum and the 16S rRNA gene of M.hominis, the outer membrane protein gene (ompA gene) of a Chlamydia trachomatis, the glycosidoprotein B gene (gB gene) of a herpes simplex virus (HSV) and the L1 gene of a papilloma virus (HPV). The gene chip and the kit can be utilized for achieving the goal of detecting the common pathogens of sexually transmitted diseases; the gene chip and the kit for detection are simple and convenient to be operated, have high flux, accuracy and repetitiveness; and the gene chip and the kit for detection can be applied to the clinic detection and epidemiology analyzing of medical and health organizations.

The invention relates to a method for expressing an IBV-HN99 membrane protein gene in an insect-rhabdovirus system, which belongs to the field of biological engineering. The invention also discloses a recombinant expression carrier of the membrane protein gene, and the recombinant expression carrier simultaneously contains a maltose label and a green fluorescent protein gene named ACB acmid-egfp-MBP-M. The method for expressing the IBV-HN99 membrane protein gene in the insect-rhabdovirus system is as follows: an expression carrier Bacmid-egfp-MBP-M is used for transfecting an Sf9 cell by a lipidosome transfect method through two generations of blind passages. The construction of the method for expressing the IBV-HN99 membrane protein gene in the insect-rhabdovirus system has important significance for developing a gene engineered vaccine of an IBV M gene or an ELISA diagnostic reagent kit of the M protein.

The present invention relates to a prawn white spot syndrome virus multivalent vector vaccine and application thereof. The multivalent vector vaccine is a recombinant vibrio anguillarum containing envelope protein VP19 gene segment or VP28 gene fragment of the prawn white spot syndrome virus. The VP19 protein or the VP28 protein exist on the surface of the recombinant vibrio anguillarum cells. According to the invention, a strain of non-pathogenic vibrio anguillarum wild strain HT5301 is used as a vector strain; a vaccine prepared from the strain has ability to protect prawn from infection of vibrio anguillarum; besides, the vaccine does not have pathogenicity of the vibrio anguillarum but retains invasiveness on the shrimp, and can be administered through soaking and oral administration, so as to realize vaccination with natural injection effect and compensate for defects of single valence and inconvenient administration. The vaccine is simple and convenient for usage, and is a multivalent, safe, and economical vaccine for control of prawn white spot syndrome virus and vibriosis.

The invention discloses a membrane protein gene of an infective bronchitis virus of chicken. A complete sequence of the gene comprises 669 ribotides for coding M proteins of 222 amino acid residues. The discoveries of a molecule genetic variation rule of the membrane protein gene of the chicken infective bronchitis virus and an epitope on the coded membrane protein of the gene have important significance to the development and the application of infective bronchitis genetic engineering antigens and genetic engineering vaccines. The invention also discloses a method for cloning the gene, wherein 5'-CGGAATTCAGTTTCCTAAGAACGGTTGGAA-3' is used as an upper primer and 5'-CCCAAGCTTCTCTCTACACGCACACATTTAT-3' is used as a lower primer for amplifying a full-length segment of the membrane protein gene of a chicken infective bronchitis virus HN99 through an RT-PCR method.

The invention discloses a rapid differential diagnosis method of riemerella anatipestifer disease and colibacillosis. The method includes that riemerella anatipestifer 42-KD outer membrane protein gene and Escherichia coli phoA gene are selected to synthesize two pair of specificity primers used for gene amplification of the two germs, the amplified segments are respectively 809bp and 622bp, difference of the two is 187bp, and the established RA and E.coli double PCR method can rapidly, specifically and sensitively can detect and differentiate the two bacteria. The invention has the advantage that the method of the invention has lower required expense, higher efficiency and stronger specificity compared with the traditional differential diagnosis method.

The invention relates to the field of medicament preparation, and particularly relates to applications of a Periostin gene and a Periostin antibody in preparation of medicaments. The Periostin gene expression is closely relevant to the occurrence and development of NAFLD (Nonalcoholic Fatty Liver Disease) and hyperlipidemia through remarkable expression increase of the Periostin gene in the liver of a high-fat diet-induced obesity mouse, the significant expression rise of Periostin in a patient with fatty liver, and obvious positive correlation between the Periostin and liver TG (Triglyceride) content as well as serum TG content, and the Periostin gene and the Periostin antibody can be used for preparing and screening a NAFLD reagent and a hyperlipidemia reagent. The Periostin antibody can be used for neutralizing Periostin in the obese mouse body, obviously reducing the liver / weight ratio, and the TG content of the liver and serum, therefore, the Periostin antibody achieves the effects of obviously improving the development of the NAFLD and reducing the TG content in serum.

The invention provides a method and kit for detecting xanthomonas oryzae pv. oryzicola by use of digital-PCR (polymerase chain reaction). The provided kit contains a pair of specific primer pairs and a probe with fluorescent marks at two ends, wherein the nucleotide sequence of the primer pairs is shown in SEQ ID NO.1-2, and the nucleotide sequence of the probe is shown in SEQ ID NO.3. The detection primers are designed on basis of assumed membrane protein genes of xanthomonas oryzae pv. oryzicola. Experiments prove that the provided method for detecting the xanthomonas oryzae pv. oryzicola is good in specificity, high in sensitivity and accuracy of detection results and suitable for detection of germs in rice seed samples and has important application value.

The invention relates to the technical field of medical detection, in particular to primers for detecting mycoplasma genitalium, a probe for detecting mycoplasma genitalium, a kit for detecting mycoplasma genitalium and a detection method. The primers and the probe comprise a primer pair of nucleotide sequences shown in SEQ ID NO:1-2 as shown in the description and a probe of a nucleotide sequenceshown in SEQ ID NO:3 as shown in the description. The provided primers and probe can specifically bound to a mycoplasma genitalium outer membrane protein B gene and a human beta-globin gene, the detection sensitivity and specificity are significantly improved, the positive rate of low-value samples reaches 100%, and detection results are accurate and reliable so that the primers, probe and kit for detecting mycoplasma genitalium and the detection method can be applied to clinical detection of mycoplasma genitalium.

The present invention relates to a method for expressing each of peptide antibiotics P5 3 and Ana13 35 having amphiphilicity and showing antibacterial, antifungal and anticancer activities 61, 63, 65, 67, 69, 71, on the microbial surface, using a vector containing outer membrane protein genes (pgsBCA) that are derived from Bacillus sp. strains and involved in the synthesis of poly-gamma-glutamate. Moreover, the present invention relates to lactic acid-forming bacteria having each of the peptide antibiotics P5 15 and Ana13 43 expressed on their surface, and the use thereof.According to the present invention, the peptide antibiotics can be expressed on the surface of various microorganisms transformed with the surface expression vectors. The inventive method for the surface expression of the peptide antibiotics allows the peptide antibiotics to be mass-produced without a purification process. Thus, the inventive method has very high industrial applicability. Further, the present invention can be applied to other peptide antibiotics besides P5 3 and Ana13 35.

The invention relates to construction of a rough Brucella strain of a recombinant chlamydia psittaci outer membrane protein MOMP gene and a vaccine thereof. A rough bovine Brucella attenuated strain RA343 is taken as a parent strain, a sucrose suicide plasmid is taken as a vector, the Chlamydia psittaci outer membrane protein MOMP gene containing a specific promoter sequence is inserted into a Brucella genome without trace after codon optimization, and the recombinant Brucella strain RA343-MOMP capable of efficiently expressing the Chlamydia psittaci outer membrane protein gene is successfullyconstructed. The recombinant strain not only retains the rough type characteristic of an original parent strain RA343 and has good immunoprotection on brucellosis (brucellosis). In addition, an MOMPantibody against chlamydia psittaci can be generated after the recombinant strain is used for immunizing animals, and accordingly immunoprotection on chlamydia psittaci is achieved. The vaccine prepared by the recombinant vaccine strain can simultaneously realize double immune protection on brucellosis and chlamydia psittaci after being used for immunizing animals.

The invention relates to the field of a virus, a compound and preparation or purification of the virus, in particular to a chimeric virus of a complete envelope protein of an HCV (hepatitis C virus) and a GB virus B. The chimeric virus is formed by sequentially connecting a 5'-end non-coding region and core protein gene sequence of the GB virus B, a complete envelope protein gene sequence of the HCV and a nonstructural protein and 3'-end non-coding region sequence of the GB virus B, wherein the complete envelope protein gene sequence of the HCV is a complete envelope protein gene sequence of a 1b-genotype HCV. A marmoset monkey can be successfully infected by the virus by carrying out intrahepatic injection and intravenous injection of a primary marmoset monkey serum containing the chimeric virus. The chimeric virus simulates infection and immune states of the HCV in a primate body. A platform for carrying out immunoassay and evaluation on the complete envelope protein of the HCV is provided. The scientific problems of limitation on HCV immunity prevention and treatment research, vaccine evaluation and the like due to shortage of a small primate infection model are solved.

The invention relates to construction and function test of a double-long-hairpin RNA (Ribonucleic Acid) expression element for inhibiting HIV-1 (Human Immunodeficiency Virus-1), belonging to the technical field of gene engineering. In accordance with the design principle of siRNA and the conservative analysis of the HIV-1 sequence, an HIV-1 capsid protein gag gene (532-552), an envelope protein env gene (1428-1448), a non-structural protein tat gene (131-151) and a vpu gene (143-161) are selected and designed into a corresponding siRNA sequence; through a two-step PCR (Polymerase Chain Reaction) method, a double-long-hairpin RNA expression element (the sequence list is shown as SEQ ID No.1) is finally constructed; and through microscopic fluorescent observation and flow cell analysis quantitative test, the inhibition effect of the double-long-hairpin RNA expression element on the eukaryotic expression of an HIV gene EGFP (Enhanced Green Fluorescent Protein) fusion protein is tested. Experiments prove that the dlh RNA expression element can effectively inhibit the expression of multiple HIV genes.