Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Salmonella LAMP (loop-mediated isothermal amplification) primer group and kit and detection method

A Salmonella, primer set technology, applied in biochemical equipment and methods, microorganism-based methods, and microorganism determination/inspection, etc. High sensitivity, the effect of preventing the occurrence of false negative test results

Inactive Publication Date: 2013-09-25
SOUTH CHINA UNIV OF TECH +1
View PDF2 Cites 20 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, PCR amplification requires expensive instruments, and many grassroots testing units do not have the corresponding testing conditions

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Salmonella LAMP (loop-mediated isothermal amplification) primer group and kit and detection method
  • Salmonella LAMP (loop-mediated isothermal amplification) primer group and kit and detection method
  • Salmonella LAMP (loop-mediated isothermal amplification) primer group and kit and detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] The establishment of embodiment 1 Salmonella LAMP detection kit

[0066] Salmonella LAMP detection kit, including LAMP primer set, LAMP reaction solution, Bst DNA polymerase, 10×SYBR, positive control, negative control and internal standard.

[0067] (1) LAMP primer set: Salmonella fimI was used as the detection gene and invA was used as the internal standard gene, and the online design software Primer Explorer version4 (http: / / primerexplorer.jp / e) was used to design LAMP primers.

[0068] The sequences of the fimI detection primers are as follows:

[0069] SafimI-F3: CACTAAATCCGCCGATCAA;

[0070] Safim I-B3: CAACGGTGAGGAGGTATTATC;

[0071] SafimI-FIP: TTCGGATCGCAGTCATTCAGGCGATTGGTGATACGACCG;

[0072] SafimI-BIP: GGTCAGGCAGATAACACCAACATTGCGGTGGTGCTATTATC;

[0073] Safim I-LF: TGGTGAAAGGCACCTGTG;

[0074] Safim I-LB: ATTTGCTGGCTGTCTCCTC.

[0075] The sequence of the invA internal standard primer set is as follows:

[0076] SainvA-F3: CGAAGCGTACTGGAAAGG;

[0077] ...

Embodiment 2

[0098] Embodiment 2 Sensitivity experiment

[0099] Use the internal standard constructed in Example 1 to conduct a sensitivity experiment. The plasmid was diluted 10 times as a quality control standard. The operation in Example 1 was used for detection, and the reaction was carried out at 63-65°C for 45 minutes. The minimum detection level of the internal standard gene was determined through the sensitivity experiment. Out limit 10fg / μl (such as figure 1 ), position the internal standard concentration at the concentration of the lowest detection limit ( figure 2 ).

[0100] Cultivate the cultured Salmonella (refer to GB4789.4-2010), perform a 10-fold gradient dilution of the cultured bacteria, extract DNA according to the method in Example 1, and perform plate culture counting on the diluted bacteria solution, and plate The culture counting results were compared with the lowest sensitivity of this kit, the lowest detection degree of this kit was 2.4×10 3 CFU / mL, test resu...

Embodiment 3

[0101] Embodiment 3 specificity experiment

[0102] Using the method of Example 1 to culture Listeria monocytogenes, Staphylococcus aureus, Escherichia coli O157, Enterobacter sakazakii, Pseudomonas aeruginosa, Escherichia coli, Vibrio parahaemolyticus, Vibrio vulnificus, Abalone respectively Shigella sonnei, Shigella sonnei, Proteus vulgaris, Klebsiella, Micrococcus luteus extract, detect according to embodiment 1, 63 reaction 45min, the result is as follows Figure 4 It shows that the internal standard gene amplification of the positive control is normal, and it is effective for Listeria monocytogenes, Staphylococcus aureus, Escherichia coli O157, Enterobacter sakazakii, Pseudomonas aeruginosa, Escherichia coli, Vibrio parahaemolyticus, Vibrio vulnificus , Shigella baumannii, Shigella sonnei, Proteus vulgaris, Klebsiella, and Micrococcus luteus had no non-specific amplification.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a Salmonella LAMP (loop-mediated isothermal amplification) primer group and kit and a detection method, belonging to the field of a molecular biological detection method for food safety. The Salmonella LAMP primer group designed by the invention comprises a detection primer group and an internal standard primer group; and the detection kit comprises the Salmonella LAMP primer group, a DNA (deoxyribonucleic acid) polymerase, an LAMP reaction solution, a fluorescent nucleic acid dye, an internal standard, a positive control and a negative control. The detection method comprises the following steps: extracting a sample to be detected, and amplifying the sample template at 63-65 DEG C for 30-45 minutes. Thus, whether the sample to be detected contains Salmonella can be detected, and meanwhile, whether a false negative detection result exists can be judged according to whether the detection internal standard primer group is amplified. The invention has the advantages of high speed, high efficiency, simple operation process, high specificity, high sensitivity and the like, is suitable for on-site detection, can effectively prevent the occurrence of false negative, and is suitable for popularization and application.

Description

technical field [0001] The invention belongs to the field of molecular biology detection methods for food safety, and in particular relates to a salmonella (salmonella) LAMP primer set, a kit and a detection method. Background technique [0002] Salmonella is a common zoonotic pathogen, which not only causes various animal diseases, but also is related to many human diseases. Among them, the food poisoning cases caused by Salmonella are in the forefront of food poisoning. [0003] Members of the genus Salmonella can infect a variety of animals and humans, most of which are highly pathogenic. Salmonella infection has been widely valued because of its harm to human beings, livestock and poultry industry. According to the report of the World Health Organization, Salmonella food contamination is increasing day by day in various countries in the world, causing huge economic losses and seriously threatening people's health and life safety. Therefore, Salmonella has been listed as...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/11C12Q1/68C12Q1/10C12R1/42
Inventor 石磊李艳莉王珊珊赵一鸣张志刚苏永裕孟赫诚闫鹤
Owner SOUTH CHINA UNIV OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com