Unlock instant, AI-driven research and patent intelligence for your innovation.

A set of primers and its application in the rapid detection of Microsporidium silkworm

A technology of microsporidia and silkworm, which is applied in the application field of rapid detection, and achieves the effect of simple operation

Inactive Publication Date: 2011-11-30
SOUTH CHINA AGRI UNIV
View PDF0 Cites 20 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] However, based on the limitations of key technologies, especially the design of primers and the technical problems of primer-related detection reagents, there is no relevant technical report on the application of LAMP method to detect N.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A set of primers and its application in the rapid detection of Microsporidium silkworm
  • A set of primers and its application in the rapid detection of Microsporidium silkworm
  • A set of primers and its application in the rapid detection of Microsporidium silkworm

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] In this example, the CTAB method and the boiling precipitation method were used to prepare the DNA of N. silkworm for detection by the LAMP method.

[0035] In this embodiment, Microsporidia silkworm ( Nosema bombycis , N. bombycis , referred to as N.b) (obtained by the Sericulture Biotechnology Laboratory of South China Agricultural University through conventional subculture with mulberry leaves, or No. silkworm provided by other laboratories or research institutes in this field) as materials, respectively passed CTAB method, boiling precipitation method (Liu Jiping. Identification technology and molecular phylogeny of insect microsporidia. South China Agricultural University, doctoral dissertation, 2005; Chen Dongmei, Lin Ying, Wang Yanxia. A simple method for isolating high-quality silkworm genomic DNA Sericulture Communication, 2007,27(2):5-9) Two methods were used to prepare N.b DNA template.

[0036] 1. The CTAB method was used to extract template DNA infected ...

Embodiment 2

[0041] Adopt respectively the Bombyx mori microsporidia that embodiment 1 boiling precipitation method and CTAB method obtain N. bombycis The template DNA was used for LAMP detection.

[0042] F2 GGTTTTTCTTGAAACTAGTTCTGT B2 GGTGAATTTTTTAACTACTTTGATGG FI2 TTCCAGCGTCGTTGATTCGC-CATGAATGAGTTGATGCAGTA BI2 CGAATACACTTACCGTCTAGGTCA-ATCATGTTGCTTCTTCATCG

[0043] LAMP reaction uses 25 μL system: 2.5 μL 10×Thermopol Buffer (20 mM Tris-HCl, pH8.8; 10 mM KCl; 2 mM MgSO 4 ; 20 mM (NH 4 ) 2 SO 4 ; 0.1% Triton X-100; ); 2.8 mM dNTPs; 1 M Betaine; 6 μL 25 mMMgCl 2 ; 40 pmol FI2 / BI2 (forward inner primer / reverse inner primer), 5 pmol F2 / B2 (forward outer primer / reverse outer primer); 2 μL Template DNA; 1 μL Bst DNA polymerase (8U); ddH 2 O to make up to 25 μL. The reaction conditions were: 63°C water bath for 60 min; finally 95°C for 2 min inactivation. After the reaction, directly add 1 μL of 10000×SYBR Green I to the reaction tube for staining and d...

Embodiment 3

[0046] (1) Extracting No. spp. infected silkworm N. bombycis template DNA;

[0047] Biological material: Microsporidia silkworm ( Nosema bombycis , referred to as N.b), was subcultured by artificial mulberry leaves by the Sericulture Biotechnology Laboratory of South China Agricultural University (according to conventional methods, it will be coated on the back of fresh mulberry leaves and fed to silkworms, which is a routine experimental method for silkworm infection; it can also be used Silkworm Microsporidia provided by other laboratories or research institutes in this field); CTAB (cetyltrimethylammonium bromide), EDTA (disodium ethylenediaminetetraacetic acid), 6×Loading Buffer, Triton X- 100. Isopropanol (analytical grade), NaOH, KCl, Na 2 HPO 4 12H 2 O, HCl (analytical pure), glycerol, etc. were purchased from Beijing Dingguo Biotechnology Co., Ltd.; chloroform and absolute ethanol were all analytically pure, purchased from the school equipment center, and DL2000 s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a group of primers and application thereof in quick detection of nosema bombycis. The primers have the nucleotide sequences as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4. Based on the primers disclosed by the invention, related reagents applied to quick detection of nosema bombycis by an LAMP (Loop-Mediated Isothermal Amplification) method can be prepared by combining a conventional technology in the field, can detect the nosema bombycis by the LAMP method quickly and accurately, are suitable for operation on a small amount of sample and simple to operate, and have important significance in practical application.

Description

technical field [0001] The invention belongs to the technical field of molecular diagnosis and identification, and in particular relates to a group of specific primers and its application in the rapid detection of microsporidia of silkworm. Background technique [0002] Microsporidia are a class of obligate intracellular parasitic unicellular eukaryotes. by Microsporidia silkworm ( Nosema bombycis , referred to as N.b) The silkworm microparticle disease caused by parasitic silkworms is an infectious disease that seriously harms sericulture production and cannot be cured for a long time, and seriously restricts the healthy and stable development of the silk industry. In the middle of the 19th century, the spread of the disease brought devastating damage to the European silk industry; at the beginning of the last century, the silkworm microparticle disease also brought great harm to China, Japan, India and other sericulture countries. Since Nageli first discovered Bombyx mor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11
Inventor 刘吉平魏建影
Owner SOUTH CHINA AGRI UNIV