A set of primers and its application in the rapid detection of Microsporidium silkworm
A technology of microsporidia and silkworm, which is applied in the application field of rapid detection, and achieves the effect of simple operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] In this example, the CTAB method and the boiling precipitation method were used to prepare the DNA of N. silkworm for detection by the LAMP method.
[0035] In this embodiment, Microsporidia silkworm ( Nosema bombycis , N. bombycis , referred to as N.b) (obtained by the Sericulture Biotechnology Laboratory of South China Agricultural University through conventional subculture with mulberry leaves, or No. silkworm provided by other laboratories or research institutes in this field) as materials, respectively passed CTAB method, boiling precipitation method (Liu Jiping. Identification technology and molecular phylogeny of insect microsporidia. South China Agricultural University, doctoral dissertation, 2005; Chen Dongmei, Lin Ying, Wang Yanxia. A simple method for isolating high-quality silkworm genomic DNA Sericulture Communication, 2007,27(2):5-9) Two methods were used to prepare N.b DNA template.
[0036] 1. The CTAB method was used to extract template DNA infected ...
Embodiment 2
[0041] Adopt respectively the Bombyx mori microsporidia that embodiment 1 boiling precipitation method and CTAB method obtain N. bombycis The template DNA was used for LAMP detection.
[0042] F2 GGTTTTTCTTGAAACTAGTTCTGT B2 GGTGAATTTTTTAACTACTTTGATGG FI2 TTCCAGCGTCGTTGATTCGC-CATGAATGAGTTGATGCAGTA BI2 CGAATACACTTACCGTCTAGGTCA-ATCATGTTGCTTCTTCATCG
[0043] LAMP reaction uses 25 μL system: 2.5 μL 10×Thermopol Buffer (20 mM Tris-HCl, pH8.8; 10 mM KCl; 2 mM MgSO 4 ; 20 mM (NH 4 ) 2 SO 4 ; 0.1% Triton X-100; ); 2.8 mM dNTPs; 1 M Betaine; 6 μL 25 mMMgCl 2 ; 40 pmol FI2 / BI2 (forward inner primer / reverse inner primer), 5 pmol F2 / B2 (forward outer primer / reverse outer primer); 2 μL Template DNA; 1 μL Bst DNA polymerase (8U); ddH 2 O to make up to 25 μL. The reaction conditions were: 63°C water bath for 60 min; finally 95°C for 2 min inactivation. After the reaction, directly add 1 μL of 10000×SYBR Green I to the reaction tube for staining and d...
Embodiment 3
[0046] (1) Extracting No. spp. infected silkworm N. bombycis template DNA;
[0047] Biological material: Microsporidia silkworm ( Nosema bombycis , referred to as N.b), was subcultured by artificial mulberry leaves by the Sericulture Biotechnology Laboratory of South China Agricultural University (according to conventional methods, it will be coated on the back of fresh mulberry leaves and fed to silkworms, which is a routine experimental method for silkworm infection; it can also be used Silkworm Microsporidia provided by other laboratories or research institutes in this field); CTAB (cetyltrimethylammonium bromide), EDTA (disodium ethylenediaminetetraacetic acid), 6×Loading Buffer, Triton X- 100. Isopropanol (analytical grade), NaOH, KCl, Na 2 HPO 4 12H 2 O, HCl (analytical pure), glycerol, etc. were purchased from Beijing Dingguo Biotechnology Co., Ltd.; chloroform and absolute ethanol were all analytically pure, purchased from the school equipment center, and DL2000 s...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
