13 results about "SYBR Green I" patented technology

The invention relates to a PCR (Polymerase Chain Reaction) reagent for detecting porphyromonas gingivalis. Comprising a specific primer pair, a KOD series high-fidelity DNA polymerase premix solution, SYBR Green I fluorescent dye and sterile nuclease-free water, the specific primer pair is composed of a forward primer and a reverse primer, the nucleotide sequence of the forward primer is CGTACTGAACTACGCTTATCTGGGCGATA, the nucleotide sequence of the reverse primer is GGTTGTCCCGCCTGCTAAGATACAA GCTA, the PCR reagent is a mixed solution with an optimized proportion in advance, the total volume is 40 [mu] L, the detection wavelength is 250nm, and the detection wavelength is 250nm. The invention discloses a porphyromonas gingivalis detection kit which comprises the following components in volume range: 20-30 mu L of KOD PCR mix, 1-1.5 mu L of upstream primer FW (10 mu M), 1-1.5 mu L of downstream primer RV (10 mu M), 0.5-1.5 mu L of SYBR Green I (20X stock solution) and the balance of sterile nuclease-free water, when porphyromonas gingivalis is detected, 4 mu L of PCR reagent needs to be taken out and put into a reaction tube, then template DNA to be detected is added, an integrated PCR reaction solution is formed by mixing, and the kit is used for detecting porphyromonas gingivalis. The technical problem that a mainstream P.g bacterium detection method in the prior art cannot meet clinical efficient and accurate detection requirements is solved.

The invention discloses a primer group and a kit for detecting HLA-B27 gene subtypes and distinguishing B27 homozygotes and heterozygotes through fluorescent quantitative PCR and application of the primer group and the kit, and belongs to the technical field of gene detection. The sequence of the primer group is shown as SEQ ID No.1-22, the kit is designed with eight holes per person, and the eighth detection hole is a non-B27 allele detection hole and is a core for distinguishing B27 homozygote and heterozygote. Based on PCR-SSP and SYBR GreenI technologies, precise detection of the HLA-B27 gene subtype is achieved, meanwhile, B27 homozygotes and heterozygotes are effectively distinguished through positive and negative results of an eighth detection hole, and the problem of result confusion caused by mutation point coincidence in the prior art is solved. The method is high in detection accuracy, strong in specificity and simple and convenient to operate, provides a clinical basis for risk assessment and personalized treatment of the central axis type spondyloarthritis, and is high in popularization value.

The invention belongs to the field of detection, and discloses a method for detecting staphylococcus aureus in bulk ready-to-eat food through semi-quantitative developing, which comprises the following steps: designing a specific primer aiming at a tuf gene of staphylococcus aureus; dNA is extracted from a bulk instant food sample to be detected to serve as a template; s2, template DNA is added into an isothermal amplification reaction system for a recombinase-mediated isothermal nucleic acid amplification reaction, wherein the isothermal amplification reaction system comprises the specific primer in the step S1 and SYBR Green I fluorescent dye; after the amplification reaction is completed, a color change judgment result of a reaction system is observed: yellow green fluorescence is judged to be positive under an ultraviolet lamp, orange is judged to be negative under the ultraviolet lamp, and DNA amplification only needs 15 minutes; amplification and detection are completed in one tube and one step at the same time, and the detection result can be accurately, simply, conveniently and rapidly judged according to the presence or absence of an S-shaped curve and the change of the color of a reaction system.

The invention provides a qPCR reaction system, a product thereof and application of the qPCR reaction system in virus detection, and relates to the technical field of qPCR. The invention provides a qPCR (quantitative polymerase chain reaction) buffer solution. The qPCR buffer solution comprises the following components: SYBR Green I, a hot start Taq enzyme, Tris, KCl, MgCl2, (NH4) 2SO4, dNTPs (deoxyribonucleoside triphosphates), choline chloride and hexadecyl trimethyl ammonium bromide. When the qPCR buffer solution is used for detection, the repeatability is good, the detection limit is low, the anti-interference capability is high, and the application potential in virus detection is huge.

The application relates to the field of liquid chromatography analysis, and provides a method for high-performance liquid chromatography analysis of DNA dyes, which comprises the following steps: performing high-performance liquid chromatography analysis on a DNA dye-containing sample to be measured; wherein the DNA dye comprises at least one of PicoGreen and SYBR Green I; the high-performance liquid chromatography analysis adopts gradient elution, and mobile phase A, mobile phase B and mobile phase C are mixed in different proportions as mobile phases; the mobile phase A comprises at least one of acetonitrile and methanol; the mobile phase B comprises at least one of phosphoric acid aqueous solution, formic acid aqueous solution and trifluoroacetic acid aqueous solution; and the mobile phase C comprises ammonium acetate aqueous solution. The method can be used for detecting the purity of Picogreen, SYBR Green I and the DNA dyes, and realizes effective separation of target peaks and impurity peaks.

The invention discloses a singlet oxygen response type chemiluminescence probe and application thereof in Her2 positive breast cancer exosome detection, the core luminescence structure of the probe is adamantyl-1, 2-dioxatetracyclic ketone, and the probe can generate a specific chemical reaction in the presence of singlet oxygen to trigger an efficient chemiluminescence signal. When a recognition probe formed by a Her2 nucleic acid aptamer and a primer T-DNA is combined with a Her2 protein specific recognition module on the surface of the Her2 positive breast cancer exosome, the T-DNA is released, a large number of double-stranded complexes are generated through a catalytic hairpin self-assembly reaction, after a photosensitizer SYBR Green I is embedded, local singlet oxygen is generated under the irradiation of green light, the probe is activated to generate a luminescence reaction, and the Her2 positive breast cancer exosome is detected. Therefore, high-sensitivity detection of the Her2 positive breast cancer exosome is realized. The system has the advantages of low background, high selectivity, excellent sensitivity and the like. The singlet oxygen response type chemiluminescent probe provided by the invention provides a new technical approach for tumor exosome detection and early diagnosis of diseases.

The application discloses a SYBR Green I fluorescent quantitative RT-PCR primer and method for detecting goat parainfluenza virus 3, and belongs to the technical field of microorganism detection. The fluorescent quantitative RT-PCR primer is as follows: M-F: AAGTATGGTGGGAGCGACAAG, M-R: TTCTCAATCTACTGGCCCATGG, and the amplified target fragment is 148 bp. The detection method comprises the following steps: (1) extracting DNA of a sample to be detected; (2) taking the DNA of the sample to be detected as a template, and performing a fluorescent quantitative RT-PCR amplification reaction by using the fluorescent quantitative RT-PCR primer in claim 1 or 2; and (3) performing amplification curve and melting curve analysis on the fluorescent quantitative RT-PCR amplification product obtained in the step (2). The method has the advantages of high specificity, high sensitivity, high clinical detection accuracy and the like.

The invention discloses a fluorescent quantitative PCR (polymerase chain reaction) primer group for detecting pathogenic bacteria of tomato root rot and application, and relates to the technical field of molecular biology and plant disease detection, the primer group comprises a primer pair BT-F / BT-R for specifically detecting the pathogenic bacteria of phytophthora and a primer pair EF-F / EF-R for specifically detecting fusarium oxysporum, the nucleotide sequences of the primers are respectively shown as SEQ ID NO: 1-4. The invention also provides a kit containing the primer group and a method for detecting tomato root rot pathogenic bacteria, and the method comprises the following steps: extracting genome DNA of a sample to be detected, performing SYBR Green I real-time fluorescent quantitative PCR amplification by taking the obtained genome DNA as a template and adopting the primer group, and detecting the tomato root rot pathogenic bacteria according to the fluorescent quantitative PCR amplification result. And judging whether the to-be-detected sample contains phytophthora pathogenic bacteria and fusarium oxysporum or not. According to the invention, tomato root rot pathogens phytophthora and fusarium oxysporum can be specifically detected, and accurate identification and quantitative detection of the phytophthora and fusarium oxysporum can be realized.

This invention provides a method for detecting telomerase activity in plants of the genus *Catella*, belonging to the field of plant telomerase detection technology. Specifically, it includes the following steps: telomerase solution samples are added to a premixed solution, and DEPC-treated water is added to make up the volume. This premixed solution includes TRAP buffer, dNTP mixture, leader primer, reverse primer, and Taq polymerase. PCR amplification is then performed, with the following amplification program: PCR extension at 26 °C for 30 min; pre-denaturation at 95 °C for 2 min; 30 cycles of 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 60 s; 72 °C for 10 min; and storage at 4 °C. After amplification, the PCR amplification products are subjected to agarose gel electrophoresis, stained with SYBR Green I staining solution, and observed under a gel imaging system. This invention proposes a method for detecting telomerase activity in plants of the genus *Catella*, applicable to various plants in the genus, and the testing process is safe and reliable.

This invention belongs to the field of molecular biology detection technology for plant fungi, and discloses a LAMP primer set, reagent kit, and detection method for detecting the pathogen of oat smut. Based on the pathogen of oat smut... Ustilago hordei A set of LAMP-specific primers was designed based on specific sequences from the whole genome. The results were determined using real-time quantitative PCR, agarose gel electrophoresis, and SYBR Green I fluorescent dye assay to detect the oat smut pathogen carried on oat seeds. The LAMP detection method for oat smut pathogen established in this invention is highly specific, sensitive, fast, and low-cost, providing a new technical means for detecting oat smut pathogen carried on oat seeds and possessing high practical application value.

This invention belongs to the field of LAMP detection reagent technology, specifically relating to a fluorescence / colorimetric dual-mode LAMP detection reagent, its preparation method, and its application. The fluorescence / colorimetric dual-mode LAMP detection reagent of this invention comprises: BST DNA polymerase, magnesium sulfate, potassium chloride, phenol red, BSA, mannitol, trehalose, a mixture of dNTPs, a DNA-binding fluorescent dye, and ammonium sulfate. This fluorescence / colorimetric dual-mode LAMP detection reagent of the present invention simultaneously contains a phenol red colorimetric system and a SYBR Green I fluorescence system, allowing the same reaction tube to be read using a fluorescence instrument or observed visually. It eliminates the need to pre-select reagent types based on the detection scenario, providing the flexibility of "one tube, two modes" to adapt to more diverse detection needs. By introducing ammonium sulfate as a reaction enhancer, the different requirements of the two reading modes for the ionic environment are balanced, achieving "dual excellence" in both fluorescence signal and colorimetric effect.

This invention belongs to the field of environmental and food safety testing technology, and specifically discloses a label-free Cd based on SYBR Green I dye. 2+ A rapid detection fluorescent aptamer sensor and its quantitative detection kit are designed to achieve highly sensitive and specific quantitative detection of cadmium ions in samples such as fruits, vegetables, and food products. The fluorescent aptamer sensor includes the nucleic acid aptamer Cd-(21) and its complementary strand CS. Cd‑(21) And SYBR Green I dye; this fluorescent aptamer sensor is used to detect Cd. 2+ This invention offers advantages such as simple operation, short processing time, high sensitivity, and good selectivity. It also provides a matching reagent kit containing the necessary aptamers, complementary strands, SGI, buffer solutions, and other reagents, facilitating operation and application. The kit is simple in design, suitable for various laboratory and field testing applications, and has broad application prospects. The label-free fluorescent aptamer sensor and its matching reagent kit of this invention are Cd... 2+ This provides a new solution for efficient detection, with good technical and practical application value.

The application discloses a kind of based on LAMP-LFD's fast detection raw milk in heat-resistant enzyme producing pseudomonas method, comprising: extracting raw milk bacterial genome;Using the LAMP primer group as shown in SEQ ID NO:1, 2, 3 and 4 carries out loop-mediated isothermal amplification reaction;Using lateral flow test strip or agarose gel electrophoresis or adding SYBR Green I dye to amplification product detects amplification product, if reaction is positive or there is expected amplification band or fluorescence, then consider that raw milk contains heat-resistant enzyme producing pseudomonas.The LAMP method of the application has the advantages of high sensitivity, strong specificity, rapid detection, simple operation, and can be used for the on-site rapid detection of raw milk in heat-resistant protease producing pseudomonas by field production front-line technical personnel.