3 results about "SYBR Green I" patented technology

The application relates to the field of liquid chromatography analysis, and provides a method for high-performance liquid chromatography analysis of DNA dyes, which comprises the following steps: performing high-performance liquid chromatography analysis on a DNA dye-containing sample to be measured; wherein the DNA dye comprises at least one of PicoGreen and SYBR Green I; the high-performance liquid chromatography analysis adopts gradient elution, and mobile phase A, mobile phase B and mobile phase C are mixed in different proportions as mobile phases; the mobile phase A comprises at least one of acetonitrile and methanol; the mobile phase B comprises at least one of phosphoric acid aqueous solution, formic acid aqueous solution and trifluoroacetic acid aqueous solution; and the mobile phase C comprises ammonium acetate aqueous solution. The method can be used for detecting the purity of Picogreen, SYBR Green I and the DNA dyes, and realizes effective separation of target peaks and impurity peaks.

The application discloses a SYBR Green I fluorescent quantitative RT-PCR primer and method for detecting goat parainfluenza virus 3, and belongs to the technical field of microorganism detection. The fluorescent quantitative RT-PCR primer is as follows: M-F: AAGTATGGTGGGAGCGACAAG, M-R: TTCTCAATCTACTGGCCCATGG, and the amplified target fragment is 148 bp. The detection method comprises the following steps: (1) extracting DNA of a sample to be detected; (2) taking the DNA of the sample to be detected as a template, and performing a fluorescent quantitative RT-PCR amplification reaction by using the fluorescent quantitative RT-PCR primer in claim 1 or 2; and (3) performing amplification curve and melting curve analysis on the fluorescent quantitative RT-PCR amplification product obtained in the step (2). The method has the advantages of high specificity, high sensitivity, high clinical detection accuracy and the like.

This invention provides a method for detecting telomerase activity in plants of the genus *Catella*, belonging to the field of plant telomerase detection technology. Specifically, it includes the following steps: telomerase solution samples are added to a premixed solution, and DEPC-treated water is added to make up the volume. This premixed solution includes TRAP buffer, dNTP mixture, leader primer, reverse primer, and Taq polymerase. PCR amplification is then performed, with the following amplification program: PCR extension at 26 °C for 30 min; pre-denaturation at 95 °C for 2 min; 30 cycles of 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 60 s; 72 °C for 10 min; and storage at 4 °C. After amplification, the PCR amplification products are subjected to agarose gel electrophoresis, stained with SYBR Green I staining solution, and observed under a gel imaging system. This invention proposes a method for detecting telomerase activity in plants of the genus *Catella*, applicable to various plants in the genus, and the testing process is safe and reliable.