24 results about "SYBR Green I" patented technology

The invention belongs to the technical field of plant fungus molecular biology detection, and discloses an LAMP primer group, a kit and a detection method for detecting oat smut pathogenic bacteria. A group of LAMP (loop-mediated isothermal amplification) specific primers are designed according to a specific sequence on a whole genome of the oat smut pathogenic bacteria Ustilago hordei, results are judged through a real-time fluorescence quantification method, an agarose gel electrophoresis method and an SYBR Green I fluorescent dye developing method, and the oat smut pathogenic bacteria carried by oat seeds are detected. The LAMP detection method for the oat smut pathogenic bacteria, established by the invention, is strong in specificity, high in sensitivity, high in speed and low in cost, provides a new technical means for detection of the oat smut pathogenic bacteria carried by the oat seeds, and has relatively high practical application value.

The invention relates to a PCR (Polymerase Chain Reaction) reagent for detecting porphyromonas gingivalis. Comprising a specific primer pair, a KOD series high-fidelity DNA polymerase premix solution, SYBR Green I fluorescent dye and sterile nuclease-free water, the specific primer pair is composed of a forward primer and a reverse primer, the nucleotide sequence of the forward primer is CGTACTGAACTACGCTTATCTGGGCGATA, the nucleotide sequence of the reverse primer is GGTTGTCCCGCCTGCTAAGATACAA GCTA, the PCR reagent is a mixed solution with an optimized proportion in advance, the total volume is 40 [mu] L, the detection wavelength is 250nm, and the detection wavelength is 250nm. The invention discloses a porphyromonas gingivalis detection kit which comprises the following components in volume range: 20-30 mu L of KOD PCR mix, 1-1.5 mu L of upstream primer FW (10 mu M), 1-1.5 mu L of downstream primer RV (10 mu M), 0.5-1.5 mu L of SYBR Green I (20X stock solution) and the balance of sterile nuclease-free water, when porphyromonas gingivalis is detected, 4 mu L of PCR reagent needs to be taken out and put into a reaction tube, then template DNA to be detected is added, an integrated PCR reaction solution is formed by mixing, and the kit is used for detecting porphyromonas gingivalis. The technical problem that a mainstream P.g bacterium detection method in the prior art cannot meet clinical efficient and accurate detection requirements is solved.

The application relates to a universal fluorescence platform capable of realizing minute-level DNA companion logic operation and a preparation method and application thereof, and belongs to the technical field of fluorescence platform preparation. The universal fluorescence platform capable of realizing minute-level DNA companion logic operation is a fast, low-cost and universal platform constructed by taking a poly-T chain as a template of copper nanoclusters and double-stranded nucleic acid intercalating dye SYBR Green I as two universal output signals, and is used for various DNA companion logic operations. Benefited from the advantages of label-free and no complex TMSD reaction, the operation of all logic devices can be completed within 10 minutes, and the operation time and cost are 1 / 12 and 1 / 4 of previous work respectively. In addition, the in-vitro intelligent analysis of a disease marker poly-A polymerase is realized by utilizing the characteristics of positive and negative cross verification of opposite logic on the detection result.

The invention discloses a primer group and a kit for detecting HLA-B27 gene subtypes and distinguishing B27 homozygotes and heterozygotes through fluorescent quantitative PCR and application of the primer group and the kit, and belongs to the technical field of gene detection. The sequence of the primer group is shown as SEQ ID No.1-22, the kit is designed with eight holes per person, and the eighth detection hole is a non-B27 allele detection hole and is a core for distinguishing B27 homozygote and heterozygote. Based on PCR-SSP and SYBR GreenI technologies, precise detection of the HLA-B27 gene subtype is achieved, meanwhile, B27 homozygotes and heterozygotes are effectively distinguished through positive and negative results of an eighth detection hole, and the problem of result confusion caused by mutation point coincidence in the prior art is solved. The method is high in detection accuracy, strong in specificity and simple and convenient to operate, provides a clinical basis for risk assessment and personalized treatment of the central axis type spondyloarthritis, and is high in popularization value.

The invention belongs to the field of detection, and discloses a method for detecting staphylococcus aureus in bulk ready-to-eat food through semi-quantitative developing, which comprises the following steps: designing a specific primer aiming at a tuf gene of staphylococcus aureus; dNA is extracted from a bulk instant food sample to be detected to serve as a template; s2, template DNA is added into an isothermal amplification reaction system for a recombinase-mediated isothermal nucleic acid amplification reaction, wherein the isothermal amplification reaction system comprises the specific primer in the step S1 and SYBR Green I fluorescent dye; after the amplification reaction is completed, a color change judgment result of a reaction system is observed: yellow green fluorescence is judged to be positive under an ultraviolet lamp, orange is judged to be negative under the ultraviolet lamp, and DNA amplification only needs 15 minutes; amplification and detection are completed in one tube and one step at the same time, and the detection result can be accurately, simply, conveniently and rapidly judged according to the presence or absence of an S-shaped curve and the change of the color of a reaction system.

The invention provides a qPCR reaction system, a product thereof and application of the qPCR reaction system in virus detection, and relates to the technical field of qPCR. The invention provides a qPCR (quantitative polymerase chain reaction) buffer solution. The qPCR buffer solution comprises the following components: SYBR Green I, a hot start Taq enzyme, Tris, KCl, MgCl2, (NH4) 2SO4, dNTPs (deoxyribonucleoside triphosphates), choline chloride and hexadecyl trimethyl ammonium bromide. When the qPCR buffer solution is used for detection, the repeatability is good, the detection limit is low, the anti-interference capability is high, and the application potential in virus detection is huge.

The application relates to the field of liquid chromatography analysis, and provides a method for high-performance liquid chromatography analysis of DNA dyes, which comprises the following steps: performing high-performance liquid chromatography analysis on a DNA dye-containing sample to be measured; wherein the DNA dye comprises at least one of PicoGreen and SYBR Green I; the high-performance liquid chromatography analysis adopts gradient elution, and mobile phase A, mobile phase B and mobile phase C are mixed in different proportions as mobile phases; the mobile phase A comprises at least one of acetonitrile and methanol; the mobile phase B comprises at least one of phosphoric acid aqueous solution, formic acid aqueous solution and trifluoroacetic acid aqueous solution; and the mobile phase C comprises ammonium acetate aqueous solution. The method can be used for detecting the purity of Picogreen, SYBR Green I and the DNA dyes, and realizes effective separation of target peaks and impurity peaks.

The invention relates to the technical field of molecular biology, and particularly discloses a porcine bocavirus G3 gene group SYBR Green I fluorescent quantitative PCR (polymerase chain reaction) detection primer and application thereof. A synthetic primer is designed according to a highly homologous conserved region of a VP1 gene of a PBoV-G3 gene group, an SYBR Green I fluorescent quantitative PCR method for detecting PBoV-G3 is established, and the SYBR Green I fluorescent quantitative PCR method has the advantages of strong specificity, high sensitivity and good repeatability. Compared with a TaqMan probe method, the method has the advantages that no complex and expensive probe is used, and the detection cost is saved. Compared with common PCR, SYBR Green I fluorescent quantitative PCR can directly quantify the virus load without treatment after amplification, so that the possibility of pollution is reduced, and the method is more suitable for clinical detection of the porcine bocavirus G3 gene group.

The invention provides a method for efficiently separating and purifying SAR11 bacteria, belongs to the technical field of environmental microorganisms, and aims to solve the problems that the SAR11 bacteria are difficult to culture, are easily inhibited by infectious microbes and the like. The method comprises the following steps: pre-filtering a seawater sample by using a 0.45 m mixed cellulose ester film, and enriching SAR11; the method comprises the following steps: by taking artificial seawater as a matrix, adding a mixture of sodium pyruvate, methionine, glycine and vitamins with specific concentration to prepare a culture medium, inoculating a sample into a 24-pore plate, and culturing under the conditions of 17-26 DEG C and darkness / 3000 / 5000lx; the method comprises the following steps: dyeing a sample for 45 minutes by SYBR Green I, and monitoring according to SAR11 light scattering and nucleic acid characteristics by using a flow cytometer (488nm laser excitation); target cells are subjected to expanding culture to obtain single colonies, and 50% glycerol is used for low-temperature breed conservation. According to the method, the separation success rate is increased, the period is shortened, and a support is provided for researching the physiological and ecological functions and the carbon cycle effect of the SAR11.

The invention discloses a singlet oxygen response type chemiluminescence probe and application thereof in Her2 positive breast cancer exosome detection, the core luminescence structure of the probe is adamantyl-1, 2-dioxatetracyclic ketone, and the probe can generate a specific chemical reaction in the presence of singlet oxygen to trigger an efficient chemiluminescence signal. When a recognition probe formed by a Her2 nucleic acid aptamer and a primer T-DNA is combined with a Her2 protein specific recognition module on the surface of the Her2 positive breast cancer exosome, the T-DNA is released, a large number of double-stranded complexes are generated through a catalytic hairpin self-assembly reaction, after a photosensitizer SYBR Green I is embedded, local singlet oxygen is generated under the irradiation of green light, the probe is activated to generate a luminescence reaction, and the Her2 positive breast cancer exosome is detected. Therefore, high-sensitivity detection of the Her2 positive breast cancer exosome is realized. The system has the advantages of low background, high selectivity, excellent sensitivity and the like. The singlet oxygen response type chemiluminescent probe provided by the invention provides a new technical approach for tumor exosome detection and early diagnosis of diseases.

The application discloses a SYBR Green I fluorescent quantitative RT-PCR primer and method for detecting goat parainfluenza virus 3, and belongs to the technical field of microorganism detection. The fluorescent quantitative RT-PCR primer is as follows: M-F: AAGTATGGTGGGAGCGACAAG, M-R: TTCTCAATCTACTGGCCCATGG, and the amplified target fragment is 148 bp. The detection method comprises the following steps: (1) extracting DNA of a sample to be detected; (2) taking the DNA of the sample to be detected as a template, and performing a fluorescent quantitative RT-PCR amplification reaction by using the fluorescent quantitative RT-PCR primer in claim 1 or 2; and (3) performing amplification curve and melting curve analysis on the fluorescent quantitative RT-PCR amplification product obtained in the step (2). The method has the advantages of high specificity, high sensitivity, high clinical detection accuracy and the like.

The invention discloses a rapid detection kit for detecting the content of potassium in serum through a Raman spectrum and a detection method of the rapid detection kit, and particularly provides a potassium ion detection kit and method based on a nucleic acid aptamer and small-particle-size nano-silver SERS (Surface Enhanced Raman Scattering) technology. The kit comprises a specific nucleic acid aptamer, a nano-silver solution and other components. During detection, the conformational change of the aptamer is induced through potassium ions, SYBR Green I molecules and nano-silver are regulated and controlled to interact to generate signal enhancement, and high-sensitivity and high-specificity rapid detection of serum potassium is realized by utilizing Raman spectrum. The method is easy and convenient to operate, high in interference resistance and suitable for clinical and family scenes.

The application relates to SYBR Green I real-time fluorescent quantitative PCR detection primers for simultaneously identifying and detecting MDGPV virulent, MDGPV attenuated and MDPV, the sequences of the primers are shown as SEQ ID NO. 1-2, and the primers are applied to the preparation of a MDGPV virulent, MDGPV attenuated and MDPV simultaneous identification and detection kit. The detection method established by using the primers can simultaneously detect MDGPV virulent, MDGPV attenuated and MDPV, has good specificity, does not have cross reactions with other main waterfowl viruses, has strong specificity, and the detection lower limit of pMD-MDGPV PT-ITR, pMD-MDGPV D-ITR and pMD-MDPV-ITR plasmid standard products is 1.0x10 1 copies per mu L; the variation coefficients of the repeatability test of the method in the group and between groups are all less than 1.0%, and the repeatability is good.

The invention discloses an LAMP (loop-mediated isothermal amplification) specific primer group for identifying corn cyst nematode and application of the LAMP specific primer group. The LAMP specific primer group can be used for identifying the corn cyst nematode. The method comprises the following steps: carrying out loop-mediated isothermal amplification by taking genome DNA (Deoxyribose Nucleic Acid) of a nematode to be detected as a template and adopting a specific LAMP primer group; after the reaction is finished, carrying out agarose gel electrophoresis on an amplification product, or carrying out SYBR Green I chromogenic reaction on an amplification reaction product, or carrying out lateral flow chromatography test strip reaction on the amplification reaction product, and then judging whether the nematode to be detected is the corn cyst nematode or not. According to the LAMP method, the corn cyst nematode can be quickly, simply, conveniently and directly detected according to the color of a reaction system and the number of indication lines of the lateral flow chromatography test strip. The primer group disclosed by the invention is strong in specificity and high in sensitivity, the detection threshold value of a single cyst of the corn cyst nematode is 1 * 10 <-4 > cyst, and the detection threshold value of a single larva is 1 * 10 <-3 > larva.

The invention discloses a fluorescent quantitative PCR (polymerase chain reaction) primer group for detecting pathogenic bacteria of tomato root rot and application, and relates to the technical field of molecular biology and plant disease detection, the primer group comprises a primer pair BT-F / BT-R for specifically detecting the pathogenic bacteria of phytophthora and a primer pair EF-F / EF-R for specifically detecting fusarium oxysporum, the nucleotide sequences of the primers are respectively shown as SEQ ID NO: 1-4. The invention also provides a kit containing the primer group and a method for detecting tomato root rot pathogenic bacteria, and the method comprises the following steps: extracting genome DNA of a sample to be detected, performing SYBR Green I real-time fluorescent quantitative PCR amplification by taking the obtained genome DNA as a template and adopting the primer group, and detecting the tomato root rot pathogenic bacteria according to the fluorescent quantitative PCR amplification result. And judging whether the to-be-detected sample contains phytophthora pathogenic bacteria and fusarium oxysporum or not. According to the invention, tomato root rot pathogens phytophthora and fusarium oxysporum can be specifically detected, and accurate identification and quantitative detection of the phytophthora and fusarium oxysporum can be realized.

This invention provides a method for detecting telomerase activity in plants of the genus *Catella*, belonging to the field of plant telomerase detection technology. Specifically, it includes the following steps: telomerase solution samples are added to a premixed solution, and DEPC-treated water is added to make up the volume. This premixed solution includes TRAP buffer, dNTP mixture, leader primer, reverse primer, and Taq polymerase. PCR amplification is then performed, with the following amplification program: PCR extension at 26 °C for 30 min; pre-denaturation at 95 °C for 2 min; 30 cycles of 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 60 s; 72 °C for 10 min; and storage at 4 °C. After amplification, the PCR amplification products are subjected to agarose gel electrophoresis, stained with SYBR Green I staining solution, and observed under a gel imaging system. This invention proposes a method for detecting telomerase activity in plants of the genus *Catella*, applicable to various plants in the genus, and the testing process is safe and reliable.

This invention belongs to the field of molecular biology detection technology for plant fungi, and discloses a LAMP primer set, reagent kit, and detection method for detecting the pathogen of oat smut. Based on the pathogen of oat smut... Ustilago hordei A set of LAMP-specific primers was designed based on specific sequences from the whole genome. The results were determined using real-time quantitative PCR, agarose gel electrophoresis, and SYBR Green I fluorescent dye assay to detect the oat smut pathogen carried on oat seeds. The LAMP detection method for oat smut pathogen established in this invention is highly specific, sensitive, fast, and low-cost, providing a new technical means for detecting oat smut pathogen carried on oat seeds and possessing high practical application value.

The invention provides a preparation method of nucleotide colloidal dye, which comprises the following steps: carrying out coupling reaction on a compound A and a compound B to obtain a compound C; the compound C and halogenated propane are subjected to a substitution reaction, and the nucleotide colloidal dye SYBR GREEN I is obtained. The synthesis method of the SYBR GREEN I is reported for the first time, the process route is high in synthesis yield and simple, the used raw materials are commercially available reagents, the raw materials are cheap and easy to obtain, and theoretical support can be provided for large-scale popularization of the SYBR GREEN I.

This invention belongs to the field of LAMP detection reagent technology, specifically relating to a fluorescence / colorimetric dual-mode LAMP detection reagent, its preparation method, and its application. The fluorescence / colorimetric dual-mode LAMP detection reagent of this invention comprises: BST DNA polymerase, magnesium sulfate, potassium chloride, phenol red, BSA, mannitol, trehalose, a mixture of dNTPs, a DNA-binding fluorescent dye, and ammonium sulfate. This fluorescence / colorimetric dual-mode LAMP detection reagent of the present invention simultaneously contains a phenol red colorimetric system and a SYBR Green I fluorescence system, allowing the same reaction tube to be read using a fluorescence instrument or observed visually. It eliminates the need to pre-select reagent types based on the detection scenario, providing the flexibility of "one tube, two modes" to adapt to more diverse detection needs. By introducing ammonium sulfate as a reaction enhancer, the different requirements of the two reading modes for the ionic environment are balanced, achieving "dual excellence" in both fluorescence signal and colorimetric effect.

The invention discloses LAMP (loop-mediated isothermal amplification) detection primers for corn stalk rot germs as well as a detection method and application of the LAMP detection primers, and belongs to the technical field of crop disease detection, identification and prevention and treatment. The LAMP detection primer comprises a pair of outer side primers F3 / B3 and a pair of inner side primers FIP / BIP. The LAMP detection method specifically comprises the following steps: (1) carrying out LAMP reaction on a sample to be detected by adopting the detection primer to obtain an LAMP product; and (2) synchronously observing a reaction result by using an LAMP turbidity meter and an SYBR Green I naked eye observation method. The LAMP rapid detection technology for fusarium verticillioides established by the invention has the advantages of strong specificity, high sensitivity, visual detection result and low false positive, can be used for rapidly detecting stem rot caused by fusarium verticillioides in the field, and has a good application prospect.

The invention relates to the technical field of stored grain pest detection, and discloses a Pesportunus trifoliatus RPA-SG visualization establishment method, the method comprises a DNA rapid extraction module, an RPA amplification module, a visualization interpretation module and a result output module, by optimizing primer concentration and reaction time parameters, an efficient and specific RPA isothermal amplification system is constructed, and the RPA-SG visualization establishment method for Pesportunus trifoliatus RPA-SG visualization is realized. Specific primers are designed on the basis of a gene conserved region of the mitochondrial COI of the prymaria rugosa, the sequences of the specific primers are as shown in SEQ ID NO: 1 and SEQ ID NO: 2, and it is ensured that only target species are accurately recognized; nucleic acid amplification is completed within 10 minutes at the constant temperature of 37 DEG C by combining an SYBR Green I fluorescent dye labeling technology, and field visual interpretation without complicated instruments is realized after purification treatment. By applying the technology, the whole process from sample processing to result output can be completed within 40 minutes, the prevention and control efficiency of prymaria rugosoannulata in granaries, customs and other scenes is improved, the single detection cost is reduced, and reliable technical support is provided for intelligent monitoring of stored grain pests.

This invention belongs to the field of environmental and food safety testing technology, and specifically discloses a label-free Cd based on SYBR Green I dye. 2+ A rapid detection fluorescent aptamer sensor and its quantitative detection kit are designed to achieve highly sensitive and specific quantitative detection of cadmium ions in samples such as fruits, vegetables, and food products. The fluorescent aptamer sensor includes the nucleic acid aptamer Cd-(21) and its complementary strand CS. Cd‑(21) And SYBR Green I dye; this fluorescent aptamer sensor is used to detect Cd. 2+ This invention offers advantages such as simple operation, short processing time, high sensitivity, and good selectivity. It also provides a matching reagent kit containing the necessary aptamers, complementary strands, SGI, buffer solutions, and other reagents, facilitating operation and application. The kit is simple in design, suitable for various laboratory and field testing applications, and has broad application prospects. The label-free fluorescent aptamer sensor and its matching reagent kit of this invention are Cd... 2+ This provides a new solution for efficient detection, with good technical and practical application value.

The application discloses a kind of based on LAMP-LFD's fast detection raw milk in heat-resistant enzyme producing pseudomonas method, comprising: extracting raw milk bacterial genome;Using the LAMP primer group as shown in SEQ ID NO:1, 2, 3 and 4 carries out loop-mediated isothermal amplification reaction;Using lateral flow test strip or agarose gel electrophoresis or adding SYBR Green I dye to amplification product detects amplification product, if reaction is positive or there is expected amplification band or fluorescence, then consider that raw milk contains heat-resistant enzyme producing pseudomonas.The LAMP method of the application has the advantages of high sensitivity, strong specificity, rapid detection, simple operation, and can be used for the on-site rapid detection of raw milk in heat-resistant protease producing pseudomonas by field production front-line technical personnel.

The invention belongs to the technical field of biology, and relates to a method for determining helicase activity based on an SYBR Green I. The method comprises the following steps: 1) preparing a reaction system and setting a negative control, the reaction system comprising an MOPS buffer solution, ATP, DTT, MnCl2, BSA, double-stranded oligonucleotide and helicase; (2) adding SYBR Green I into the reaction system, and measuring a fluorescence signal; 3) carrying out a reaction on the reaction system; 4) after the reaction of the reaction system is completed, determining a fluorescence signal; and 5) calculating the ratio of the fluorescence signals before and after the reaction, and measuring the activity of the helicase by taking the ratio of negative control as a reference value 1. The method disclosed by the invention is simple to operate, low in cost, high in accuracy and good in reproducibility, and is particularly suitable for high-throughput drug screening application of the helicase activity inhibitor.