Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

28 results about "Stem-loop" patented technology

Stem-loop intramolecular base pairing is a pattern that can occur in single-stranded DNA or, more commonly, in RNA. The structure is also known as a hairpin or hairpin loop. It occurs when two regions of the same strand, usually complementary in nucleotide sequence when read in opposite directions, base-pair to form a double helix that ends in an unpaired loop. The resulting structure is a key building block of many RNA secondary structures. As an important secondary structure of RNA, it can direct RNA folding, protect structural stability for messenger RNA (mRNA), provide recognition sites for RNA binding proteins, and serve as a substrate for enzymatic reactions.

Super-sensitive molecule system for biological signal amplification, detection method and application

The invention provides a super-sensitive molecule system for biological signal amplification, a detection method and application, and belongs to the technical field of biological sensing. The super-sensitive molecular system for biological signal amplification is composed of a hairpin probe H and gold nanoparticles (TS (at) CP (at) loading a trajectory chain TS and a capture chain CP (CP), a traditional DNA walking machine walking chain is split into the hairpin probe H and the capture chain CP which are spatially isolated, and a target-dependent activation mechanism is constructed: when no target exists, the hairpin probe H realizes self-protection through a self-folding stem-loop structure; non-specific binding with the capture chain CP / trajectory chain TS is blocked; after the target is beaten on the clamping probe H, the exposed sequence of the clamping probe H is hybridized with the capture chain CP to form a complete walking chain, and a signal amplification reaction driven by cutting incision enzyme is triggered, so that the problem of false positive caused by co-localization of the walking chain and a track chain interface is fundamentally solved.
Owner:TIANJIN UNIV

Construction method of PFLAMP-Cas12b one-tube method reaction system based on single-chain stem loop mediation

The invention relates to the technical field of nucleic acid detection, and discloses a construction method of a PFLAMP-Cas12b one-tube method reaction system based on single-stranded stem loop mediation. The construction method comprises the following steps: designing an LAMP amplification primer; designing an sgRNA sequence of a single-stranded loop region in a targeted LAMP amplification product; and constructing a reaction system containing the LAMP amplification primer, the Cas12b protein, the sgRNA sequence and the fluorescence report probe. A single-chain stem-loop structure formed in an LAMP amplification product is used as a specific activation target of the Cas12b protein, PAM dependence of the Cas12b protein on double-chain DNA targeting in traditional detection is avoided, and the bottleneck that sgRNA design is limited due to lack of natural PAM sites in a highly conserved gene area is effectively overcome; and non-specific background amplification interference induced by artificially introducing a PAM sequence into the primer is eliminated, and the detection accuracy is improved.
Owner:NANJING AGRICULTURAL UNIVERSITY

Recombinant nucleic acid molecule for preparing scar-free circular RNA based on stem-loop structure and application of recombinant nucleic acid molecule

PendingCN121991944AAvoid unpredictable impactscyclization promotionOrganic active ingredientsWhole-cell/virus/DNA/RNA ingredientsRibosomeCircular RNA
The invention provides a preparation method for preparing a scar-free circular RNA (Ribonucleic Acid), a recombinant nucleic acid molecule for preparing the scar-free circular RNA and application of the recombinant nucleic acid molecule. The recombinant nucleic acid molecule based on the IRES stem-loop structure provided by the invention can be used for preparing a circular nucleic acid molecule in which an exogenous sequence is completely eliminated, and any sequence of IRES is not changed, so that the unpredictable influence of IRES mutation on recruitment of ribosome functions is avoided.
Owner:HANGZHOU INSTITUTE OF MEDICAL SCIENCES CHINESE ACADEMY OF SCIENCES

A modified crRNA, a light-controlled nucleic acid detection system, a kit and application

The application discloses a modified crRNA, a light-controlled nucleic acid detection system, a kit and application, and belongs to the cross field of biotechnology, intelligent sensing and molecular diagnosis. In view of the technical defects of strong target sequence dependence and high ultraviolet irradiation requirement of the existing light-controlled CRISPR technology, the application innovatively introduces a photosensitive protection group 6-nitropiperidin oxymethyl (NPOM) at a specific key node of a stem loop skeleton of crRNA maintaining conformation. In the constant temperature amplification stage, preferred double-site cooperative modification can transiently inhibit RNP complex assembly to realize target non-interference enrichment; subsequently, only 10 mW / cm 2 of extremely low intensity ultraviolet light irradiation for 30 seconds can restore the crRNA conformation and activate the trans cleavage. The preferred technical scheme of the application can eliminate the target sequence limitation, realizes a detection limit of as low as 2 copies in a single reaction tube, and the result can be obtained within 15 minutes. The system is widely applicable to rapid diagnosis of infectious agents, high-specificity typing of single nucleotide polymorphism and portable intelligent molecular diagnosis terminal.
Owner:AGRICULTURAL GENOMICS INSTITUTE AT SHENZHEN CHINESE ACADEMY OF AGRICULTURAL SCIENCES (SHENZHEN BRANCH GUANGDONG LABORATORY FOR LINGNAN MODERN AGRICULTURE)

Double-stranded nucleic acid inhibitor molecules with shortened sense strands

ActiveUS12529053B2Activity regulationDNA/RNA fragmentationDiseaseNucleic acid inhibitor
Provided herein are double-stranded nucleic acid inhibitor molecules having a shortened sense strand with a stem loop structure and an antisense strand. Also provided are methods and compositions for reducing target gene expression and methods and compositions for treating a disease of interest.
Owner:NOVO NORDISK AS

Stable RNA compositions with stem loop, and methods thereof

PCT designated stageWO2025188687A8Activity regulationDNA/RNA fragmentationRNA Ligase (ATP)Biochemistry
The present invention provides, among other things, linear mRNA compositions comprising a poly A tail and a stem loop structure downstream to the poly A tail. Also provided herein are methods of producing mRNA by ligating a stem loop exonuclease blocker using a double-stranded RNA ligase.
Owner:BEAM THERAPEUTICS INC

Enzyme substrates for detecting shiga toxins

The present invention relates to an oligonucleotide comprising: a) a nucleotide sequence of a broom-kojin-ricin loop (SRL) of a eukaryotic / mammalian 60S ribosomal subunit wherein the SRL nucleotide sequence comprises at least one adenine; and b) at least one cut-dependent marker; wherein the oligonucleotide is a single strand. Preferably, the oligonucleotides form at least one loop structure or stem-loop structure. In another aspect, the invention relates to a method of detecting active shiga toxin in a sample, the method comprising the steps of: a) providing at least one oligonucleotide according to the invention; b) providing a sample of shiga toxin to be detected; c) incubating the sample with at least one single-stranded oligonucleotide; and d) detecting a labeled signal, wherein the signal indicates the presence of Shiga toxin in the sample. The invention additionally comprises a kit comprising at least one oligonucleotide according to the invention.
Owner:ROBERT KOCH INSTITUTE +1

Prime editing guide RNA, prime editing system, and use thereof

Provided is a prime editing guide RNA (pegRNA), aprime editing (PE) system, and use thereof, pertaining to the technical field of prime editing. The prime editing guide RNA provided herein positions the reverse transcriptase template and primer binding site (RTT-PBS) at the stem loop 2 region of the sgRNA scaffold based on the canonical pegRNA design. This configuration not only effectively mitigates degradation of the RTT-PBS but also increases its binding capability to Cas9. Consequently, this design preserves the efficiency of prime editing without interference.
Owner:WESTLAKE UNIV

RNA aptamers that bind to ASP7967 or its analogs

An object of the present invention is to provide RNA aptamers capable of binding to ASP7967 or analogs thereof. The RNA aptamer of the present invention is an RNA aptamer that binds to ASP7967 or an analog thereof, and has the sequence: -X1-L1-X2-L2-X3- (wherein X1 has the sequence Y1GY2GY3Y4Y5; L1 is a first stem-loop nucleotide sequence comprising a first stem region, a first loop region, and a second stem region, wherein the first stem region and the second stem region are two or more base pairs in length and are substantially complementary to each other; X2 is A, G, C, or U; L2 is a second stem-loop nucleotide sequence comprising a third stem region, a second loop region, and a fourth stem region, wherein the third stem region and the fourth stem region are two or more base pairs in length and are substantially complementary to each other; the first base in the third stem region is G and the last base in the fourth stem region is C; and X3 has the sequence UY6). , Y1, Y2, Y3, Y4, Y5, and Y6 are each independently A, G, C, or U), or a third stem loop region comprising the sequence: -S1-X2-L2-X3-L3-X1-S2- (wherein S1 and S2 are each independently A, G, C, or U, and S1 and S2 can form base pairs or wobble base pairs with each other, and L3 comprises a fifth stem region, a third loop region, and a sixth stem region). the fifth stem region and the sixth stem region are one or more base pairs in length and are substantially complementary to each other, and X1, X2, X3, and L2 are as defined above), or the sequence: -S3-X3-L3-X1-L1-X2-S4- (wherein S3 is C, S4 is G, and X1, X2, X3, L1, and L3 are as defined above).
Owner:OKINAWA INST OF SCI & TECH SCHOOL

Novel highly efficient prime editor and applications thereof

The application belongs to the technical field of biological medicine, and discloses a gene leading editing system, which comprises a carrier, the carrier contains a gene coding pegRNA and a gene coding fusion protein, the pegRNA comprises sgRNA, reverse transcription template RTT, primary binding site PBS and RNA stem loop structure, and the fusion protein is a fusion protein of Cas9 nickase or a variant thereof and reverse transcriptase. The application develops sPEs by adding an RNA neck ring structure to the 3' end of the pegRNA, develops tPEs by allowing the 3' end of the pegRNA to bind to Cas9, so as to improve the stability of the Cas9 / pegRNA complex, and further improve the editing efficiency of different genomic sites in different cells.
Owner:SHANGHAI TECH UNIV

Recombinant plasmid containing stuffer DNA

The present invention provides a recombinant plasmid which includes: (a) an adeno-associated virus (AAV) genome that includes two AAV ITR sequences and a target gene sequence flanked by the AAV ITR sequences; and (b) stuffer DNA which comprises a nucleotide sequence that does not include an inverted repeat sequence capable of forming a stem loop.
Owner:THE UNIV OF TOKYO +1

Synthetic guide RNA, compositions, methods and uses thereof

The present invention provides, inter alia, a method for producing synthetic RNA using a self-template method. For example, in some embodiments, generating synthetic gRNA comprises contacting a first RNA with a second RNA, where the first RNA and the second RNA comprise at least five complementary RNA nucleotides, and where the contacting forms a stem structure or a stem-loop structure; and ligating the first RNA and the second RNA (i) within the stem structure or (ii) at the end of the stem structure with a ligase, thereby forming a loop at the end of the stem structure.
Owner:BEAM THERAPEUTICS INC

Compositions for immunostimulatory small RNA structures and methods of use thereof

Immunostimulatory molecules and methods of use thereof are provided. Compositions include at least one immunostimulatory RNA molecule having a stem loop containing one or more AAAA adenine rich regions and / or one or more CAA motif regions. Methods include administering said compositions to a subject in need thereof for treating viral infection and / or increasing IFN expression.
Owner:WASHINGTON UNIV IN SAINT LOUIS

A live cell imaging system based on CRISPR-dCas12a and fluorescent RNA aptamer and application thereof

PendingCN122503446AAptamerLive cell imaging
The application belongs to the technical field of live cell imaging, and particularly relates to a live cell imaging system based on CRISPR-dCas12a and fluorescent RNA aptamer and application thereof. The application discloses a CRISPR LiteColor system, which mainly comprises CRISPR-dCas12a and crRNA fused with fluorescent RNA aptamer. When dCas12a and the modified crRNA are cooperatively targeted to a target site of a genome, and a corresponding small molecule fluorescent dye is added, the visualization imaging of the target gene site can be realized. The system embeds the fluorescent RNA aptamer into the stem loop structure region of the crRNA, and only relies on a single crRNA to target and recognize the specific site of the TTTV type PAM sequence in the genome, has the characteristics of autonomous degradation and low cell transfection load, and greatly simplifies the experimental operation process on the basis of ensuring high specificity of targeted recognition.
Owner:SUN YAT SEN UNIV +1

Absolute quantitative detection method for engineering modified exosome shRNA (short hairpin Ribonucleic Acid)

The invention provides a detection method for absolute quantification of engineering modified exosome shRNA (short hairpin Ribonucleic Acid), and relates to a method for detecting the expression quantity of shRNA loaded by the engineering modified exosome. According to the method, aiming at the current technical situation that quantitative detection of shRNA in engineered exosomes lacks a standardized scheme, an absolute quantitative system based on combination of stem-loop reverse transcription and a standard substance is established, and the method has relatively high quantitative accuracy and repeatability. The method not only can be used for evaluating the RNA loading efficiency under different engineering loading strategies, but also can be used as a key quality attribute of an engineering exosome product, and is used for batch consistency evaluation and quality control in a large-scale preparation process. Meanwhile, the method can be used as an important reference for determining the in-vivo administration dosage and carrying out pharmacokinetics and safety evaluation.
Owner:P S K BIOSCIENCE CO LTD

Detection of gene loci with polychromatic CRISPR-associated protein 9

A C9orf72 DNA repeat expansion can be detected using a CRISPR Arrayed Repeat Detection System (CARDS). Based upon the compositions and methods supporting this platform primary cell cultures and / or blood cell smears can be tested under conventional clinical diagnostic laboratory conditions to diagnose genetically-based diseases having DNA repeat expansions, including but not limited to ALS. dCas9 constructs are also contemplated as having fluorescent proteins bound to any or all stem loop sequences, wherein detection of a plurality of dCas9 constructs having different colored fluorescent proteins can simultaneously detect at least six (6) different gene target loci.
Owner:UNIVERSITY OF CENTRAL FLORIDA RESEARCH FOUNDATION INC +1

Hot spot self-assembly colorimetric-Raman sensing platform and escherichia coli detection method

The invention discloses a hot spot self-assembly colorimetric-Raman sensing platform and an escherichia coli detection method, the hot spot self-assembly colorimetric-Raman sensing platform comprises an isothermal amplification system, a CRISPR-dCas9 system, GNPs-probe and SA-GNPs, a target bacterial gene is taken as a DNA template, RPA amplification is carried out through the isothermal amplification system, and a double-chain amplification product modified by terminal biotin is obtained; the CRISPR-dCas9 system is used for targeted recognition of a double-chain amplification product modified by terminal biotin to form a composite product; gNPs-probe is composed of gold nanoparticles, a Raman signal molecule and a DNA probe, and the GNPs-probe is combined with the stem-loop structure of the sgRNA of the composite product through the DNA probe; sA-GNPs is combined with the biotin of the composite product through streptavidin; gNPs-probe and SA-GNPs are assembled on the composite product, so that a colorimetric-Raman sensing platform for detecting target bacteria is formed. According to the present invention, the cross validation of the generated colorimetric, ultraviolet and Raman multi-mode signals is adopted to improve the result reliability, the isothermal amplification and the self-assembly hot spot are adopted to enhance the multiple sensibilization detection signal, and the specificity is enhanced based on the specific primer group and the CRISPR-dCas9 system mediated secondary recognition, such that the rapid and accurate detection of the bacteria in the actual sample is finally achieved.
Owner:ANHUI MEDICAL UNIV

Use of serum tsRNA in preparation of non-small cell lung cancer early diagnosis or detection reagent

The application discloses application of serum tsRNA in preparation of a non-small cell lung cancer early diagnosis or detection reagent, and is characterized in that the serum tsRNA is tsRNA-Asp-5-0013 sequence, the stem loop structure reverse transcription primer sequence is CACTCAACAGACCTGCACGAGCACGAC AGTCACAAGAGGTGCAGGTCTGT, the fluorescence quantitative PCR specific amplification upstream primer is GAGAACACTGACAGCACGAG, and the downstream primer is CCTTCCTCGTTAGTATAGT. The application also provides application of the serum tsRNA in preparation of non-small cell lung cancer and benign tumor, tumor size, non-small cell lung cancer N0 and N1-3 stage, M0 and M1 stage and TNM stage diagnosis, and has high specificity and sensitivity.
Owner:NINGBO UNIV

Nucleic acid aptamer aiming at ricin and / or abrus precatorius toxin and application of nucleic acid aptamer

The invention relates to the technical field of biological medicine, in particular to a nucleic acid aptamer for ricin and / or abrus precatorius toxin and application of the nucleic acid aptamer. Based on a toxicity damage mechanism of ricin and abrus precatorius toxin, starting from reasonable drug design, a nucleic acid chemical modification strategy is adopted, a nucleic acid aptamer with a stable stem-loop conformation is designed, and the adopted sequence design and modification core strategy comprises but is not limited to locked nucleic acid modification of a conserved region GAGA; a stable conformation design (a plurality of CG units) of a'stem 'region on both sides of the'loop'; performing sulfo-modification on a sequence skeleton; the tail end of the sequence is modified by chemical functional groups (such as cholesterol and biotin). The nucleic acid aptamer provided by the invention has good in-vivo and in-vitro pharmacodynamic activity, and can realize remarkable animal protection rate and prolonged survival time under lethal dose.
Owner:THE FIRST MEDICAL CENT CHINESE PLA GENERAL HOSPITAL

Gene plasmid combining ZDHHC5 with NOD1 and application thereof

The invention belongs to the technical field of gene engineering, and discloses a plasmid targeting a ZDHHC5 gene in order to solve the problems of transient effect, low knock-down efficiency and high off-target rate of the existing siRNA technology. The plasmid comprises a DNA sequence for expressing shRNA, preferably a SEQ ID NO: 1 site, adopts a stem-loop structure 'CTCGAG' to improve stability, and integrates green fluorescent protein and puromycin resistance genes on the basis of a lentiviral vector to realize visual screening and long-term expression after transfection. And by optimizing the shRNA design and the special transfection process, the specificity and repeatability are remarkably enhanced. Experiments show that the plasmid can efficiently inhibit ZDHHC5 expression, effectively inhibit proliferation in Huh-7 cells and induce apoptosis.
Owner:THE SECOND AFFILIATED HOSPITAL OF CHONGQING MEDICAL UNIV

Kit for detecting specific early diagnosis of focal stage glomerulosclerosis

PendingCN121951034AStrong specificityIncrease abundanceMicrobiological testing/measurementDNA/RNA fragmentationFocal segmental glomerulosclerosisBioinformatics
The invention discloses a kit for detecting specific early diagnosis of focal stage glomerulosclerosis, through innovative primer probe design and detection system optimization, the core advantage of the kit is that six miRNA markers, namely miR-125b, miR-186, miR-193a-3p, miR-17, miR-451 and miR-19b, which are verified by a multi-center queue are innovatively integrated; six groups of specific reverse transcription primers based on a stem-loop structure are successfully designed. According to the kit for specific early diagnosis of focal segmental glomerulosclerosis, aiming at the technical defects of low abundance, high sequence homology, poor multi-index detection compatibility and the like of focal segmental glomerulosclerosis (FSGS)-related miRNA, systematic optimization of a stem-loop reverse transcription method and a real-time fluorescent quantitative PCR (qPCR) two-step method is carried out, so that the specificity of the focal segmental glomerulosclerosis is improved, and the specificity of the focal segmental glomerulosclerosis is improved. The detection efficiency, the sensitivity and the specificity are obviously improved.
Owner:GUANGZHOU ZHONGZHI MEDICAL LAB CO LTD

A microRNA marker composition and detection reagent, detection kit for colorectal cancer diagnosis

The application provides a microRNA marker composition and detection reagent and kit for colorectal cancer diagnosis, the microRNA comprising miR-135b-5p, miR-29a-3p and miR-18a-5p. The application sets the target of multiple primer probe groups as miRNA related to colorectal cancer, so that the composition of the application can effectively amplify miRNA. Meanwhile, the primer probe group of the application comprises a stem loop reverse transcription primer, a forward primer, a reverse primer and a probe, reverse transcription to generate cDNA and probe method qPCR can be completed in one tube in one step, and then detection is realized, and the operation is simple.
Owner:SANSURE BIOTECH INC

Sense-and-Response of Proteins, Peptides, and Small Molecules Using Ligand-Induced Dimerization Activating RNA Editing (LIDAR)

The present disclosure provides a method for ligand induced ADAR (adenosine deaminase acting on RNA) mediated expression of an RNA coding sequence, the method comprising contacting a ligand with a cell associated LIDAR meditated expression system comprising: 1) an output RNA, 2) a stem loop binding protein and 3) an RNA editing protein; to express the RNA coding sequence. The present disclosure also provides compositions and kits for practicing the methods disclosed herein.
Owner:THE BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIOR UNIV

Methods and compositions for linking RNA stem loops

Provided herein are, inter alia, methods and compositions for linking RNA stem loops. The methods include linking a first RNA stem loop and a second RNA stem loop by way of a preQ1 linking compound.
Owner:RGT UNIV OF CALIFORNIA

An aptamer sensor and preparation and application thereof

The application relates to an aptamer sensor and preparation and application thereof. The aptamer sensor comprises an aptamer chain, an auxiliary chain, an LH1 chain, an LH2 chain and a buffer system, the LH1 chain is formed by assembling an L chain and a plurality of hairpin probes H1 through base complementary pairing, and the LH2 chain is formed by assembling an L chain and a plurality of hairpin probes H2 through base complementary pairing; the hairpin probe H1 comprises a first hairpin sequence section and an L chain complementary section, the first hairpin sequence section participates in forming a stem loop structure of the hairpin probe H1 through intrachain base complementary pairing, meanwhile, the first hairpin sequence section serves as a core region which is specifically complementary to the auxiliary chain, can be combined with the auxiliary chain and triggers a sticky end-mediated strand displacement reaction, and realizes opening of a hairpin secondary structure; the hairpin probe H2 comprises a second hairpin sequence section and an L chain complementary section, and the first hairpin sequence section and the second hairpin sequence section are specifically complementary to each other.
Owner:GUANGDONG POLYTECHNIC OF ENVIRONMENTAL PROTECTION ENG

A nucleic acid detection method and kit for distinguishing pathogen DNA / RNA

The application discloses a nucleic acid detection method and kit for distinguishing pathogen DNA / RNA, and a section of artificial sequence is introduced at the 5' end of a primer to improve the specificity of the primer, the artificial sequence is not complementary to a template, and the artificial sequence is complementary to the 3' end sequence of the primer to form a stem loop structure. When the template is not completely complementary to the 3' end of the primer, the primer exists in the form of the stem loop structure, and when the template is completely complementary to the 3' end of the primer, the stem loop structure is unbound to perform reverse transcription. When RNA is amplified, the synthesized cDNA is provided with the artificial sequence, the primer is completely complementary to the cDNA during amplification, 7-11 bases at the 3' end of the primer are complementary to the template, and deoxyuracil is used to replace deoxythymine base at the 3' end of the primer. According to the application, the Tm value of the primer binding is relatively low when DNA is amplified under a certain annealing temperature, so that the DNA cannot be amplified, and when RNA is amplified, the 5' end of the reverse transcription primer is provided with the artificial sequence, so that the synthesized cDNA is provided with the artificial sequence, the primer can be completely complementary to the cDNA during amplification, and the RNA can be accurately detected.
Owner:HANGZHOU KMB BIOTECH

Diagnostic target and detection primer for wood infection of pine wood nematodes and application of diagnostic target and detection primer

The invention discloses a diagnosis target and a detection primer for wood infection of pine wood nematodes and application of the diagnosis target and the detection primer. According to the invention, through data analysis and comparison of miRNA changes with significant differences between a control group and an experimental group at different time points, six miRNAs which only exist in an inoculation group and do not exist in the control group are finally screened out; furthermore, a specific stem-loop DNA probe is designed by taking the six miRNAs as target genes to establish a pine wood nematode detection method, and according to a sensitivity detection result, the novel-miR574 with a nucleotide sequence as shown in SEQ ID No.13 has optimal detection sensitivity when being used as a diagnosis target for wood infection with pine wood nematode diseases; specificity test results show that whether a forest sample is infected with pine wood nematode or not can be specifically detected by using the novel-miR574 as the diagnosis target of the forest infected with the pine wood nematode disease; the invention has an application prospect in prevention and treatment of pine wood nematodes.
Owner:INST OF FOREST ECOLOGY ENVIRONMENT & PROTECTION CHINESE ACAD OF FORESTRY